Preprint
Article

This version is not peer-reviewed.

Activation of BDNF-TrkB Signaling in Specific Structures of the Sheep Brain by Kynurenic Acid

A peer-reviewed version of this preprint was published in:
Cells 2024, 13(23), 1928. https://doi.org/10.3390/cells13231928

Submitted:

15 October 2024

Posted:

16 October 2024

You are already at the latest version

Abstract

Fluctuations in kynurenic acid (KYNA) and brain-derived neurotrophic factor (BDNF) levels in the brain reflect its neurological status. The aim of the study was to investigate the effect of transiently elevated KYNA concentration in the cerebroventricular circulation on the expression of BDNF and its high-affinity tropomyosin-related kinase receptor B (TrkB) in specific structures of the sheep brain. Intracerebroventricularly cannulated anestrous sheep were subjected to a series of four 30-min infusions of KYNA: 4×5 μg/60 μL/30 min (KYNA20, n=6) and 4×25 μg/60 μL/30 min (KYNA100, n=6) or a control infusion (n=6), at 30-min intervals. Sections of the hippocampal CA3 field, amygdala (AMG), prefrontal cortex (PCx), and the hypothalamic medial-basal (MBH) and preoptic (POA) areas were dissected from the brain immediately after the experiment. The highest concentration of BDNF protein was found in the CA3 field (P<0.01), which was 8-fold higher than in the AMG and 12-fold higher than that in the PCx (MBH and POA were not analyzed). The most pronounced BDNF mRNA expression was observed in the MBH followed by the PCx, POA, AMG and CA3, while the highest abundance of TrkB mRNA was recorded in the AMG followed by the MBH, PCx, CA3 and POA. KYNA increased (P<0.05-P<0.01) BDNF protein levels and the expression of its gene in the brain structures examined, with the effect varying by dose and brain region. KYNA, particularly at the KYNA100 dose, also increased (P<0.01) TrkB gene expression, except for the AMG, where the lower KYNA20 dose was more effective (P<0.01). These findings suggest a positive relationships between KYNA levels in the cerebroventricular circulation and BDNF-TrkB expression in specific brain regions in a sheep model. This indicates that a transient increase in CSF KYNA concentration can potentially restore BDNF production, whose deficiency underlies numerous neurological disorders.

Keywords: 
;  ;  ;  ;  

1. Introduction

Brain-derived neurotrophic factor (BDNF) is the dominant member of the neurotrophin protein family, which also includes nerve growth factor, neurotrophin-3 and neurotrophin-4 [1]. Neurotrophins regulate neuronal survival and neuroplasticity, playing important roles in the growth, differentiation and repair of neurons [1,2]. BDNF has also been shown to modulate neuronal transmission in brain structures critical for learning and memory processes, while exerting neuroprotective properties in adverse conditions, such as glutamatergic stimulation, cerebral ischemia, hypoglycemia or neurotoxicity [3,4]. Along with its signaling partners and other trophic factors, such as glial-derived neurotrophic factor and vascular endothelial growth factor, BDNF influences neurogenesis and numerous accompanying processes like gliogenesis and angiogenesis [2,5]. In mammals, the capacity for neurogenesis in the brain persists throughout postnatal and adult life, primarily in two neurogenic niches located in the subgranular zone (SGZ) of the hippocampal dentate gyrus (DG) and the subventricular zone (SVZ) of the lateral ventricles [6]. Lower innate levels of neurogenesis have also been found in other brain regions, including the basal forebrain, striatum, amygdala, substantia nigra and hypothalamus [7,8]. Adult neurogenesis is believed to play an important role in processes such as learning and memory, emotions, stress, depression and response to injury [9]. This process can be influenced by environmental factors and experiences, indicating that newly generated neurons can mediate interactions with the environment [10,11]. Disruption or inhibition of adult neurogenesis has been linked to changes that may impair neuronal functions and, consequently, the development of dementia or depression [12].
BDNF is abundantly expressed in the immature and adult mammalian brain, and its messenger RNA (mRNA) and protein levels in various structures increase dramatically during the postnatal period [13]. The neurotrophin is initially synthesized as a precursor protein (pro-BDNF), which is then cleaved into its mature form and stored in secretory vesicles. The co-localization of the cleaved pro-peptide region and mature BDNF in secretory vesicles of hippocampal neurons indicates that this conversion occurs directly within neurons [14]. Mature BDNF is released locally from both axonal and dendritic compartments in a process dependent on neuronal activity [15]. The neurotrophic effects of BDNF are primarily mediated by its high-affinity tropomyosin-related kinase receptor B (TrkB), while pro-BDNF binds preferentially to p75NTR. Activation of BDNF-TrkB signaling stimulates different intracellular pathways that regulate the expression of genes encoding proteins involved in neural plasticity, stress resistance and cell survival [3,16].
Studies in different animal models and humans show that abnormalities related to BDNF synthesis and secretion, causing a significant decrease in its levels in the brain, are associated with many neurological disorders and central nervous system (CNS) diseases [12,17]. Decreased levels of BDNF protein and mRNA expression have been observed in the brains of individuals suffering from Alzheimer’s and Huntington’s diseases, as well as depression and schizophrenia [17,18,19,20]. These abnormalities may not be directly related to the expression of BDNF, but may also result from age-related alterations in the production of endogenous substances that modulate the activity of the excitatory glutamatergic system. Among such substances is kynurenic acid (KYNA), a neuroactive tryptophan (TRP) metabolite, whose fluctuating levels in the CNS may be related to neurotrophic activity and the course of adult neurogenesis. While KYNA brain levels are elevated during the perinatal period in mammals, extracellular concentrations in adults generally remain in the low nanomolar range [21]. However, the reported elevations in KYNA concentration in the adult brain have been associated with a broad spectrum of neurological and psychiatric disorders, particularly those linked to excitotoxicity [22]. KYNA is the only known endogenous non-selective antagonist of all ionotropic receptors for excitatory amino acids in the mammalian brain [22]. Consequently, experimentally induced increases in KYNA levels in the brain have been shown to reduce toxic excitatory neurotransmission and inhibit some neurodegenerative changes [23]. On the other hand, high levels of KYNA were demonstrated to impair cognitive functions, as observed in schizophrenia, while reducing KYNA concentrations enhanced cognitive ability in rodents [24]. The mechanisms underlying these beneficial and detrimental effects are complex and may involve various types of receptors (not only for excitatory amino acids), signaling pathways and neuroactive proteins, including BDNF [25].
The relationship between KYNA and BDNF in specific CNS pathologies remains unclear, and their interaction under physiological conditions is also poorly understood. Given this, the present study sought to examine the effect of transiently increased KYNA concentrations in the cerebroventricular circulation on the expression of BDNF and its receptor TrkB in specific areas of the sheep brain. These structures included the hippocampal CA3 field, amygdala (AMG) and prefrontal cortex (PCx), as well as the hypothalamic medial-basal (MBH) and preoptic (POA) areas. The sheep model was selected for the study, due to its higher degree of anatomical and structural homology to the human brain compared to commonly used smaller laboratory animals.

