Submitted:
18 September 2024
Posted:
19 September 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Animal, Viruses and Cell Lines
2.2. The Preparation of DCs
2.3. Purification and Identification of BMDCs
2.4. Real-Time Quantitative PCR (RT-qPCR)
2.5. Western Blotting (WB)
2.6. Flow Cytometry Assay
2.7. Detection of Cytokine and Lymphocyte Proliferation Level
2.8. Detection of Antigen Uptake Ability
2.9. Detection of DCs Migration Ability
2.10. Cells Viability Assay
2.11. Indirect Immunofluorescence Assay (IFA)
2.12. Statistical Analysis
3. Results
3.1. Isolation and Identification of BMDCs
3.2. Recombinant Virus Replication Capability in DCs
3.3. Phenotypic Changes in DCs Infected with Recombinant Viruses
3.4. Detection of Cytokine Secretion in DCs Infected with Recombinant Viruses
3.5. TLRs Expression in DCs Infected with Recombinant Viruses
3.6. Phagocytosis and Migration Ability Detection in DCs
3.7. The Apoptosis of DCs Infected with Recombinant Viruses
3.8. Antigen Presentation Ability Detection in DCs
3.9. T Cells Proliferation Ability
3.10. Cytokine Secretion in Co-Cultured Supernatants
3.11. The effect of Recombinant Virus on the Activation of T lymphocytes
3.12. The Effect of Recombinant Virus on the Polarization of CD4+T lymphocyte Subsets
3.13. The Effect of Recombinant Virus on the CD4+T Cells Related Transcription Factors Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data availability statement
Conflicts of Interest
References
- Schlafer, D.H.; Mebus, C.A.; McVicar, J.W. African swine fever in neonatal pigs: passively acquired protection from colostrum or serum of recovered pigs. Am J Vet Res. 1984, 45, 1367–1372. [Google Scholar] [PubMed]
- Oura, C.A.L.; Denyer, M.S. ; Takamatsu. H.; Parkhouse, R.M.E. In vivo depletion of CD8+ T lymphocytes abrogates protective immunity to African swine fever virus. J Gen Virol. 2005, 86, 2445–2450. [Google Scholar] [CrossRef]
- Takamatsu, H.H.; Denyer, M.S.; Lacasta, A.; Stirling, C.M.; Argilaguet, J.M.; Netherton, C.L.; Oura, C.A.; Martins, C.; Rodríguez, F. Cellular immunity in ASFV responses. Virus Res. 2013, 173, 110–121. [Google Scholar] [CrossRef]
- Scholl, T.; Lunney, J.K.; Mebus, C.A.; Duffy, E.; Martins, C.L. Virus-specific cellular blastogenesis and interleukin-2 production in swine after recovery from African swine fever. Am J Vet Res. 1989, 50, 1781–1786. [Google Scholar] [PubMed]
- O'Sullivan, B.J.; Thomas, R. CD40 ligation conditions dendritic cell antigen-presenting function through sustained activation of NF-kappaB. J Immunol. 2002, 168, 5491–5498. [Google Scholar] [CrossRef]
- Kapsenberg, M.L. Dendritic-cell control of pathogen-driven T-cell polarization. Nat Rev Immunol. 2003, 3, 984–993. [Google Scholar] [CrossRef] [PubMed]
- Alvarez, D.; Vollmann, E.H.; von Andrian, U.H. Mechanisms and consequences of dendritic cell migration. Immunity. 2008, 29, 325–342. [Google Scholar] [CrossRef]
