Submitted:
17 July 2024
Posted:
18 July 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. Preparations of BSMV-RNAs
2.3. Inoculation Methods
2.4. Green Fluorescence Imaging
2.5. Quantitative RT-PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Construction of Gamma (γ) Vectors for BSMV-Mediated Assays
3.2. BSMV-Mediated Gene Silencing in Oats
3.3. BSMV-Mediated Gene Over-Expression in Oats
3.4. Progress and Timeline of BSMV-Mediated Assays
4. Discussion
4.1. Challenges of the BSMV-Mediated Assays
4.2. Advantages and Disadvantages
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rhaeva K, Kumar A. Chapter 37 - Application of virus-induced gene silencing in crops: mechanism, assessment of risk factors and ecological advantages. In: Gaur RK, Sharma P, Czosnek H, editors. Geminivirus: Detection, Diagnosis and Management [Internet]. Academic Press; 2022 [cited 2024 Jul 15]. p. 589–97.
- Zulfiqar S, Farooq MA, Zhao T, Wang P, Tabusam J, Wang Y, et al. Virus-Induced Gene Silencing (VIGS): A powerful tool for crop improvement and its advancement towards Epigenetics. Int J Mol Sci. 2023 Mar 15;24(6):5608. [CrossRef]
- Kumagai MH, Donson J, della-Cioppa G, Harvey D, Hanley K, Grill LK. Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proc Natl Acad Sci U S A. 1995 Feb 28;92(5):1679–83. [CrossRef]
- MACFARLANE, SA. Tobraviruses—plant pathogens and tools for biotechnology. Mol Plant Pathol. 2010 Mar 3;11(4):577–83. [CrossRef]
- Nyamesorto B, Zhang H, Rouse M, Wang M, Chen X, Huang L. A transcriptomic-guided strategy used in identification of a wheat rust pathogen target and modification of the target enhanced host resistance to rust pathogens. Front Plant Sci. 2022;13:962973.
- Qin D, Liu G, Liu R, Wang C, Xu F, Xu Q, et al. Positional cloning identified HvTUBULIN8 as the candidate gene for round lateral spikelet (RLS) in barley (Hordeum vulgare L.). Theor Appl Genet. 2023 Jan;136(1):7. [CrossRef]
- Han X, Zhang D, Hao H, Luo Y, Zhu Z, Kuai B. Transcriptomic analysis of three differentially senescing maize (Zea mays L.) inbred lines upon heat stress. International Journal of Molecular Sciences. 2023 Jan;24(12):9782. [CrossRef]
- Cheuk A, Houde M. A rapid and efficient method for uniform gene expression using the barley stripe mosaic virus. Plant Methods. 2017;13:24. [CrossRef]
- Pacak A, Geisler K, Jørgensen B, Barciszewska-Pacak M, Nilsson L, Nielsen TH, et al. Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat. Plant Methods. 2010 Nov 30;6:26. [CrossRef]
- Heap, I. Global perspective of herbicide-resistant weeds. Pest Manag Sci. 2014 Sep;70(9):1306–15. [CrossRef]
- Dyer, WE. Stress-induced evolution of herbicide resistance and related pleiotropic effects. Pest Manag Sci. 2018 Aug;74(8):1759–68. [CrossRef]
- Beffa R, Menne H, Köcher H. Herbicide Resistance Action Committee (HRAC): Herbicide classification, resistance evolution, survey, and resistance mitigation activities. In: Modern Crop Protection Compounds [Internet]. John Wiley & Sons, Ltd; 2019 [cited 2024 Jul 15]. p. 5–32.