2. Materials and Methods

2.1. Animal Management

Eighteen Polish Longwool sheep (a breed showing reproductive seasonality), aged 1 year and weighing 55 ± 2 kg, were used in the experiment. The animals were bred at the Sheep Breeding Center of the Kielanowski Institute of Animal Physiology and Nutrition, Polish Academy of Sciences (Jablonna near Warsaw, Poland) under natural lighting conditions (52°N, 21°E). Sheep were fed twice daily according to their physiological status, with a diet based on pellet concentrate and hay, following the recommendations of the National Research Institute of Animal Production in Krakow-Balice (Poland), and the National Institute for Agricultural Research (France) [26]. During the experimental period, sheep were housed in individual pens with visual, olfactory and tactile contact, and were provided free access to water and mineral licks.

2.2. Third Ventricle (IIIv) Cannulation

One month before the experiment, the sheep underwent surgical implantation of a stainless-steel guide cannula into the third ventricle (IIIv) of the brain (outer diameter: 1.2 mm, frontal position: 31.0 mm). Implantation was performed under general anesthesia (xylazine: 40 mg/kg body weight, intravenously; xylapan and ketamine: 10-20 mg/kg body weight, intravenously; Bioketan, Vetoquinol Biowet, Pulawy, Poland), in accordance with the stereotaxic coordinate system for sheep hypothalamus [27] and the procedure described by Traczyk and Przekop [28]. The guide cannula was fixed to the skull with stainless-steel screws and dental cement, and the external orifice of the canal was sealed with a stylet. After surgery, the sheep were injected for 4 days with antibiotics (1 g streptomycin and 1,200,000 IU benzylpenicillin; Polfa, Poland) and analgesics (metamizole sodium: 50 mg/animal; Biovetalgin, Biowet Drwalew, Poland, or meloxicam: 1.5 mg/animal; Metacam, Boehringer Ingelheim, Germany). The correct positioning of the cannula in the ventricle was confirmed in all sheep by cerebrospinal fluid (CSF) efflux surgery and brain examination after slaughter.

2.3. Experimental Design and Tissue Collection

The experiment was performed in March during the natural anestrous season for this breed of sheep. The animals were randomly divided into three groups (n = 6 each) and infused into the IIIv with Ringer-Locke solution (RLs, control) or with one of two doses of KYNA (Sigma Chemical Co., St Louis, MO, USA) dissolved in RLs. The treatment consistent of a series of four 30-min infusions, at 30-min intervals, from 10:00 to 14:00. The selected KYNA doses: lower – 4 × 5 μg/60 μL/30 min (KYNA20), and higher – 4 × 25 μg/60 μL/30 min (KYNA100) were based on scientific literature [22,25]. All infusions were delivered using a BAS Bee microinjection pump (Bioanalytical Systems Inc., West Lafayette, IN, USA) and calibrated 1.0 mL gas-tight syringes. During the treatments, sheep were kept in pairs in the experimental room in comfortable cages, where they could lie down and to which they had been acclimatized for three days prior to the experiment. Immediately after the experiment, sheep were slaughtered after prior pharmacological stunning (xylazine 0.2 mg/kg body weight and ketamine: 3 mg/kg body weight, intravenously), and the brains were rapidly removed from the skull. Following the separation of the median eminence, each brain was sagittally sectioned into the cerebral hemispheres. The isolated blocks of the hypothalamus (cut to a depth of 2 mm) were then dissected into two regions: POA and MBH, according to the stereotaxic atlas of the ovine hypothalamus [27]. The hippocampal CA3 field and AMG were dissected from the medial temporal lobe of the right hemisphere as described previously [29]. Subsequently, approximately 2-3 mm-long sections, representing the PCx, were incised from the anterior frontal lobe of the cerebral cortex. All tissue incisions were performed on sterile glass plates placed on ice, and the collected structures were immediately frozen in liquid nitrogen and stored at -80°C.

2.3. Tissue BDNF Concentration Assay

Frozen sections (CA3, AMG and PCx) were mixed with radioimmunoprecipitation assay (RIPA) buffer (0.5 M Tris-HCl, pH 7.4, 1.5 M NaCl, 2.5% deoxycholic acid, 10% NP-40, 10 mM EDTA) (Merck, Darmstadt, Germany) at a ratio of 1:10 (tissue to reagents), and aprotinin as protease inhibitor (10 IU/mL, Sigma-Aldrich, Saint Louis, MO, USA). Each tissue sample was homogenized using a laboratory homogenizer and ceramic beads. After 30 minutes of incubation on ice, the homogenates were centrifuged at 12,000× g for 10 min at 4°C. The supernatants were then transferred to a new 1.5-mL Eppendorf tube and immediately stored at ̶ 80°C for later use. BDNF concentration in the homogenates was determined using the Biosensis Mature BDNF Rapid ELISA kit (BEK-2211, Biosensis Pty Ltd., Thebarton, Australia) according to the manufacturer’s protocol. Although originally designed for humans, mice, and rat studies, this ELISA kit is also suitable for quantifying mature BDNF in biological material obtained from other mammalian species, including sheep [30]. The assay demonstrated reproducibility with intra- and interassay CVs of 1% and 5%, respectively, with a minimum detectable dose of BDNF of less than 2 pg/mL. In addition, total protein concentration in the tissue homogenates was analyzed spectrophotometrically using the Bradford method and the Bio-Rad Protein Assay Kit II (Bio-Rad, Hercules, CA, USA), according to the manufacturer’s instructions. BDNF concentration in each homogenate sample was expressed as pg per mg of total protein.

2.4. Relative mRNA Abundance

Total RNA from hypothalamic and hippocampal tissues was isolated using the NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s protocol. The concentration and purity of isolated RNA were quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). RNA integrity was electrophoretically verified on a 1.5% agarose gel stained with ethidium bromide. The TranScriba Kit (A&A Biotechnology, Gdynia, Poland) was used to synthesize cDNA as per the manufacturer’s instructions with 1 µg of total RNA in a reaction volume of 20 µL. Quantitative polymerase chain reaction (qPCR) was performed using 5×HOT FIREPol® EvaGreen qPCR Mix Plus (Solis BioDyne, Tartu, Estonia). The PCR amplification mix contained 2 µL of cDNA template, 1 µL of primers (0.5 µL each at 10 pmol/mL), 3 µL of PCR Master Mix and 9 µL of dd H2O. The reaction conditions were as follows: initial denaturation at 95°C for 15 min, denaturation at 95°C for 15 s, annealing at 60°C for 20 s, and elongation at 72°C for 20 s (40 cycles). Specific primers for the expression analysis of BDNF and TrkB genes, as well as the endogenous control genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and peptidylprolyl isomerase C (PPIC), were designed using Primer3 software (The Whitehead Institute, Boston, MA, USA) (Table 1). Amplification specificity was further validated by electrophoresis of the obtained amplicons on a 2% agarose gel and visualized under a UV light camera. Data were analyzed using Rotor Gene 6000 v. 1.7 software (Qiagen, Hilden, Germany) employing a comparative quantification option and Relative Expression Software Tool, based on the PCR efficiency correction algorithm developed by Pfaffl et al. [31,32]. Gene expression levels were normalized to the geometric mean of the expression of reference genes. Endogenous con trol genes were assayed in each sample to compensate for variation in cDNA concentration and PCR efficiency between individual tubes.