- Plevin, R.E.; Knoll, M.; McKay, M.; Arbabi, S.; Cuschieri, J. The role of lipopolysaccharide structure in monocyte activation and cytokine secretion. Shock. 2016, 45, 22–27. [Google Scholar] [CrossRef]
- Gille, C.; Steffen, F.; Lauber, K.; Keppeler, H.; Leiber, A.; Spring, B.; Poets, C.F.; Orlikowsky, T.W. Clearance of apoptotic neutrophils is diminished in cord blood monocytes and does not lead to reduced IL-8 production. Pediatr Res. 2009, 66, 507–512. [Google Scholar] [CrossRef] [PubMed]
- Schulz, O.; Edwards, A.D.; Schito, M.; Aliberti, J.; Manickasingham, S.; Sher, A.; Reis e Sousa, C. CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal. Immunity. 2000, 13, 453–462. [Google Scholar] [CrossRef] [PubMed]
- Wolf, D.; Ley, K. Immunity and Inflammation in Atherosclerosis. Circ Res. 2019, 124, 315–327. [Google Scholar] [CrossRef] [PubMed]
- Allan, R.S.; Waithman, J.; Bedoui, S.; Jones, C.M.; Villadangos, J.A.; Zhan, Y.; Lew, A.M.; Shortman, K.; Heath, W.R.; Carbone, F.R. Migratory dendritic cells transfer antigen to a lymph node-resident dendritic cell population for efficient CTL priming. Immunity. 2006, 25, 153–162. [Google Scholar] [CrossRef]
- Peng, Y.T.; Chaung, H.C.; Chang, H.L.; Chang, H.C.; Chung, W.B. Modulations of phenotype and cytokine expression of porcine bone marrow-derived dendritic cells by porcine reproductive and respiratory syndrome virus. Vet Microbiol. 2009, 136, 359–365. [Google Scholar] [CrossRef] [PubMed]
- Zheng, F.Y.; Qiu, C.Q.; Jia, H.J.; Chen, G.H.; Zeng, S.; He, X.B.; Fang, Y.X.; Lin, G.Z.; Jing, Z.Z. Infection of mouse bone marrow-derived immature dendritic cells with classical swine fever virus C-strain promotes cells maturation and lymphocyte proliferation. Res Vet Sci. 2013, 95, 1268–1270. [Google Scholar] [CrossRef] [PubMed]
- Franzoni, G.; Graham, S.P.; Dei, G.S.; Oggiano, A. Porcine dendritic cells and viruses: An update. Viruses. 2019, 11. [Google Scholar] [CrossRef] [PubMed]
- Bezbaruah, R.; Borah, P.; Kakoti, B.B.; Al-Shar'I, N.A.; Chandrasekaran, B.; Jaradat, D.M.M.; Al-Zeer, M.A.; Abu-Romman, S. Developmental Landscape of Potential Vaccine Candidates Based on Viral Vector for Prophylaxis of COVID-19. Front Mol Biosci. 2021, 8, 635337. [Google Scholar] [CrossRef] [PubMed]
- Zou, S.L.; Nie, Z.M.; Wu, X.F.; Fang, X.K.; Sun, T. Study on the interactions of vesicular stomatitis virus with monocyte and moDC. Journal of Zhejiang Sci-Tech University. 2016, 35, 749–753. [Google Scholar]
- Ma, Y.; Shao, J.; Liu, W.; Gao, S.; Peng, D.; Miao, C.; Yang, S.; Hou, Z.; Zhou, G.; Qi, X.; Chang, H. A vesicular stomatitis virus-based African swine fever vaccine prototype effectively induced robust immune responses in mice following a single-dose immunization. Front Microbiol. 2023, 14, 1310333. [Google Scholar] [CrossRef] [PubMed]
- Abdelmageed, A.A.; Ferran, M.C. The propagation, quantification, and storage of vesicular stomatitis virus. Curr Protoc Microbiol. 2020, 58, e110. [Google Scholar] [CrossRef] [PubMed]
