Submitted:
09 September 2024
Posted:
09 September 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Plant Material and Extraction
2.2. Cell Culture and ME Treatment
2.3. Determination of mRNA Transcription Levels
2.4. Composition Identification and Cell Metabolomics Based on LC-MS
2.5. Data Processing and Compound Identification
2.6. Comprehensive Metabolomics Analysis: From Multivariate Statistics to Pathway Enrichment and Network Visualization
2.7. Gene Ontology (GO) Analysis Methodology
3. Results
3.1. Evaluation of Safety and Efficacy: MIE and MBE's Impact on Cell Viability and NO Production in Inflammatory Conditions
3.2. Dose-Dependent Anti-Oxidative and Anti-inflammatory Effects of MIE and MBE
3.3. Comparative Metabolomic Profiling of Yellow and Blue Meconopsis Species: MIE and MBE Shared about 70% Composition
3.4. Molecular Insights into Meconopsis: GO Enrichment and Disease Network Analysis of Common Feature Targets
3.5. Metabolomic Profiling Reveals Anti-inflammatory Effects of Meconopsis Species in LPS-Stimulated RAW264.7 Cells
4. Discussion
4.1. Arachidonic Acid Metabolism
4.2. Glutathione and Methionine Metabolism
4.3. Arginine and Proline Metabolism
4.4. Energy Metabolism
4.5. Other Pathways
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Guo, Q.; Bai, R.; Zhao, B.; Feng, X.; Zhao, Y.; Tu, P.; Chai, X. An ethnopharmacological, phytochemical and pharmacological review of the genus Meconopsis. Am J Chin Med 2016, 44, 439–462. [Google Scholar] [CrossRef] [PubMed]
- Shi, N.; Wang, C.; Wang, J.; Wu, N.; Naudiyal, N.; Zhang, L.; Wang, L.; Sun, J.; Du, W.; Wei, Y.; et al. Biogeographic patterns and richness of the Meconopsis species and their influence factors across the Pan-Himalaya and adjacent regions. 2022, 14, 661. [Google Scholar] [CrossRef]
- Wang, W.; Guo, W.; Jarvie, S.; Svenning, J. The fate of Meconopsis species in the Tibeto-Himalayan region under future climate change. 2021, 11, 887–899. [Google Scholar] [CrossRef]
- Wangchuk, P.; Samten; Jamtsho, T. Phytopharmaceutical properties and quality assessment of two Himalayan medicinal plants, Meconopsis horridula and Meconopsis simplicifolia. Journal of Herbal Medicine 2023, 38, 100628. [Google Scholar] [CrossRef]
- Chen, J.; Zhang, Q.; Wang, R.; Yang, Y.; Wang, Y.; Liu, X.; Zhang, X.; Qiao, X.; Zhong, G.; Wei, J.; et al. Preliminary study on the effective site and mechanism of action of Meconopsis quintuplinervia regel in alleviating acute alcoholic liver injury in mice. Journal of Ethnopharmacology 2023, 308, 116230. [Google Scholar] [CrossRef] [PubMed]
- He, X.; Burgess, K.; Yang, X.; Ahrends, A.; Gao, L.; Li, D. Upward elevation and northwest range shifts for alpine Meconopsis species in the Himalaya–Hengduan Mountains region. 2019, 9, 4055–4064. [Google Scholar] [CrossRef]
- He, J.; Huang, B.; Ban, X.; Tian, J.; Zhu, L.; Wang, Y. In vitro and in vivo antioxidant activity of the ethanolic extract from Meconopsis quintuplinervia. Journal of Ethnopharmacology 2012, 141, 104–110. [Google Scholar] [CrossRef]
- Zhao, F.; Bai, R.; Li, J.; Feng, X.; Jiao, S.; Wuken, S.; Ge, F.; Zhang, Q.; Zhou, X.; Tu, P.; et al. Meconopsis horridula Hook. f. & Thomson extract and its alkaloid oleracein E exert cardioprotective effects against acute myocardial ischaemic injury in mice. Journal of Ethnopharmacology 2020, 258, 112893. [Google Scholar] [CrossRef]