2.5. Statistical Analysis

Initially, all data were assessed using the Shapiro-Wilk normality test and subsequently grouped into parametric and non-parametric groups. Tissue BDNF concentrations were analyzed using one-way analysis of variance (STATISTICA, Stat Soft, Tulsa, OK, USA), followed by the post-hoc Last Significance Difference test. Statistical evaluations of differences in mRNA expression levels for BDNF and its TrkB receptor in the examined brain structures between treatment groups were performed using non-parametric statistics, involving the Kruskal-Wallis test with multiple comparisons of average ranks and the Mann-Whitney U test for pairwise group comparisons. Differences were considered significant at p < 0.05, and all data are presented as mean ± standard error of the mean (SEM).
Table 1. Specific primers used for gene expression analysis.
Table 1. Specific primers used for gene expression analysis.
GENE PRIMERS (5’ – 3’) GENBANK
ACC. NO.
AMPLICON SIZE
BDNF F: CGTTGGCTGACACTTTTGAA
R: CGCAGCATCCAGGTAATTTT
XM_012143442.1 188
TRKB F: TGTCTGAGCTGATCCTGGTG
R: TATCTGCAGGTTTGCCAGTG
XM_012117231.2 155
GAPDH F: GGGTCATCATCTCTGCACCT
R: GGTCATAAGTCCCTCCACGA
NM_001190390.1 131
PPIC F: TGGAAAAGTCGTGCCCAAGA
R: TGCTTATACCACCAGTGCCA
XM_004008676.1 158
BDNF: brain-derived neurotrophic factor, TrkB: tyrosine kinase receptor B, GAPDH: glyceraldehyde-3-phosphate dehydrogenase, PPIC: peptidylprolyl isomerase C, F: forward primer, R: reverse primer. Real-time PCR amplification efficiency of target and reference genes was 96 – 100%.

3. Results

3.1. Tissue BDNF Concentration

Due to the larger volume of collected tissue material, BDNF concentration was examined in the CA3, AMG and PCx. Of these tissues, the highest concentration of the peptide was found in the hippocampal CA3 field (P < 0.001). BDNF concentration in the CA3 was 8-fold higher than the concentration recorded in the AMG and 12-fold higher than in the PCx (Figure 1).
Differences in BDNF levels between treatment groups are depicted for individual tissues in Figure 2A–C. Both doses of KYNA caused a significant increase in BDNF concentration in the hippocampal CA3 field (P < 0.01 and P < 0.05 for KYNA20 and KYNA100, respectively), compared to the control group (Figure 2A). The increase was more pronounced after infusion of KYNA20 compared to KYNA100 (P < 0.05). In contrast, KYNA20 had no significant effect on BDNF levels in the AMG and PCx, whereas KYNA100 significantly increased BDNF concentration in both tissues (AMG – P < 0.05, and PCx – P < 0.01) compared to controls (Figure 2B and 2C, respectively).

3.2. Relative Abundance of BDNF and TrkB mRNA

BDNF and TrkB gene transcripts were detected in the hippocampal CA3 field, AMG and PCx, as well as in the selected hypothalamic areas, the MBH and the POA. The highest BDNF mRNA expression was observed in the MBH, followed by the PCx, POA, AMG, and CA3. The highest abundance of TrkB mRNA was observed in the AMG, followed by the MBH, PCx, CA3, and POA.
The differences in the abundance of BDNF gene transcripts between the treatment groups are shown for individual tissues in Figure 3A–E. Both doses of KYNA caused a significant increase in the abundance of BDNF mRNA in the hippocampal CA3 field with P < 0.01 for KYNA20 and P < 0.05 for KYNA100 compared to the control group (Figure 3A). However, there was no significant difference in BDNF mRNA levels between the KYNA20 and KYNA100 groups. In the AMG (Figure 3B) and PCx (Figure 3C), only the KYNA100 dose significantly increased BDNF transcript abundance (P < 0.05 and P < 0.01, respectively) compared to controls. With respect to the MBH (Figure 3D), both KYNA doses had a comparable stimulatory effect (P < 0.01) on the expression BDNF transcript. However, the effect was more gradual in the POA (Figure 3E); while both doses significantly increased BDNF mRNA expression (P < 0.01) compared to controls, the KYNA100 group showed a higher (P < 0.05) BDNF transcript abundance than the KYNA20 group.
The differences in the abundance of TrkB gene transcripts between the treatment groups are shown for individual tissues in Figure 4A–E. Both doses of KYNA induced an increase in the TrkB transcript levels in the hippocampal CA3 field (Figure 4A), however, only the KYNA100-infused sheep showed a statistically significant increase (P < 0.01) compared to controls. With respect to the AMG (Figure 4B), the KYNA20 dose proved most effective, significantly increasing (P < 0.01) TrkB mRNA levels. A differential response to KYNA infusion was observed in PCx tissue (Figure 4C), as both doses significantly (P < 0.01) increased TrkB mRNA expression compared to the control, but the transcript abundance was higher (P < 0.05) in the group of sheep treated with KYNA100 than those administered KYNA20. Intracerebroventricular KYNA infusion also exerted a stimulatory effect on TrkB mRNA expression in various areas of the hypothalamus. Both KYNA doses caused a significant (P < 0.01) increase in TrkB transcript abundance in the MBH (Figure 4D) compared to controls. In the POA (Figure 4E), however, a significant increase (P < 0.01) in transcript levels occurred only in response to the KYNA100 dose.