- Pelzel-McCluskey, A.M. Vesicular stomatitis virus. Vet Clin North Am Food Anim Pract. 2024, 23. [Google Scholar] [CrossRef]
- Zhang, Y.; Nagalo, B.M. Immunovirotherapy based on recombinant vesicular stomatitis virus: Where are we? Front Immunol. 2022, 13, 898631. [Google Scholar] [CrossRef]
- Hastie, E.; Cataldi, M.; Marriott, I.; Grdzelishvili, V.Z. Understanding and altering cell tropism of vesicular stomatitis virus. Virus Res. 2013, 176, 16–32. [Google Scholar] [CrossRef]
- Shi, Y.; Liu, C.H.; Roberts, A.I.; Das, J.; Xu, G.; Ren, G.; Zhang, Y.; Zhang, L.; Yuan, Z.R.; Tan, H.S.; Das, G.; Devadas, S. Granulocyte-macrophage colony-stimulating factor (GM-CSF) and T-cell responses: what we do and don't know. Cell Res. 2006, 16, 126–133. [Google Scholar] [CrossRef] [PubMed]
- Ramsburg, E.; Publicover, J.; Buonocore, L.; Poholek, A.; Robek, M.; Palin, A.; Rose, J.K. A vesicular stomatitis virus recombinant expressing granulocyte-macrophage colony-stimulating factor induces enhanced T-cell responses and is highly attenuated for replication in animals. J Virol. 2005, 79, 15043–15053. [Google Scholar] [CrossRef] [PubMed]
- Lemay, C.G.; Rintoul, J.L.; Kus, A.; Paterson, J.M.; Garcia, V.; Falls, T.J.; Ferreira, L.; Bridle, B.W.; Conrad, D.P.; Tang, V.A.; Diallo, J.S.; Arulanandam, R.; Le Boeuf, F.; Garson, K.; Vanderhyden, B.C.; Stojdl, D.F.; Lichty, B.D.; Atkins, H.L.; Parato, K.A.; Bell, J.C.; Auer, R.C. Harnessing oncolytic virus-mediated antitumor immunity in an infected cell vaccine. Mol Ther. 2012, 20, 1791–1799. [Google Scholar] [CrossRef]
- Qin, T.; Yin, Y.; Yu, Q.; Yang, Q. Bursopentin (BP5) protects dendritic cells from lipopolysaccharide-induced oxidative stress for immunosuppression. PLoS One. 2015, 10, e0117477. [Google Scholar] [CrossRef] [PubMed]
- Burgdorf, S.; Kautz, A.; Böhnert, V.; Knolle, P.A.; Kurts, C. Distinct pathways of antigen uptake and intracellular routing in CD4 and CD8 T cell activation. Science. 2007, 316, 612–616. [Google Scholar] [CrossRef]
- Lee, J.M.; Lee, M.H.; Garon, E.; Goldman, J.W.; Salehi-Rad, R.; Baratelli, F.E.; Schaue, D.; Wang, G.; Rosen, F.; Yanagawa, J.; Walser, T.C.; Lin, Y.; Park, S.J.; Adams, S.; Marincola, F.M.; Tumeh, P.C.; Abtin, F.; Suh, R.; Reckamp, K.L.; Lee, G.; Wallace, W.D.; Lee, S.; Zeng, G.; Elashoff, D.A.; Sharma, S.; Dubinett, S.M. Phase I Trial of Intratumoral Injection of CCL21 Gene-Modified Dendritic Cells in Lung Cancer Elicits Tumor-Specific Immune Responses and CD8+ T-cell Infiltration. Clin Cancer Res. 2017, 23, 4556–4568. [Google Scholar] [CrossRef] [PubMed]
- Palomares, F.; Pina, A.; Dakhaoui, H.; Leiva-Castro, C.; Munera-Rodriguez, A.M.; Cejudo-Guillen, M.; Granados, B.; Alba, G.; Santa-Maria, C.; Sobrino, F.; Lopez-Enriquez, S. Dendritic Cells as a Therapeutic Strategy in Acute Myeloid Leukemia: Vaccines. Vaccines (Basel). 2024, 12. [Google Scholar] [CrossRef] [PubMed]