- Yang, F.; Qin, A.; Li, Y.; Wang, X. Great genetic differentiation among populations of Meconopsis integrifolia and its implication for plant speciation in the Qinghai-Tibetan Plateau. PLOS ONE 2012, 7, e37196. [Google Scholar] [CrossRef]
- Fan, J.; Wang, Y.; Wang, X.; Wang, P.; Tang, W.; Yuan, W.; Kong, L.; Liu, Q. The antitumor activity of Meconopsis Horridula Hook, a traditional Tibetan medical plant, in murine leukemia L1210 cells. Cellular Physiology and Biochemistry 2015, 37, 1055–1065. [Google Scholar] [CrossRef]
- Sergeant, S.; Rahbar, E.; Chilton, F.H. Gamma-linolenic acid, Dihommo-gamma linolenic, eicosanoids and inflammatory processes. European Journal of Pharmacology 2016, 785, 77–86. [Google Scholar] [CrossRef] [PubMed]
- Kikut, J.; Komorniak, N.; Ziętek, M.; Palma, J.; Szczuko, M. Inflammation with the participation of arachidonic (AA) and linoleic acid (LA) derivatives (HETEs and HODEs) is necessary in the course of a normal reproductive cycle and pregnancy. Journal of Reproductive Immunology 2020, 141, 103177. [Google Scholar] [CrossRef] [PubMed]
- Sul, O.-J.; Ra, S.W. Quercetin prevents LPS-induced oxidative stress and inflammation by modulating NOX2/ROS/NF-kB in lung epithelial cells. Molecules 2021, 26(22), 6949. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.; Xiao, Y.; Hu, H.; Zou, Q.; Li, Y.; Gao, Y.; Ge, W.; Cheng, X.; Sun, S.C. Proinflammatory TLR signalling is regulated by a TRAF2-dependent proteolysis mechanism in macrophages. Nat Commun 2015, 6, 5930. [Google Scholar] [CrossRef]
- Mohammadi, A.; Sharifi, A.; Pourpaknia, R.; Mohammadian, S.; Sahebkar, A. Manipulating macrophage polarization and function using classical HDAC inhibitors: implications for autoimmunity and inflammation. Crit Rev Oncol Hematol 2018, 128, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Zhang, A.; Sun, H.; Yan, G.; Wang, P.; Wang, X. Mass spectrometry-based metabolomics: applications to biomarker and metabolic pathway research. Biomed. Chromatogr. 2016, 30, 7–12. [Google Scholar] [CrossRef]
- Hanna, V.S.; Hafez, E.A.A. Synopsis of arachidonic acid metabolism: a review. J Adv Res 2018, 11, 23–32. [Google Scholar] [CrossRef]
- Herschman, H.R. , Xie, W., Reddy, S. (1999). Function and regulation of prostaglandin synthase 2. in: Honn, K.V., Marnett, L.J., Nigam, S., Dennis, E.A. (eds) Eicosanoids and other bioactive lipids in cancer, inflammation, and radiation injury, 4. Advances in Experimental Medicine and Biology, vol 469. Springer, Boston, MA. [CrossRef]
- Granström, E. The arachidonic acid cascade. Inflammation 1984, 8, S15–S25. [Google Scholar] [CrossRef]
- Brenna, J.T.; Salem, N., Jr.; Sinclair, A.J.; Cunnane, S.C. α-Linolenic acid supplementation and conversion to n-3 long-chain polyunsaturated fatty acids in humans. Prostaglandins Leukot Essent Fatty Acids 2009, 80, 85–91. [Google Scholar] [CrossRef]
- Averill-Bates, D.A. The antioxidant glutathione. Vitamins and Hormones 2023, 121, 109–141. [Google Scholar] [CrossRef]
- Lever, M.; McEntyre, C.J.; George, P.M.; Chambers, S.T. Is N,N-dimethylglycine N-oxide a choline and betaine metabolite? Biol. Chem. 2017, 398, 775–784. [Google Scholar] [CrossRef]
