Submitted:
24 September 2024
Posted:
25 September 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
E. histolytica Culture
Construction of the Myc-Tagged EhDUF2419 (MycEhDUF2419) or Truncated EhDUF2419 Vector (TrunEhDUF2419)
Transfection of E. histolytica Trophozoites
Quantitative-Real Time PCR (qRT-PCR)
Western Blot Analysis
Immunoprecipitation
In Gel Proteolysis and MS Analysis
PANTHER Classification System
Ribosome Purification
Assessment of Protein Synthesis through Surface Sensing of Translation (SUnSET)
N-Acryloyl-3-Aminophenylboronic Acid (APB) Northern Blotting for E. histolytica tRNAHisGUG
Statistical Analysis
3. Results
3.1. Interactome of MycEhDUF2419 in E. histolytica Trophozoites
3.2. EhDUF2419 Co-Purified with Ribosomal Proteins in the Ribosome Fraction
3.3. EhDUF2419 Interacts with Ribosomal Protein Independent of Its Catalytic Domain
3.4. EhDUF2419 Overexpression Reduces Q-tRNA Formation in Presence of Q.
3.5. EhDUF2419 Is Regulated by Proteasome-Mediated Degradation Pathways
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Haque, R.; Huston, C.D.; Hughes, M.; Houpt, E.; Petri, W.A., Jr. Amebiasis. N Engl J Med 2003, 348, 1565–1573. [Google Scholar] [CrossRef]
- Agrawal, A.; Maitra, S.C.; Arya, A.; Sagar, P. Action of metronidazole on Entamoeba histolytica: An ultrastructural study. J Commun Dis 1990, 22, 47–54, Available: https://www.ncbi.nlm.nih.gov/pubmed/2230021. [Google Scholar]
- Samarawickrema, N.A.; Brown, D.M.; Upcroft, J.A.; Thammapalerd, N.; Upcroft, P. Involvement of superoxide dismutase and pyruvate:ferredoxin oxidoreductase in mechanisms of metronidazole resistance in Entamoeba histolytica. J Antimicrob Chemother 1997, 40, 833–840. [Google Scholar] [CrossRef]
- Bansal, D.; Sehgal, R.; Chawla, Y.; Mahajan, R.C.; Malla, N. In vitro activity of antiamoebic drugs against clinical isolates of Entamoeba histolytica and Entamoeba dispar. Ann Clin Microbiol Antimicrob 2004, 3, 27. [Google Scholar] [CrossRef]
- Katze, J.R.; Basile, B.; McCloskey, J.A. Queuine, a modified base incorporated posttranscriptionally into eukaryotic transfer RNA: Wide distribution in nature. Science 1982, 216, 55–56. [Google Scholar] [CrossRef]
- Ott, G.; Kersten, H.; Nishimura, S. Dictyostelium discoideum: A useful model system to evaluate the function of queuine and of the Q-family of tRNAs. FEBS Lett 1982, 146, 311–314. [Google Scholar] [CrossRef]
- Farkas, W.R. Effect of diet on the queuosine family of tRNAs of germ-free mice. J Biol Chem 1980, 255, 6832–6835, Available: https://www.ncbi.nlm.nih.gov/pubmed/6771278. [Google Scholar] [CrossRef]
- Fergus, C.; Barnes, D.; Alqasem, M.A.; Kelly, V.P. The queuine micronutrient: Charting a course from microbe to man. Nutrients 2015, 7, 2897–2929. [Google Scholar] [CrossRef]
- Nagaraja, S.; et al. . Queuine Is a Nutritional Regulator of Entamoeba histolytica Response to Oxidative Stress and a Virulence Attenuator. mBio 2021, 12. [Google Scholar] [CrossRef]
- Muller, M.; et al. . Queuine links translational control in eukaryotes to a micronutrient from bacteria. Nucleic acids research 2019, 47, 3711–3727. [Google Scholar] [CrossRef]
- Tuorto, F.; et al. . Queuosine-modified tRNAs confer nutritional control of protein translation. The EMBO journal 2018, 37. [Google Scholar] [CrossRef]
- Zallot, R.; Yuan, Y.; de Crecy-Lagard, V. The Escherichia coli COG1738 Member YhhQ Is Involved in 7-Cyanodeazaguanine (preQ(0)) Transport. Biomolecules 2017, 7. [Google Scholar] [CrossRef]
- Yuan, Y.; et al. . Discovery of novel bacterial queuine salvage enzymes and pathways in human pathogens. Proc Natl Acad Sci U S A 2019, 116, 19126–19135. [Google Scholar] [CrossRef]