4. Discussion

Many therapeutic agents used to treat various CNS disorders and diseases have been shown to affect BDNF signaling. It appears that beneficial changes in neurotrophin expression can also be induced by modulating the levels and activity of endogenously derived compounds within the CNS. The present work revealed a positive association between increasing KYNA levels in the CSF and the expression of BDNF and its specific receptor TrkB in various brain structures responsible for vital, cognitive and psychological functions. Most of these structures are located in close proximity to the ventricular system, and due to the multidirectional CSF circulation [22,33], may be easily exposed to infused KYNA. Although doses of administered KYNA appear to exceed physiological concentrations described for the mammalian brain [25,34], it is worth noting that a significant portion of KYNA may flow out of the third ventricle with the mainstream and be absorbed into capillaries, e.g. in the median eminence, other circumventricular organs or the choroid plexus. Research has demonstrated that micromolar concentrations of KYNA in the cerebroventricular circulation in sheep can trigger various receptor-activated responses in the targeted tissues [23,30].
One key finding of our study is the high concentration of BDNF protein in the CA3 field of the sheep hippocampus, despite the relatively lower abundance of BDNF mRNA in the same region. This observation is consistent with previous result in rats, where both complementary DNA (cDNA) labeling and BDNF-immunoreactivity were shown to be relatively dense in nearly all cells of this hippocampal region [35]. Rodent studies have further demonstrated that both mossy fibers (MF), originating from DG presynaptically, and CA3 pyramidal cells postsynaptically, contain elevated levels of BDNF and also express TrkB [35,36]. According to Griego and Galvan [37], BDNF-TrkB signaling plays a fundamental role as a homeostatic regulator controlling the intrinsic excitability of the CA3 network. The observed discrepancy between BDNF mRNA and protein levels, likely reflects the different locations of synthesis sites in the nerve cells and the presence of anterograde axonal transport [35,36]. The relatively lower levels of available mRNA transcripts for BDNF and its receptor in relation to other structures may indicate the high tissue requirement for BDNF protein and its involvement in signaling processes. Nevertheless, the high concentrations of BDNF in the CA3 homogenate found in our study reflect a high quantities of mature peptide both stored and released locally.
In mammals, the hippocampal CA3 region plays a specific role in memory processes, spatial orientation, and is highly susceptible to neurodegeneration. The pyramidal neurons, which largely define the morphology of the CA3 field, form extensive dendritic trees characterized by high plasticity. This internal connectivity enables processing of input signals from the cortex (via the perforant path) and DG (via MF), as well as excitatory transmissions to a large number of neurons in the CA1 field (via Shaffer collaterals) and other adjacent hippocampal areas [38]. Ji and coworkers [39] demonstrated that BDNF could induce neurite elongation or branching through distinct signaling cascades, depending on the concentration of BDNF in the extracellular space. Moreover, BDNF was shown to promote neurite differentiation to axons in vivo and was required for axon formation in cultured hippocampal neurons [40,41]. Extensive evidence indicates that activity-induced increases in long-term synaptic potentiation (LTP), a cellular correlate of learning and memory, are strongly linked to efficient BDNF-TrkB signaling [42]. Studies in TrkB- or BDNF-deficient mice have shown that impaired BDNF-TrkB signaling leads to a significant downregulation of LTP in the hippocampus; on the other hand, such an insufficiency can be reversed by restoring BDNF gene expression or by administering recombinant BDNF [42]. While the detailed mechanisms by which BDNF modulates LTP in the hippocampus are beyond the scope of this work, it is noteworthy that BDNF is also expressed in hippocampal astrocytes. This glial expression may contribute to enhancing neuronal firing efficiency to some extent [43]. It should be mentioned that the postnatal generation of new neurons (adult neurogenesis) observed in the DG is another morphological correlate of neuronal hippocampal plasticity [6]. In the SGZ, newborn cells migrate a short distance to the inner layer of granule cells, where they differentiate into granule neurons. Subsequently, they extend long axonal projections along the MF pathway and reach the target CA3 pyramidal cell layer. Various growth and trophic factors, including BDNF, significantly contribute to the proliferation, survival and development of newborn neurons in the adult hippocampus and other neurogenic regions [44].
Both the hippocampus and AMG are integral components of the limbic system, connected through an extensive and reciprocal network, reaching, e.g., the hypothalamus and frontal cortex. In sheep, as in other mammals, the AMG consists of groups of nuclei clustered mainly in three subregions: centromedial, basolateral and cortical, which have been implicated in a wide variety of functions such as emotions, motivation, learning or memory [45]. Although several neurotrophins and their cognate receptors have been identified in the amygdaloid nuclei, BDNF-TrkB signaling in the AMG seems to be particularly important for fear learning [46]. The examined AMG sections represent all three subregions, which showed moderate levels of both BDNF protein and BDNF mRNA, along with relatively high expression of mRNA for the TrkB receptor. Studies in rodents indicate that BDNF-TrkB signaling predominates in synaptic sites of neurons entering the AMG from thalamic and cortical regions [35,36]. Reciprocal connections of the limbic system and thalamus also extend to the PCx, which plays a key role in cognitive control and executive functions, including decision-making and stress control ability [47]. In humans, the PCx shares extensive connections with the AMG, which are crucial for processing emotional stimuli, particularly negative ones, and are influenced by varying BDNF levels [48]. Thus, although the PCx is remote from the cerebroventricular system, the activation of BDNF-TrkB signaling in this structure in response to KYNA infusion may result from its strong interconnections with the limbic system. Research on the specific function of the PCx in sheep remains, however, limited. An early work, using stressors such as isolation or repeated transportation mainly showed the effects of stress on the emotional reactivity of young animal [49]. Another study demonstrated that prenatal aversive handling of ewes resulted in significant changes in apical dendritic spine density and morphology in the hippocampus and PCx of one-month-old offspring [50]. In rodent studies, chronic stress-induced damage to synaptic plasticity, including dendritic atrophy, synapse reduction, and volumetric changes in the PCx, has been associated with reduced BDNF expression [51]. Dysfunction in the limbic system and PCx, as well as deficits in cognitive control due to an insufficient supply of neurotrophic factors, are believed to be a key cause of many mental and neurological disorders in humans. Accordingly, reduced BDNF levels have been reported in brains of patients with depression [52] and schizophrenia [53]. In the context of our research, it is important to note that prenatal redirection of kynurenine metabolism to KYNA has been shown to enhance neuronal excitability, LTP, and increase the expression of several neurodevelopmental proteins in the brain of rat offspring [54]. Another study in rodents showed an antidepressant-like effect of 7-chlorokynurenic acid, associated with induction of BDNF-TrkB signaling in the limbic system in mice subjected to chronic unpredictable mild stress [55]. Additionally, in elderly human population with mood disorders, a tryptophan-rich diet increased both tryptophan and KYNA urinary levels, exerting a beneficial, antidepressant effect on mental health and improving the metabolism of this amino acid [56]. On the other hand, enhanced cognitive abilities and synaptic plasticity, associated with increased extracellular glutamate levels, were observed in mice with a targeted deletion of kynurenine aminotransferase II, a key enzyme involved in KYNA biosynthesis in the brain [57]. Interesting outcomes also emerged from the exposure of experimental animals to KYNA during adolescence, which led to increased sensitivity to reward-related cues and impaired LTP later in life [58]. The data presented indicate that the kynurenine pathway plays a fundamental role in the early development of the CNS. Variations in KYNA concentration may, depending on age and the presence of harmful factors, modulate the ability of brain structures to process signals by engaging neurotrophic factors.
Important BDNF-dependent neuronal centers, such as the arcuate, dorsomedial, and ventromedial (VMH) nuclei are located within the MBH, which along with the lateral hypothalamic area play critical roles in regulating food intake and body weight [35,59]. BDNF has been shown to act as an anorexigenic factor, influencing these processes through its interaction with a variety of locally produced signaling proteins [59]. Moreover, Ameroso et al. [60] identified VMH astrocytes as essential cellular substrates for BDNF in terms of maintaining energy and glucose homeostasis. The POA, on the other hand, with its complex organization, contains sites critical for regulating body temperature, electrolyte balance and the wake-sleep cycle [61]. In addition, the medial POA is one of the most important areas for controlling instinctive behaviors, including parental care, mating and aggression [62]. In many mammals, including sheep, both the MBH and POA are also regions housing gonadotropin-releasing hormone (GnRH) neurons, which trigger the synthesis and release of pituitary gonadotropins [61]. The involvement of BDNF in the regulation of central reproductive functions was previously demonstrated in sheep by Przybył et al. [63], who observed substantial changes in kisspeptin and GnRH mRNA expression after intracerebroventricular administration of BDNF. However, the specific role of KYNA as a primary regulator of the described BDNF activity in the hypothalamus has not been fully explored. Research indicates that disturbances in the kynurenine pathway associated with certain neuropsychiatric disorders may be related to an individual’s nutritional status, e.g. as seen in cases of anorexia [64]. Conversely, obesity may impair the synthesis of glutamate N-methyl-D-aspartate receptor (NMDAR) subunits, which could be targets of both substances [65]. Equally important for our research is the fact that the hypothalamus in adults emerged as a new neurogenic region with substantial proliferative capacity, constitutively generating cells of the neuronal lineage [66]. Although the level of neurogenesis in the hypothalamus is lower than that observed in well-established hippocampal neurogenic regions, its significance lies in the critical functional implications of this brain region. In general, BDNF expression in different areas of the hypothalamus is associated with maintaining control of neuroendocrine functions and plays a vital role in numerous aspects of hypothalamic control over key physiological processes [59,60,63,67].
Studies have demonstrated that BDNF transcription and release are mainly stimulated by excitatory synaptic activity, especially involving ionotropic NMDARs [68]. Antagonistic compounds can induce fast antidepressant-like effects, associated with the disinhibition of glutamate transmission, leading to a transient increase in glutamate levels and, consequently, enhanced BDNF expression [69]. Moreover, the involvement of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors have also been shown to be involved in the upregulation of BDNF expression in the CNS [70]. Since many brain regions receive glutamatergic inputs, the involvement of KYNA, as a modulator of glutamate receptors and related physiological processes, especially at micromolar concentrations, seems reasonable. Therefore, maintaining appropriate KYNA levels in the brain, depending on age and disease state, could be considered as part of the therapy for some CNS disorders and conditions. However, a critical aspect that requires comprehensive research is the permeability of the blood-brain barrier/blood-cerebrospinal fluid barrier (BBB/BCSFB) to KYNA. According to some researchers, the efficiency of KYNA in penetrating these barriers is low, indicating that its concentration in the CNS relies on local synthesis [22]. On the other hand, evidence exists that peripheral administration of KYNA can produce effective central effects. Scharfman and Goodman [71] demonstrated that the hippocampal responses following peripheral KYNA administration were qualitatively similar to those observed with direct administration to hippocampal slices. According to Heyes and Quearry [72], the slight increase in KYNA concentration in the CSF, following systemic KYNA administration, could result from the hightened sensitivity of the BBB/BSCFB to the increased availability of KYNA in the blood. Such specific cases require further investigations.