- Magnusson, M.; Wang, T.J.; Clish, C.; Engström, G.; Nilsson, P.; Gerszten, R.E.; Melander, O. Dimethylglycine deficiency and the development of diabetes. Diabetes 2015, 64, 3010–3016. [Google Scholar] [CrossRef] [PubMed]
- Sutter, B.M.; Wu, X.; Laxman, S.; Tu, B.P. Methionine inhibits autophagy and promotes growth by inducing the SAM-responsive methylation of PP2A. Cell 2013, 154, 403–415. [Google Scholar] [CrossRef] [PubMed]
- Gupta, N.; Gresser, M.J.; Ford-Hutchinson, A.W. Kinetic mechanism of glutathione conjugation to leukotriene A4 by leukotriene C4 synthase. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism 1998, 1391, 157–168. [Google Scholar] [CrossRef]
- Wijnands, K.A.P.; Castermans, T.M.R.; Hommen, M.P.J.; Meesters, D.M.; Poeze, M. Arginine and citrulline and the immune response in sepsis. Nutrients 2015, 7(3), 1426–1463. [Google Scholar] [CrossRef]
- Moncada, S.; Higgs, A. The L-Arginine-Nitric Oxide Pathway. N Engl J Med 1993, 329, 2002–2012. [Google Scholar] [CrossRef]
- Martí i Líndez, A.-A.; Reith, W. Arginine-dependent immune responses. Cellular and Molecular Life Sciences 2021, 78, 5303–5324. [Google Scholar] [CrossRef]
- Tsai, WB. , Long, Y., Savaraj, N., Feun, L.G., Kuo, M.T. (2017). Mechanisms of l-Arginine-Auxotrophic response and their cancer therapeutic implications. In: Patel, V., Preedy, V., Rajendram, R. (eds) L-Arginine in clinical nutrition. Nutrition and Health. Humana Press, Cham. [CrossRef]
- Wang, X.; Liu, Y.; Wang, S.; Pi, D.; Leng, W.; Zhu, H.; Zhang, J.; Shi, H.; Li, S.; Lin, X.; et al. Asparagine reduces the mRNA expression of muscle atrophy markers via regulating protein kinase B (Akt), AMP-activated protein kinase α, toll-like receptor 4 and nucleotide-binding oligomerisation domain protein signalling in weaning piglets after lipopolysaccharide challenge. British Journal of Nutrition 2016, 116, 1188–1198. [Google Scholar] [CrossRef]
- Chen, S.; Liu, Y.; Wang, X.; Wang, H.; Li, S.; Shi, H.; Zhu, H.; Zhang, J.; Pi, D.; Hu, C.-A.A.; et al. Asparagine improves intestinal integrity, inhibits TLR4 and NOD signaling, and differently regulates p38 and ERK1/2 signaling in weanling piglets after LPS challenge. Innate Immun. 2016, 22, 577–587. [Google Scholar] [CrossRef]
- Kieler, M.; Hofmann, M.; Schabbauer, G. More than just protein building blocks: how amino acids and related metabolic pathways fuel macrophage polarization. FEBS J. 2021, 288, 3694–3714. [Google Scholar] [CrossRef]
- Vettore, L.A.; Westbrook, R.L.; Tennant, D.A. Proline metabolism and redox; maintaining a balance in health and disease. Amino Acids 2021, 53, 1779–1788. [Google Scholar] [CrossRef]
- Ji, D.; Yin, J.; Li, D.; Zhu, C.; Ye, J.; Pan, Y. Effects of inflammatory and anti-inflammatory environments on the macrophage mitochondrial function. Scientific Reports 2020, 10, 20324. [Google Scholar] [CrossRef]
- Soto-Heredero, G.; Gómez de las Heras, M.M.; Gabandé-Rodríguez, E.; Oller, J.; Mittelbrunn, M. Glycolysis – a key player in the inflammatory response. FEBS J. 2020, 287, 3350–3369. [Google Scholar] [CrossRef]
- Chiba, S.; Hisamatsu, T.; Suzuki, H.; Mori, K.; Kitazume, M.T.; Shimamura, K.; Mizuno, S.; Nakamoto, N.; Matsuoka, K.; Naganuma, M.; et al. Glycolysis regulates LPS-induced cytokine production in M2 polarized human macrophages. Immunology Letters 2017, 183, 17–23. [Google Scholar] [CrossRef]