- Keith BK, Lehnhoff EA, Burns EE, Menalled FD, Dyer WE. Characterisation of Avena fatua populations with resistance to multiple herbicides. Marshall J, editor. Weed Research. 2015 Dec;55(6):621–30. [CrossRef]
- Lehnhoff EA, Keith BK, Dyer WE, Peterson RK, Menalled F. Multiple herbicide resistance in wild oat and impacts on physiology, germinability, and seed production. Agronomy Journal. 2013 May;105(3):854–62. [CrossRef]
- Keith BK, Burns EE, Bothner B, Carey CC, Mazurie AJ, Hilmer JK, et al. Intensive herbicide use has selected for constitutively elevated levels of stress-responsive mRNAs and proteins in multiple herbicide-resistant Avena fatua L. Pest Manag Sci. 2017 Nov;73(11):2267–81. [CrossRef]
- Burns EE, Keith BK, Refai MY, Bothner B, Dyer WE. Constitutive redox and phosphoproteome changes in multiple herbicide resistant Avena fatua L. are similar to those of systemic acquired resistance and systemic acquired acclimation. J Plant Physiol. 2018 Jan;220:105–14. [CrossRef]
- MacGregor, DR. What makes a weed a weed? How virus-mediated reverse genetics can help to explore the genetics of weediness. outlook pest man. 2020 Oct 1;31(5):224–9. [CrossRef]
- Mellado-Sánchez M, McDiarmid F, Cardoso V, Kanyuka K, MacGregor DR. Virus-mediated transient expression techniques enable gene function studies in black-grass. Plant Physiol. 2020 Jun;183(2):455–9. [CrossRef]
- Burns EE, Keith BK, Refai MY, Bothner B, Dyer WE. Proteomic and biochemical assays of glutathione-related proteins in susceptible and multiple herbicide resistant Avena fatua L. Pesticide Biochemistry and Physiology. 2017 Aug 1;140:69–78. [CrossRef]
- Naylor JM, Jana S. Genetic adaptation for seed dormancy in Avena fatua. Can J Bot. 1976 Feb 1;54(3–4):306–12. [CrossRef]
- Johnson RR, Cranston HJ, Chaverra ME, Dyer WE. Characterization of cDNA clones for differentially expressed genes in embryos of dormant and nondormant Avena fatua L. caryopses. Plant Mol Biol. 1995 Apr 1;28(1):113–22. [CrossRef]
- Huang F, Spangler JR, Huang AY. In vivo cloning of up to 16 kb plasmids in E. coli is as simple as PCR. PLoS One. 2017 Aug 24;12(8):e0183974. [CrossRef]
- Holzberg S, Brosio P, Gross C, Pogue GP. Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J. 2002 May;30(3):315–27. [CrossRef]
- Wang X, Zhang H, Nyamesorto B, Luo Y, Mu X, Wang F, et al. A new mode of NPR1 action via an NB-ARC–NPR1 fusion protein negatively regulates the defence response in wheat to stem rust pathogen. New Phytologist [Internet]. 2020 Nov [cited 2022 Apr 29];228(3):959–72. [CrossRef]
- Wang X, Zhang H, Nyamesorto B, Luo Y, Mu X, Wang F, et al. A new mode of NPR1 action via an NB-ARC–NPR1 fusion protein negatively regulates the defence response in wheat to stem rust pathogen. New Phytologist. 2020;228(3):959–72. [CrossRef]
- Pond SLK, Murrell B, Poon AFY. Evolution of viral genomes - interplay between selection, recombination and other forces.
- Scofield SR, Huang L, Brandt AS, Gill BS. Development of a virus-induced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiology. 2005 Aug 1;138(4):2165–73. [CrossRef]
- Bruun-Rasmussen M, Madsen CT, Jessing S, Albrechtsen M. Stability of barley stripe mosaic virus-induced gene silencing in barley. Mol Plant Microbe Interact. 2007 Nov;20(11):1323–31. [CrossRef]
- Scofield SR, Nelson RS. Resources for Virus-Induced Gene Silencing in the Grasses. Plant Physiology. 2009 Jan 6;149(1):152–7. [CrossRef]
- Scofield, SR. Loss of Foreign DNA inserts from barley stripe mosaic virus vectors - potential consequences for use in functional genomics studies. International Journal of Plant Biology. 2023 Dec;14(4):1100–4.
- Montgomery J, Morran S, MacGregor DR, McElroy JS, Neve P, Neto C, et al. Current status of community resources and priorities for weed genomics research. Genome Biol. 2024 May 27;25(1):139. [CrossRef]
- Cook J, Wright L, Fiedler J, Keith BK, Dyer WE. Quantitative trait locus analysis of multiple herbicide resistance in Avena fatua. submitted.







| Name | Sequence | Tm (°C) | Size of the amplicon (bp) |
|---|---|---|---|
| AfPDSF1 | TGGATAACTCGTCAGGGTTTATG | 54.3 | 109 |
| AfPDSR1 | ACTGTTTCAGAGTGGATGGAAA | 54.1 | |
| GLUP F | CCTGGCAGTGAATTGTCTCAG | 55.8 | 148 |
| GLUP R | AAGTTTTCCTCTCCAACCTCC | 54.6 |
| Treatments | Lines | Efficiency rate (%) |
|---|---|---|
| BSMV:PDS | A. fatua | 50 |
| A. sativa | 48 | |
| T. aestivum | 100 | |
| BSMV:GFP | A. fatua | 82 |
| A. sativa | 66 | |
| T. aestivum | 100 | |
| BSMV:00 | A. fatua | 100 |
| A. sativa | 50 | |
| T. aestivum | 100 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).