5. Conclusions

The present study demonstrated a positive association between KYNA levels in the cerebroventricular circulation and BDNF-TrkB expression in various brain regions in a sheep model. This finding suggests that a transient increase in CSF KYNA concentration can potentially restore BDNF synthesis, whose deficiency underlies numerous neurological disorders.

Supplementary Materials

The following supporting information can be downloaded at the website of this paper posted on Preprints.org.

Author Contributions

Conceptualization, K.R-O., and T.M. Investigation, Methodology, and Data curation, K.R-O., P.M., E.M., M.S., M.B., and T.M. Writing - original draft preparation, K.R-O. Writing - review and editing, T.M. All authors have read and agreed to the published version of the manuscript.

Funding

The research was supported by a statutory subsidy from the Ministry of Education and Science, Poland, including the Institute’s funds allocated for the 5th edition of “Grant for a Start.”

Ethical Board Statement

All animal procedures were conducted in accordance with the Polish Act on the Protection of Animals Used for Scientific or Educational Purposes (2015) and were approved by the 2nd Local Ethics Committee for Animal Experiments, Warsaw University of Life Sciences – SGGW, Warsaw, Poland (Resolution No. WAW2/128/2020).

Data Availability Statement

The datasets analyzed during the current study are available from the corresponding author upon reasonable request.