- Sato, K.; Yang, X.L.; Yudate, T.; Chung, J.S.; Wu, J.; Luby-Phelps, K.; Kimberly, R.P.; Underhill, D.; Cruz, P.D.; Ariizumi, K. Dectin-2 is a pattern recognition receptor for fungi that couples with the Fc receptor gamma chain to induce innate immune responses. J Biol Chem. 2006, 281, 38854–38866. [Google Scholar] [CrossRef] [PubMed]
- Langrish, C.L.; McKenzie, B.S.; Wilson, N.J.; de Waal Malefyt, R.; Kastelein, R.A.; Cua, D.J. IL-12 and IL-23: master regulators of innate and adaptive immunity. Immunol Rev. 2004, 202, 96–105. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.Y.; Eri, R.; Lyons, A.B.; Grimm, M.C.; Korner, H. CC chemokine ligand 20 and its cognate receptor CCR6 in mucosal T cell immunology and inflammatory bowel disease: Odd couple or axis of evil? Front Immunol. 2013, 4, 194. [Google Scholar] [CrossRef]
- Jouault, T.; El Abed-El Behi, M.; Martínez-Esparza, M.; Breuilh, L.; Trinel, P.A.; Chamaillard, M.; Trottein, F.; Poulain, D. Specific recognition of Candida albicans by macrophages requires galectin-3 to discriminate Saccharomyces cerevisiae and needs association with TLR2 for signaling. J Immunol. 2006, 177, 4679–4687. [Google Scholar] [CrossRef]
- Fermin Lee, A.; Chen, H.Y.; Wan, L.; Wu, S.Y.; Yu, J.S.; Huang, A.C.; Miaw, S.C.; Hsu, D.K.; Wu-Hsieh, B.A.; Liu, F.T. Galectin-3 modulates Th17 responses by regulating dendritic cell cytokines. Am J Pathol. 2013, 183, 1209–1222. [Google Scholar] [CrossRef] [PubMed]
- Littman, D.R.; Rudensky, A.Y. Th17 and regulatory T cells in mediating and restraining inflammation. Cell. 2010, 140, 845–858. [Google Scholar] [CrossRef]
- Lina, C.; Conghua, W.; Nan, L.; Ping, Z. Combined treatment of etanercept and MTX reverses Th1/Th2, Th17/Treg imbalance in patients with rheumatoid arthritis. J Clin Immunol. 2011, 31, 596–605. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, V.; Rink, L.; Uciechowski, P. The Th17/Treg balance is disturbed during aging. Exp Gerontol. 2013, 48, 1379–1386. [Google Scholar] [CrossRef] [PubMed]














| Primers | Sequences (5'- 3') |
| VSV N | Forward: GGAATAAACATCGGGAAAG |
| Reverse: TGGTTGCCTTTGTATCTACTT | |
| TLR3 | Forward: TCGGCAACGGTTCCTTCTCC |
| Reverse: AATGCTCGCTTCAAACTCAGGTAC | |
| TLR7 | Forward: AAAGCCCTTTACCTGGATGGAAAC |
| Reverse: TCGTGATGGAGAAGATGTTGTTAGC | |
| TLR8 | Forward: GGTTATGTTGGCTGCTCTGGTTC |
| Reverse: TGGGATGTGGATGAAGTCCTGTA | |
| TLR9 | Forward: AACCTCAGCCACAACATTCTCAAG |
| Reverse: CACCTCCAACAGTAAGTCTACGAAG | |
| ASFV-p72 | Forward: CTGCTCATGGTATCAATCTTATCGA |
| Reverse: GATACCACAAGATCAGCCGT | |
| ASFV-p30 | Forward: ATCTACGCAGGACAGGGATACAC |
| Reverse: GTCGTTCTTCTCGTGGATGTTCTC | |
| T-bet | Forward: ATCACTAAGCAAGGACGGCGAATG |
| Reverse: TCCACCAAGACCACATCCACAAAC | |
| GATA-3 | Forward: TCTGGAGGAGGAACGCTAATGGG |
| Reverse: CGGGTCTGGATGCCTTCTTTCTTC | |
| RORγt | Forward: TGTCCCGAGATGCTGTCAAGTTTG |
| Reverse: TCCTGTTGCTGCTGCTGTTGC | |
| Foxp3 | Forward: AAGAATGCCATCCGCCACAACC |
| Reverse: TACGGTCCACACTGCTCCCTTC | |
| β-actin | Forward: CTGGCACCACACCTTCTACAATGAG |
| Reverse: TGGCGTGAGGGAGAGCATAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).