- Quaiyum, S.; Yuan, Y.; Kuipers, P.J.; Martinelli, M.; Jaroch, M.; de Crecy-Lagard, V. Deciphering the Diversity in Bacterial Transporters That Salvage Queuosine Precursors. Epigenomes 2024, 8. [Google Scholar] [CrossRef]
- Sarid, L.; et al. . Queuine Salvaging in the Human Parasite Entamoeba histolytica. Cells 2022, 11. [Google Scholar] [CrossRef]
- Diamond, L.S.; Harlow, D.R.; Cunnick, C.C. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans R Soc Trop Med Hyg 1978, 72, 431–432. [Google Scholar] [CrossRef]
- Zhang, H.; Veira, J.; Bauer, S.T.; Yip, C.; Singh, U. RISC in Entamoeba histolytica: Identification of a Protein-Protein Interaction Network for the RNA Interference Pathway in a Deep-Branching Eukaryote. mBio 2021, 12, e0154021. [Google Scholar] [CrossRef]
- Zallot, R.; et al. . Plant, animal, and fungal micronutrient queuosine is salvaged by members of the DUF2419 protein family. ACS chemical biology 2014, 9, 1812–1825. [Google Scholar] [CrossRef]
- Olvera, A.; et al. . Stable transfection of Entamoeba histolytica trophozoites by lipofection. Arch Med Res 1997, 28, 49–51, Available: https://www.ncbi.nlm.nih.gov/pubmed/9033009. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lee, S.R.; Collins, K. Physical and functional coupling of RNA-dependent RNA polymerase and Dicer in the biogenesis of endogenous siRNAs. Nat Struct Mol Biol 2007, 14, 604–610. [Google Scholar] [CrossRef]
- Sarid, L.; Zanditenas, E.; Ye, J.; Trebicz-Geffen, M.; Ankri, S. Insights into the Mechanisms of Lactobacillus acidophilus Activity against Entamoeba histolytica by Using Thiol Redox Proteomics. Antioxidants (Basel) 2022, 11, 814. [Google Scholar] [CrossRef]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat Biotechnol 2008, 26, 1367–1372. [Google Scholar] [CrossRef]
- Mi, H.; et al. . PANTHER version 16: A revised family classification, tree-based classification tool, enhancer regions and extensive API. Nucleic acids research 2021, 49, D394–D403. [Google Scholar] [CrossRef]
- Shalgi, R.; Hurt, J.A.; Krykbaeva, I.; Taipale, M.; Lindquist, S.; Burge, C.B. Widespread regulation of translation by elongation pausing in heat shock. Mol Cell 2013, 49, 439–452. [Google Scholar] [CrossRef]
- Chavez-Rios, R.; Arias-Romero, L.E.; Mde, J.A.-B.; Hernandez-Rivas, R.; Guillen, N.; Vargas, M. L10 ribosomal protein from Entamoeba histolytica share structural and functional homologies with QM/Jif-1: Proteins with extraribosomal functions. Mol Biochem Parasitol 2003, 127, 151–160. [Google Scholar] [CrossRef]
- Hertz, R.; et al. . The Entamoeba histolytica Dnmt2 homolog (Ehmeth) confers resistance to nitrosative stress. Eukaryot Cell 2014, 13, 494–503. [Google Scholar] [CrossRef]
- Trebicz-Geffen, M.; et al. . Identification of S-Nitrosylated (SNO) Proteins in Entamoeba histolytica Adapted to Nitrosative Stress: Insights into the Role of SNO Actin and In vitro Virulence. Frontiers in cellular and infection microbiology 2017, 7, 192. [Google Scholar] [CrossRef]
- Schindelin, J.; et al. . Fiji: An open-source platform for biological-image analysis. Nat Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Igloi, G.L.; Kossel, H. Affinity electrophoresis for monitoring terminal phosphorylation and the presence of queuosine in RNA. Application of polyacrylamide containing a covalently bound boronic acid. Nucleic Acids Res 1985, 13, 6881–6898. [Google Scholar] [CrossRef]
- Hamann, L.; Nickel, R.; Tannich, E. Transfection and continuous expression of heterologous genes in the protozoan parasite Entamoeba histolytica. (in eng), Proceedings of the National Academy of Sciences of the United States of America 1995, 92, 8975–8979, Available: http://www.ncbi.nlm.nih.gov/pubmed/7568055. [Google Scholar] [CrossRef] [PubMed]