Acknowledgments

The authors thank W. Mrozek and R. Druchniak for animal care.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bothwell, M. NGF, BDNF, NT3, and NT4. Handb. Exp. Pharmacol. 2014, 220, 3–15. [Google Scholar] [PubMed]
  2. Gibon, J.; Barker, P.A. Neurotrophins and proneurotrophins: Focus on synaptic activity and plasticity in the brain. Neuroscientist 2017, 23, 587–604. [Google Scholar] [CrossRef] [PubMed]
  3. Bathina, S.; Das, U.N. Brain-derived neurotrophic factor and its clinical implications. Arch. Med. Sci. 2015, 11, 1164–1178. [Google Scholar] [CrossRef]
  4. Lin, C.C.; Huang, T.L. Brain-derived neurotrophic factor and mental disorders. Biomed. J. 2020, 43, 134–142. [Google Scholar] [CrossRef] [PubMed]
  5. Lledo, P.M.; Alonso, M.; Grubb, M.S. Adult neurogenesis and functional plasticity in neuronal circuits. Nature Rev. Neurosci. 2006, 7, 179–193. [Google Scholar] [CrossRef]
  6. Vilar, M.; Mira, H. Regulation of neurogenesis by neurotrophins during adulthood: Expected and unexpected roles. Front. Neurosci. 2016, 10, 26. [Google Scholar] [CrossRef]
  7. Gould, E. How widespread is adult neurogenesis in mammals? Nat. Rev. Neurosci. 2007, 8, 481–488. [Google Scholar] [CrossRef]
  8. Lee, D.A.; Blackshaw, S. Functional implications of hypothalamic neurogenesis in the adult mammalian brain. Int. J. Devel. Neurosci. 2012, 30, 615–621. [Google Scholar] [CrossRef]
  9. Cameron, H.A.; Glover, L.R. Adult neurogenesis: Beyond learning and memory. Ann. Rev. Psychol. 2015, 66, 53–81. [Google Scholar] [CrossRef]
  10. McEwen, B.S.; Nasca, C.; Gray, J.D. Stress effects on neuronal structure: Hippocampus, amygdala, and prefrontal cortex. Neuropsychopharmacol. Rev. 2016, 41, 3–23. [Google Scholar] [CrossRef]
  11. Pawluski, J.L.; Lambert, K.G.; Kinsley, C.H. Neuroplasticity in the maternal hippocampus: Relation to cognition and effects of repeated stress. Horm. Behav. 2016, 77, 86–97. [Google Scholar] [CrossRef] [PubMed]
  12. Forlenza, O.V.; Miranda, A.S.; Guimar, I.; Talib, L.L.; Diniz, B.S.; Gattaz, W.F.; Teixeira, A.L. Decreased neurotrophic support is associated with cognitive decline in non-demented subjects. J. Alzheimers Dis. 2015, 46, 423–429. [Google Scholar] [CrossRef] [PubMed]
  13. Katoh-Semba, R.; Takeuchi, I.K.; Semba, R.; Kato, K. Distribution of brain-derived neurotrophic factor in rats and its changes with development in the brain. J. Neurochem. 1997, 69, 34–42. [Google Scholar] [CrossRef] [PubMed]
  14. Dieni, S.; Matsumoto, T.; Dekkers, M.; Rauskolb, S.; Ionescu, M.S.; Deogracias, R.; Gundelfinger, E.D.; Kojima, M.; Nestel, S.; Frotscher, M.; Barde, Y.A. BDNF and its pro-peptide are stored in presynaptic dense core vesicles in brain neurons. J. Cell. Biol. 2012, 196, 775–788. [Google Scholar] [CrossRef]
  15. Edelmann, E.; Lessmann, V.; Brigadski, T. Pre- and postsynaptic twists in BDNF secretion and action in synaptic plasticity. Neuropharmacology 2014, 76 Pt C, 610–627. [Google Scholar] [CrossRef]
  16. Hempstead, B. Brain-derived neurotrophic factor: three ligands, many actions. Trans. Am. Clin. Climatol. Assoc. 2015, 126, 9. [Google Scholar]
  17. Adachi, N.; Numakawa, T.; Richards, M.; Nakajima, S.; Kunugi, H. New insight in expression, transport, and secretion of brain-derived neurotrophic factor: Implications in brain-related diseases. World J. Biol. Chem. 2014, 5, 409–428. [Google Scholar] [CrossRef]
  18. Diniz, B.S.; Teixeira, A.L. Brain-derived neurotrophic factor and Alzheimer’s disease: Physiopathology and beyond. Neuromol. Med. 2011, 13, 217–222. [Google Scholar] [CrossRef]
  19. Zuccato, C.; Marullo, M.; Conforti, P.; MacDonald, M.E.; Tartari, M.; Cattaneo, E. Systematic assessment of BDNF and its receptor levels in human cortices affected by Huntington’s disease. Brain Pathol. 2008, 18, 225–238. [Google Scholar] [CrossRef]
  20. Angelucci, F.; Brenè, S.; Mathé, A.A. BDNF in schizophrenia, depression and corresponding animal models. Mol. Psychiat. 2005, 10, 345–352. [Google Scholar] [CrossRef]
  21. Cannazza, G.; Chiarugi., A.; Parenti, C.; Zanoli, P.; Baraldi, M. Changes in kynurenic, anthranilic, and quinolinic acid concentrations in rat brain tissue during development. Neurochem. Res. 2001, 26, 511–514. [Google Scholar] [CrossRef] [PubMed]
  22. Moroni, F.; Cozzi, A.; Sili, M.; Mannaioni, G. Kynurenic acid: a metabolite with multiple actions and multiple targets in brain and periphery. J. Neural Transm. 2012, 119, 133–139. [Google Scholar] [CrossRef] [PubMed]
  23. Vamos, E.; Pardutz, A.; Klivenyi, P.; Toldi, J.; Vecsei, L. The role of kynurenines in disorders of the central nervous system: Possibilities for neuroprotection. J. Neurol. Sci. 2009, 283, 21–27. [Google Scholar] [CrossRef] [PubMed]
  24. Kozak, R.; Campbell, B.M.; Strick, C.A.; Horner, W.; Hoffmann, W.E.; Kiss, T.; Chapin, D.S.; McGinnis, D.; Abbott, A.L.; Roberts, B.M.; Fonseca, K.; Guanowsky, V.; Young, D.A.; Seymour, P.A.; Dounay, A.; Hajos, M.; Williams, G.V.; Castner, S.A. Reduction of brain kynurenic acid improves cognitive function. J. Neurosci. 2014, 34, 10592–10602. [Google Scholar] [CrossRef]
  25. Stone, T.W. Development and therapeutic potential of kynurenic acid and kynurenine derivatives for neuroprotection. Trends Pharmacol. Sci. 2000, 21, 149–154. [Google Scholar] [CrossRef]
  26. Strzetelski, J. IZ PIB–INRA Feeding recommendations for ruminants and feed tables; Kraków, Poland, 2014. (in Polish) [Google Scholar]
  27. Welento, J.; Szteyn, S.; Milart, Z. Observations on the stereotaxic configuration of the hypothalamus nuclei in the sheep. Anat. Anz. 1969, 124, 1–27. [Google Scholar]
  28. Traczyk, W.; Przekop, F. Methods of investigation of the function of the hypothalamus and hypophysis in chronic experiments in sheep. Acta Physiol. Pol. 1963, 14, 227–236. [Google Scholar]
  29. Misztal, T.; Kowalczyk, P.; Młotkowska, P.; Marciniak, E. The effect of allopregnanolone on enzymatic activity of the DNA base excision repair pathway in the sheep hippocampus and amygdala under natural and stressful conditions. Int. J. Mol. Sci. 2020, 21, 7762. [Google Scholar] [CrossRef] [PubMed]
  30. Roszkowicz-Ostrowska, K.; Młotkowska, P.; Kowalczyk, P.; Marciniak, E.; Barszcz, M.; Misztal, T. Central stimulatory effect of kynurenic acid on BDNF-TrkB signaling and BER enzymatic activity in the hippocampal CA1 field in sheep. Int. J. Mol. Sci. 2023, 24, 136. [Google Scholar] [CrossRef]
  31. Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, 36. [Google Scholar] [CrossRef]
  32. Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper – Excel-based tool using pairwise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