- Boscá, L.; González-Ramos, S.; Prieto, P.; Fernández-Velasco, M.; Mojena, M.; Martín-Sanz, P.; Alemany, S. Metabolic signatures linked to macrophage polarization: from glucose metabolism to oxidative phosphorylation. Biochemical Society Transactions 2015, 43, 740–744. [Google Scholar] [CrossRef]
- Palmieri, E.M.; Holewinski, R.; McGinity, C.L.; Pierri, C.L.; Maio, N.; Weiss, J.M.; Tragni, V.; Miranda, K.M.; Rouault, T.A.; Andresson, T.; et al. Pyruvate dehydrogenase operates as an intramolecular nitroxyl generator during macrophage metabolic reprogramming. Nature Communications 2023, 14, 5114. [Google Scholar] [CrossRef]
- Bonvini, A.; Rogero, M.M.; Coqueiro, A.Y.; Raizel, R.; Bella, L.M.; Fock, R.A.; Borelli, P.; Tirapegui, J. Effects of different branched-chain amino acids supplementation protocols on the inflammatory response of LPS-stimulated RAW 264.7 macrophages. Amino Acids 2021, 53, 597–607. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.; Wang, S.; Zhang, C.; Zhao, Y. Coordinated Modulation of Energy Metabolism and Inflammation by Branched-Chain Amino Acids and Fatty Acids. Front. Endocrinol. 2020, 11, 617. [Google Scholar] [CrossRef]
- Liu, Y.; Xu, R.; Gu, H.; Zhang, E.; Qu, J.; Cao, W.; Huang, X.; Yan, H.; He, J.; Cai, Z. Metabolic reprogramming in macrophage responses. Biomarker Research 2021, 9, 1. [Google Scholar] [CrossRef]
- Ham, M.; Lee, J.-W.; Choi, A.H.; Jang, H.; Choi, G.; Park, J.; Kozuka, C.; Sears, D.D.; Masuzaki, H.; Kim, J.B. Macrophage glucose-6-phosphate dehydrogenase stimulates proinflammatory responses with oxidative stress. Molecular and Cellular Biology 2013, 33, 2425–2435. [Google Scholar] [CrossRef] [PubMed]
- Linden, J.; Koch-Nolte, F.; Dahl, G. Purine release, metabolism, and signaling in the inflammatory response. Annu Rev Immunol 2019, 37, 325–347. [Google Scholar] [CrossRef]
- John, S.V.; Seim, G.L.; Erazo-Flores, B.J.; Steill, J.; Freeman, J.; Votava, J.A.; Arp, N.L.; Qing, X.; Stewart, R.; Knoll, L.J.; et al. Macrophages undergo functionally significant reprograming of nucleotide metabolism upon classical activation. bioRxiv 2023, 12, 27–573447. [Google Scholar] [CrossRef]
- Haskó, G.; Pacher, P. Regulation of Macrophage Function by Adenosine. J. Am. Heart Assoc. 2012, 32, 865–869. [Google Scholar] [CrossRef]
- Yanaka, N.; Koyama, T.-A.; Komatsu, S.-I.; Nakamura, E.; Kanda, M.; Kato, N. Vitamin B6 suppresses NF-κB activation in LPS-stimulated mouse macrophages. Int J Mol Med 2005, 16, 1071–1075. [Google Scholar] [CrossRef]
- Shan, M.-R.; Zhou, S.-N.; Fu, C.-N.; Song, J.-W.; Wang, X.-Q.; Bai, W.-W.; Li, P.; Song, P.; Zhu, M.-L.; Ma, Z.-M.; et al. Vitamin B6 inhibits macrophage activation to prevent lipopolysaccharide-induced acute pneumonia in mice. J. Cell. Mol. Med. 2020, 24, 3139–3148. [Google Scholar] [CrossRef]









| Gene | Forward primer (5'-3') | Reverse primer (3'-5') |
|---|---|---|
| IL-1β | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
| IL-1α | TCTCAGATTCACAACTGTTCGTG | AGAAAATGAGGTCGGTCTCACTA |
| TNF-α | GTAGCCCACGTCGTAGCAAA | ACAAGGTACAACCCATCGGC |
| IL-6 | TGGAGTACCATAGCTACCTGGA | TGGAAATTGGGGTAGGAAGGAC |
| β-actin | GATATCGCTGCGCTGGTCG | CATTCCCACCATCACACCCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).