- McCluskey, A.J.; et al. . The catalytic subunit of shiga-like toxin 1 interacts with ribosomal stalk proteins and is inhibited by their conserved C-terminal domain. J Mol Biol 2008, 378, 375–386. [Google Scholar] [CrossRef] [PubMed]
- Ren, J.; Wang, Y.; Liang, Y.; Zhang, Y.; Bao, S.; Xu, Z. Methylation of ribosomal protein S10 by protein-arginine methyltransferase 5 regulates ribosome biogenesis. J Biol Chem 2010, 285, 12695–12705. [Google Scholar] [CrossRef] [PubMed]
- Cirzi, C.; Tuorto, F. Analysis of Queuosine tRNA Modification Using APB Northern Blot Assay. Methods Mol Biol 2021, 2298, 217–230. [Google Scholar] [CrossRef]
- Schmidt, E.K.; Clavarino, G.; Ceppi, M.; Pierre, P. SUnSET, a nonradioactive method to monitor protein synthesis. (in eng), Nature methods 2009, 6, 275–277. [Google Scholar] [CrossRef]
- Makioka, A.; Kumagai, M.; Ohtomo, H.; Kobayashi, S.; Takeuchi, T. Effect of proteasome inhibitors on the growth, encystation, and excystation of Entamoeba histolytica and Entamoeba invadens. Parasitol Res 2002, 88, 454–459. [Google Scholar] [CrossRef]
- Hung, S.H.; et al. . Structural basis of Qng1-mediated salvage of the micronutrient queuine from queuosine-5′-monophosphate as the biological substrate. Nucleic acids research 2023, 51, 935–951. [Google Scholar] [CrossRef]
- Diaz-Rullo, J.; Gonzalez-Pastor, J.E. tRNA queuosine modification is involved in biofilm formation and virulence in bacteria. Nucleic acids research 2023, 51, 9821–9837. [Google Scholar] [CrossRef]
- Perez-Arellano, I.; Gallego, J.; Cervera, J. The PUA domain - a structural and functional overview. The FEBS journal 2007, 274, 4972–4984. [Google Scholar] [CrossRef]
- El Yacoubi, B.; Bailly, M.; de Crecy-Lagard, V. Biosynthesis and function of posttranscriptional modifications of transfer RNAs. Annu Rev Genet 2012, 46, 69–95. [Google Scholar] [CrossRef]
- Agris, P.F.; Vendeix, F.A.; Graham, W.D. tRNA’s wobble decoding of the genome: 40 years of modification. J Mol Biol 2007, 366, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Jeltsch, A.; et al. . Mechanism and biological role of Dnmt2 in Nucleic Acid Methylation. RNA Biol 2017, 14, 1108–1123. [Google Scholar] [CrossRef] [PubMed]
- Muller, M.; et al. . Dynamic modulation of Dnmt2-dependent tRNA methylation by the micronutrient queuine. Nucleic Acids Res 2015, 43, 10952–10962. [Google Scholar] [CrossRef] [PubMed]
- Ehrenhofer-Murray, A.E. Cross-Talk between Dnmt2-Dependent tRNA Methylation and Queuosine Modification. Biomolecules 2017, 7. [Google Scholar] [CrossRef] [PubMed]
- Fuller-Pace, F.V. DExD/H box RNA helicases: Multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res 2006, 34, 4206–4215. [Google Scholar] [CrossRef]
- Schutz, P.; et al. . Comparative structural analysis of human DEAD-box RNA helicases. PLoS ONE 2010, 5. [Google Scholar] [CrossRef]
- Drino, A.; et al. . Identification of RNA helicases with unwinding activity on angiogenin-processed tRNAs. Nucleic Acids Res 2023, 51, 1326–1352. [Google Scholar] [CrossRef]
- Chimnaronk, S.; et al. . RNA helicase module in an acetyltransferase that modifies a specific tRNA anticodon. EMBO J 2009, 28, 1362–1373. [Google Scholar] [CrossRef]









| Protein | Forward Primer (5′ to 3′) | Reverse Primer (5′ to 3′) | Enzyme Site | Notes |
|---|---|---|---|---|
| EhDUF2419 | CCCCCGGGATGTGTGAATATGTTCG | CCCTCGAGTCAATAAAAAATGGTTTGTGTTCG | SmaI, XhoI | |
| TrunEhDUF2419 | CCCCCGGGATGTGTGAATATGTTCG | CCCTCGAGTCAGCGATATCCTTCAATAAAT | SmaI, XhoI | |
| EhDUF2419 | TCCATCTGGGTCTGAAGAAG | GTTTGTGTTCGGTGGTGTGG | qPCR | |
| rDNA | TCAAAAAGCAACGTCGCTA | AGCCCGTAAGGTGATTTCT | qPCR |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).