  33. Veening, J.G.; Barendregt, H.P. The regulation of brain states by neuroactive substances distributed via the cerebrospinal fluid; a review. Cerebrospin. Fluid Res. 2010, 7, 1. [Google Scholar] [CrossRef]
  34. Yang, L.; Kress, B.T.; Weber, H.J.; Thiyagarajan, M.; Wang, B.; Deane, R.; Benveniste, H.; Iliff, J.J.; Nedergaard, M. Evaluating glymphatic pathway function utilizing clinically relevant intrathecal infusion of CSF tracer. J. Transl. Med. 2013, 11, 107. [Google Scholar] [CrossRef] [PubMed]
  35. Conner, J.M.; Lauterborn, J.C.; Yan, Q.; Gall, C.M.; Varon, S. Distribution of brain-derived neurotrophic factor (BDNF) protein and mRNA in the normal adult rat CNS: evidence for anterograde axonal transport. J. Neurosci. 1997, 17, 2295–2313. [Google Scholar] [CrossRef]
  36. Yan, Q.; Rosenfeld, R.D.; Matheson, C.R.; Hawkins, N.; Lopez, O.T.; Bennett, L.; Welcher, A.A. Expression of brain-derived neurotrophic factor protein in the adult rat central nervous system. Neuroscience 1997, 78, 431–448. [Google Scholar] [CrossRef] [PubMed]
  37. Griego, E.; Galván, E.J. BDNF and Lactate as Modulators of Hippocampal CA3 Network Physiology. Cell. Mol. Neurobiol. 2023, 43, 4007–4022. [Google Scholar] [CrossRef]
  38. Cherubini, E.; Miles, R. ; The CA3 region of the hippocampus: how is it? What is it for? How does it do it? Front. Cell. Neurosci. 2015, 9, 19. [Google Scholar] [CrossRef]
  39. Ji, Y.; Lu, Y.; Yang, F.; Shen, W.; Tang, T.T.; Feng, L.; Duan, S.; Lu, B. Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons. Nat. Neurosci. 2010, 13, 302–309. [Google Scholar] [CrossRef]
  40. Cheng, P.L.; Song, A.H.; Wong, Y.H.; Wang, S.; Zhang, X.; Poo, M.M. Self-amplifying autocrine actions of BDNF in axon development. Proc. Natl. Acad. Sci. USA 2011, 108, 18430–18435. [Google Scholar] [CrossRef]
  41. Shelly, M.; Cancedda, L.; Lim, B.K.; Popescu, A.T.; Cheng, P.L.; Gao, H.; Poo, M.M. Semaphorin3A regulates neuronal polarization by suppressing axon formation and promoting dendrite growth. Neuron 2011, 71, 433–446. [Google Scholar] [CrossRef]
  42. Leal, G.; Comprido, D.; Duarte, C.B. BDNF-induced local protein synthesis and synaptic plasticity. Neuropharmacology 2014, 76 Pt C, 639–656. [Google Scholar] [CrossRef]
  43. Fernandez-Garcia, S.; Sancho-Balsells, A.; Longueville, S.; Herve, D.; Gruart, A.; Delgado-Garcia, J.M.; Alberch, J.; Giralt, A. Astrocytic BDNF and TrkB regulate severity and neuronal activity in mouse models of temporal lobe epilepsy. Cell Death Dis. 2020, 11, 411. [Google Scholar] [CrossRef] [PubMed]
  44. Migaud, M.; Batailler, M.; Segura, S.; Duittoz, A.; Franceschini, I.; Pillon, D. Emerging new sites for adult neurogenesis in the mammalian brain: a comparative study between the hypothalamus and the classical neurogenic zones. Europ. J. Neurosci. 2010, 32, 2042–2052. [Google Scholar] [CrossRef] [PubMed]
  45. McDonald, A.J.; Amygdala. Encyclopedia of the Neurological Sciences, Second ed.; Aminoff, M.J., Daroff, R.B., Eds.; Academic Press, 2014; pp. 153–156. [Google Scholar]
  46. Meis, S.; Endres, T.; Lessmann, V. Neurotrophin signalling in amygdala-dependent cued fear learning. Cell Tissue Res. 2020, 382, 161–172. [Google Scholar] [CrossRef] [PubMed]
  47. Friedman, N.P.; Robbins, T.W. The role of prefrontal cortex in cognitive control and executive function. Neuropsychopharmacology 2022, 47, 72–89. [Google Scholar] [CrossRef] [PubMed]
  48. Gorka, S.M.; Teppen, T.; Radoman, M.; Phan, K.L.; Pandey, S.C. Human plasma BDNF is associated with amygdala-prefrontal cortex functional connectivity and problem drinking behaviors. Internat. J. Neuropsychopharmacol. 2020, 23, 1–11. [Google Scholar] [CrossRef]
  49. Roussel, S.; Hemsworth, P.H.; Leruste, H.; White, C.; Duvaux-Ponter, C.; Nowak, R.; Boissy, A. Repeated transport and isolation during pregnancy in ewes: effects on the reactivity to humans and to their offspring after lambing. Appl. Anim. Behav. Sci. 2006, 97, 172–189. [Google Scholar] [CrossRef]
  50. Coulon, M.; Wellman, C.L.; Marjara, I.S.; Janczak, A.M.; Zanella, A.J. Early adverse experience alters dendritic spine density and gene expression in prefrontal cortex and hippocampus in lambs. Psychoneuroendocrinology 2013, 38, 1112–1121. [Google Scholar] [CrossRef]
  51. Duman, R.S.; Monteggia, L.M. A neurotrophic model for stress-related mood disorders. Biol. Psychiatry. 2006, 59, 1116–1127. [Google Scholar] [CrossRef]
  52. Tripp, A.; Oh, H.; Guilloux, J.P.; Martinowich, K.; Lewis, D.A.; Sibille, E. Brain-derived neurotrophic factor signaling and subgenual anterior cingulate cortex dysfunction in major depressive disorder, Am. J. Psychiatry 2012, 169, 1194–1202. [Google Scholar]
  53. Hashimoto, T.; Bergen, S.E.; Nguyen, Q.L.; Xu, B.; Monteggia, L.M.; Pierri, J.N.; Sun, Z.; Sampson, A.R.; Lewis, D.A. Relationship of brain-derived neurotrophic factor and its receptor TrkB to altered inhibitory prefrontal circuitry in schizophrenia. J. Neurosci. 2005, 25, 372–383. [Google Scholar] [CrossRef] [PubMed]
  54. Forrest, C.M.; Khalil, O.S.; Pisar, M.; Darlington, L.G.; Stone, T.W. Prenatal inhibition of the tryptophan–kynurenine pathway alters synaptic plasticity and protein expression in the rat hippocampus. Brain Res. 2013, 1504, 1–15. [Google Scholar] [CrossRef] [PubMed]
  55. Li, C.F.; Chen, X.M.; Chen, S.M.; Mu, R.H.; Liu, B.B.; Luo, L.; Liu, X.L.; Geng, D.; Liu, Q.; Yi, L.T. Activation of hippocampal BDNF signaling is involved in the antidepressant-like effect of the NMDA receptor antagonist 7-chlorokynurenicacid. Brain Res. 2016, 1630, 73–82. [Google Scholar] [CrossRef]
  56. Chojnacki, C.; Gąsiorowska, A.; Popławski, T.; Konrad, P.; Chojnacki, M.; Fila, M.; Blasiak, J. Beneficial effect of increased tryptophan intake on its metabolism and mental state of the elderly. Nutrients 2023, 15, 847. [Google Scholar] [CrossRef]
  57. Potter, M.C.; Elmer, G.I.; Bergeron, R.; Albuquerque, E.X.; Guidetti, P.; Wu, H.Q.; Schwarcz, R. Reduction of endogenous kynurenic acid formation enhances extracellular glutamate, hippocampal plasticity, and cognitive behavior. Neuropsychopharmacology 2010, 35, 1734–1742. [Google Scholar] [CrossRef]
  58. DeAngeli, N.E.; Todd, T.P.; Chang, S.E.; Yeh, H.H.; Yeh, P.W.; Bucci, D.J. Exposure to kynurenic acid during adolescence increases sign-tracking and impairs long-term potentiation in adulthood. Front. Behav. Neurosci. 2015, 8, 451. [Google Scholar] [CrossRef]
  59. Lebrun, B.; Bariohay, B.; Moyse, E.; Jean, A. Brain-derived neurotrophic factor (BDNF) and food intake regulation: A minireview. Auton. Neurosci. 2006, 126-127, 30–38. [Google Scholar] [CrossRef] [PubMed]
  60. Ameroso, D.; Meng, A.; Chen, S.; Felsted, J.; Dulla, S.G.; Rios, M. Astrocytic BDNF signaling within the ventromedial hypothalamus regulates energy homeostasis. Nat. Metab. 2022, 4, 627–643. [Google Scholar] [CrossRef] [PubMed]
  61. Parent, A.D.; Perkins, E. The hypothalamus. In Fundamental Neuroscience for Basic and Clinical Applications, 5th Edition; Haines, D.E., Mihailoff, G.A., Eds.; Elsevier: Philadelphia, PA, 2018; pp. 442–456. [Google Scholar]
  62. Tsuneoka, Y. Molecular neuroanatomy of the mouse medial preoptic area with reference to parental behavior. Anat. Sci. Int. 2019, 94, 39–52. [Google Scholar] [CrossRef]
  63. Przybył, B.J.; Szlis, M.; Wójcik-Gładysz, A. Brain-derived neurotrophic factor (BDNF) affects the activity of the gonadotrophic axis in sheep. Horm. Behav. 2021, 131, 104980. [Google Scholar] [CrossRef]
  64. Demitrack, M.A.; Heyes, M.P.; Altemus, M.; Pigott, T.A.; Gold, P.W. Cerebrospinal fluid levels of kynurenine pathway metabolites in patients with eating disorders: relation to clinical and biochemical variable. Biol. Psychiatry 1995, 37, 512–20. [Google Scholar] [CrossRef] [PubMed]
  65. Elmas, O.; Cenik, P.; Sirinyildiz, F.; Elmas, S.; Sirin, F.B.; Cesur, G. Relationship between cognitive functions, levels of NR2A and NR2B subunits of hippocampal NMDA receptors, serum TGF-β1 level, and oxidative stress in rats fed a high-fat diet. J. Anim. Feed Sci. 2022, 31, 318–327. [Google Scholar] [CrossRef]
  66. Kokoeva, M.V.; Yin, H.; Flier, J.S. Evidence for constitutive neural cell proliferation in the adult murine hypothalamus. J. Comp. Neurol. 2007, 505, 209–220. [Google Scholar] [CrossRef] [PubMed]
  67. Katz, A.; Meiri, N. Brain-derived neurotrophic factor is critically involved in thermal-experience-dependent developmental plasticity. J. Neurosci. 2006, 26, 3899–3907. [Google Scholar] [CrossRef] [PubMed]
  68. Marini, A.M.; Rabin, S.J.; Lipsky, R.H.; Mocchetti, I. Activity-dependent release of brain-derived neurotrophic factor underlies the neuroprotective effect of N-methyl-D-aspartate. J. Biol. Chem. 1998, 273, 29394–29399. [Google Scholar] [CrossRef]
  69. Autry, A.; Adachi, M.; Nosyreva, E.; Na, E.S.; Los, M.F.; Cheng, P.; Kavalali, E.T.; Monteggia, L.M. NMDA receptor blockade at rest triggers rapid behavioural antidepressant responses. Nature 2011, 475, 91–95. [Google Scholar] [CrossRef]
  70. Zhou, W.; Wang, N.; Yang, C.; Li, X.M.; Zhou, Z.; Yang, J.J. Ketamine-induced antidepressant effects are AMPA receptors mediated upregulation of mTOR and BDNF in rat hippocampus and prefrontal cortex. Eur. Psychiatry 2014, 29, 419–423. [Google Scholar] [CrossRef] [PubMed]
  71. Scharfman, H.E.; Goodman, J.H. Effects of central and peripheral administration of kynurenic acid on hippocampal evoked responses in vivo and in vitro. Neuroscience 1998, 86, 751–764. [Google Scholar] [CrossRef]
  72. Heyes, M.P.; Quearry, B.J. Quantification of kynurenic acid in cerebrospinal fluid: effects of systemic and central L-kynurenine administration. J. Chromatogr. 1990, 530, 108–111. [Google Scholar] [CrossRef]
Figure 1. Brain-derived neurotrophic factor (BDNF) protein concentration (pg/mg protein, mean ± SEM) in homogenates of the examined sheep brain structures: CA3 field of the hippocampus (CA3), amygdala (AMG), and the prefrontal cortex (PCx). Significance of differences: AB, p < 0.001.
Figure 1. Brain-derived neurotrophic factor (BDNF) protein concentration (pg/mg protein, mean ± SEM) in homogenates of the examined sheep brain structures: CA3 field of the hippocampus (CA3), amygdala (AMG), and the prefrontal cortex (PCx). Significance of differences: AB, p < 0.001.
Preprints 121360 g001
Figure 2. Comparison of brain-derived neurotrophic factor (BDNF) protein concentration (pg/mg protein, mean ± SEM) in homogenates of the hippocampal CA3 field (A), amygdala (B), and the prefrontal cortex (C) in sheep infused with control solution and the lower (total 20 μg, (KYNA20) and higher (total 100 μg, KYNA100) doses of kynurenic acid (KYNA) into the third brain ventricle. Significance of differences: ab, cd, p < 0.05; AB, p < 0.01.
Figure 2. Comparison of brain-derived neurotrophic factor (BDNF) protein concentration (pg/mg protein, mean ± SEM) in homogenates of the hippocampal CA3 field (A), amygdala (B), and the prefrontal cortex (C) in sheep infused with control solution and the lower (total 20 μg, (KYNA20) and higher (total 100 μg, KYNA100) doses of kynurenic acid (KYNA) into the third brain ventricle. Significance of differences: ab, cd, p < 0.05; AB, p < 0.01.
Preprints 121360 g002
Figure 3. Comparison of relative brain-derived neurotrophic factor (BDNF) mRNA expression (mean ± SEM) in the hippocampal CA3 field (A), amygdala (B), prefrontal cortex (C), and in the hypothalamic medial-basal area (D), and the preoptic area (E) in sheep infused with control solution and the lower (total 20 μg, (KYNA20) and higher (total 100 μg, KYNA100) doses of kynurenic acid (KYNA) into the third brain ventricle. Significance of differences: ab, cd, p < 0.05; AB, p < 0.01.
Figure 3. Comparison of relative brain-derived neurotrophic factor (BDNF) mRNA expression (mean ± SEM) in the hippocampal CA3 field (A), amygdala (B), prefrontal cortex (C), and in the hypothalamic medial-basal area (D), and the preoptic area (E) in sheep infused with control solution and the lower (total 20 μg, (KYNA20) and higher (total 100 μg, KYNA100) doses of kynurenic acid (KYNA) into the third brain ventricle. Significance of differences: ab, cd, p < 0.05; AB, p < 0.01.
Preprints 121360 g003
Figure 4. Comparison of relative tropomyosin-related kinase receptor B (TrkB) mRNA expression (mean ± SEM) in the hippocampal CA3 field (A), amygdala (B), prefrontal cortex (C), and in the hypothalamic medial-basal area (D), and the preoptic area (E) in sheep infused with control solution and the lower (total 20 μg, (KYNA20) and higher (total 100 μg, KYNA100) doses of kynurenic acid (KYNA) into the third brain ventricle. Significance of differences: cd, p < 0.05; AB, p < 0.01.
Figure 4. Comparison of relative tropomyosin-related kinase receptor B (TrkB) mRNA expression (mean ± SEM) in the hippocampal CA3 field (A), amygdala (B), prefrontal cortex (C), and in the hypothalamic medial-basal area (D), and the preoptic area (E) in sheep infused with control solution and the lower (total 20 μg, (KYNA20) and higher (total 100 μg, KYNA100) doses of kynurenic acid (KYNA) into the third brain ventricle. Significance of differences: cd, p < 0.05; AB, p < 0.01.
Preprints 121360 g004
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

© 2026 MDPI (Basel, Switzerland) unless otherwise stated

Accessibility

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings