Submitted:
08 May 2024
Posted:
10 May 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
3. Results
3.1 . Prevention for Oxidative Apoptosis by A. Senescens Extract
3.2 . Protection of Mitochondrial Activity by A. senescens Extract
3.3. Modulation of Expression of Apoptotic Makers by A. senescens Extract
3.4 . Protective Effects of A. senescens Extract against Oxidative Stress in Brine Shrimp
4. Discussion
5. . Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Sadan, O.; Bahat-Stromza, M.; Barhum, Y.; Levy, Y.S.; Pisnevsky, A.; Peretz, H.; Ilan, A.B.; Bulvik, S.; Shemesh, N.; Krepel, D.; et al. Protective effects of neurotrophic factor-secreting cells in a 6-OHDA rat model of Parkinson disease. Stem Cells Dev 2009, 18, 1179–1190. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.; Gilbert, R.M. Epidemiology of Parkinson Disease. Neurol Clin 2016, 34, 955–965. [Google Scholar] [CrossRef] [PubMed]
- Pope-Coleman, A.; Schneider, J.S. Effects of Chronic GM1 Ganglioside Treatment on Cognitieve and Motor Deficits in a Slowly Progressing Model of Parkinsonism in Non-Human Primates. Restor Neurol Neurosci 1998, 12, 255–266. [Google Scholar] [PubMed]
- Hoglinger, G.U.; Michel, P.P.; Champy, P.; Feger, J.; Hirsch, E.C.; Ruberg, M.; Lannuzel, A. Experimental evidence for a toxic etiology of tropical parkinsonism. Mov Disord 2005, 20, 118–119. [Google Scholar] [CrossRef] [PubMed]
- Mittal, S.; Bjornevik, K.; Im, D.S.; Flierl, A.; Dong, X.; Locascio, J.J.; Abo, K.M.; Long, E.; Jin, M.; Xu, B.; et al. beta2-Adrenoreceptor is a regulator of the alpha-synuclein gene driving risk of Parkinson's disease. Science 2017, 357, 891–898. [Google Scholar] [CrossRef]
- Balestrino, R.; Schapira, A.H.V. Parkinson disease. Eur J Neurol 2020, 27, 27–42. [Google Scholar] [CrossRef]
- Houldsworth, A. Role of oxidative stress in neurodegenerative disorders: A review of reactive oxygen species and prevention by antioxidants. Brain Communications 2024, fcad356. [Google Scholar] [CrossRef] [PubMed]
- Kiran, N.S.; Yashaswini, C.; Lowkesh, G.; Range, K.; Madhu, R. Phytochemicals and Herbal Medicines: Potential Drug Candidates for Obsessive-Compulsive Disorder Treatment. In Nutrition and Obsessive-Compulsive Disorder; CRC Press: 2024; pp. 189–200.
- Hernandez-Baltazar, D.; Zavala-Flores, L.M.; Villanueva-Olivo, A. The 6-hydroxydopamine model and parkinsonian pathophysiology: Novel findings in an older model. Neurologia 2017, 32, 533–539. [Google Scholar] [CrossRef] [PubMed]
- Breese, G.R.; Knapp, D.J.; Criswell, H.E.; Moy, S.S.; Papadeas, S.T.; Blake, B.L. The neonate-6-hydroxydopamine-lesioned rat: a model for clinical neuroscience and neurobiological principles. Brain Res Brain Res Rev 2005, 48, 57–73. [Google Scholar] [CrossRef]
- Bellance, N.; Lestienne, P.; Rossignol, R. Mitochondria: from bioenergetics to the metabolic regulation of carcinogenesis. Front Biosci (Landmark Ed) 2009, 14, 4015–4034. [Google Scholar] [CrossRef]
- Maggiorani, D.; Manzella, N.; Edmondson, D.E.; Mattevi, A.; Parini, A.; Binda, C.; Mialet-Perez, J. Monoamine Oxidases, Oxidative Stress, and Altered Mitochondrial Dynamics in Cardiac Ageing. Oxid Med Cell Longev 2017, 2017, 3017947. [Google Scholar] [CrossRef] [PubMed]
- Mayer, B.; Oberbauer, R. Mitochondrial regulation of apoptosis. News Physiol Sci 2003, 18, 89–94. [Google Scholar] [CrossRef] [PubMed]
- Dobo, J.; Swanson, R.; Salvesen, G.S.; Olson, S.T.; Gettins, P.G. Cytokine response modifier a inhibition of initiator caspases results in covalent complex formation and dissociation of the caspase tetramer. J Biol Chem 2006, 281, 38781–38790. [Google Scholar] [CrossRef] [PubMed]
- Vamos, M.; Welsh, K.; Finlay, D.; Lee, P.S.; Mace, P.D.; Snipas, S.J.; Gonzalez, M.L.; Ganji, S.R.; Ardecky, R.J.; Riedl, S.J.; et al. Expedient synthesis of highly potent antagonists of inhibitor of apoptosis proteins (IAPs) with unique selectivity for ML-IAP. ACS Chem Biol 2013, 8, 725–732. [Google Scholar] [CrossRef] [PubMed]
- Kvansakul, M.; Caria, S.; Hinds, M.G. The Bcl-2 Family in Host-Virus Interactions. Viruses 2017, 9. [Google Scholar] [CrossRef] [PubMed]
- Gervais, F.G.; Xu, D.; Robertson, G.S.; Vaillancourt, J.P.; Zhu, Y.; Huang, J.; LeBlanc, A.; Smith, D.; Rigby, M.; Shearman, M.S.; et al. Involvement of caspases in proteolytic cleavage of Alzheimer's amyloid-beta precursor protein and amyloidogenic A beta peptide formation. Cell 1999, 97, 395–406. [Google Scholar] [CrossRef] [PubMed]
- Ong, H.G.; Chung, J.-M.; Jeong, H.-R.; Kim, Y.-D.; Choi, K.; Shin, C.-H.; Lee, Y.-M. Ethnobotany of the wild edible plants gathered in Ulleung Island, South Korea. Genetic Resources and Crop Evolution 2016, 63, 409–427. [Google Scholar] [CrossRef]
- Pârvu, M.; Pârvu, A.E.; Vlase, L.; Rosca-Casian, O.; Pârvu, O.; Puscas, M. Allicin and alliin content and antifungal activity of Allium senescens L. ssp. montanum (FW Schmidt) Holub ethanol extract. J. Med. Plants Res 2011, 5, 6544–6549. [Google Scholar]
- Shin, G.-M.; Koppula, S.; Chae, Y.-J.; Kim, H.-S.; Lee, J.-D.; Kim, M.-K.; Song, M. Anti-hepatofibrosis effect of Allium senescens in activated hepatic stellate cells and thioacetamide-induced fibrosis rat model. Pharmaceutical biology 2018, 56, 632–642. [Google Scholar] [CrossRef]
- Kim, B.Y.; Shin, G.H.; Lee, I.S.; Kim, S.W.; Kim, H.S.; Kim, J.K.; Lee, S.G. Localization patterns of dopamine active transporter synthesizing cells during development of brine shrimp. Archives of insect biochemistry and physiology 2017, 94, e21378. [Google Scholar] [CrossRef]
- Kim, B.Y.; Song, H.Y.; Kim, M.Y.; Lee, B.H.; Kim, K.J.; Jo, K.J.; Kim, S.W.; Lee, S.G.; Lee, B.H. Distinctive localization of Group 3 late embryogenesis abundant synthesizing cells during brine shrimp development. Archives of insect biochemistry and physiology 2015, 89, 169–180. [Google Scholar] [CrossRef] [PubMed]
- Stefanatos, R.; Sanz, A. The role of mitochondrial ROS in the aging brain. FEBS letters 2018, 592, 743–758. [Google Scholar] [CrossRef] [PubMed]
- Datta, K.; Sinha, S.; Chattopadhyay, P. Reactive oxygen species in health and disease. National Medical Journal of India 2000, 13, 304–310. [Google Scholar]
- Umeno, A.; Biju, V.; Yoshida, Y. In vivo ROS production and use of oxidative stress-derived biomarkers to detect the onset of diseases such as Alzheimer’s disease, Parkinson’s disease, and diabetes. Free radical research 2017, 51, 413–427. [Google Scholar] [CrossRef]
- Giorgio, M.; Migliaccio, E.; Orsini, F.; Paolucci, D.; Moroni, M.; Contursi, C.; Pelliccia, G.; Luzi, L.; Minucci, S.; Marcaccio, M. Electron transfer between cytochrome c and p66Shc generates reactive oxygen species that trigger mitochondrial apoptosis. Cell 2005, 122, 221–233. [Google Scholar] [CrossRef] [PubMed]
- Jha, N.K.; Jha, S.K.; Kar, R.; Nand, P.; Swati, K.; Goswami, V.K. Nuclear factor-kappa β as a therapeutic target for Alzheimer's disease. Journal of neurochemistry 2019, 150, 113–137. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.-d.; Hou, J.-g.; Yang, G.; Jiang, S.; Chen, C.; Wang, Z.; Liu, Y.-y.; Ren, S.; Li, W. Icariin ameliorates cisplatin-induced cytotoxicity in human embryonic kidney 293 cells by suppressing ROS-mediated PI3K/Akt pathway. Biomedicine & Pharmacotherapy 2019, 109, 2309–2317. [Google Scholar]
- Zhang, Q.; Guo, S.; Hu, G. Toxic effects of two commercial polybrominated diphenyl ethers on Artemia larvae at three developmental stages. Crustaceana 2021, 94, 177–187. [Google Scholar] [CrossRef]
- Gronenberg, W.; López-Riquelme, G. Multisensory convergence in the mushroom bodies of ants and bees. Acta Biologica Hungarica 2004, 55, 31–37. [Google Scholar] [CrossRef]







| Gene | F/R* | Seq (5’ → 3’) |
|---|---|---|
| AKT | F | GGCTGCCAAGTGTCAAATCC |
| R | AGTGCTCCCCCACTTACTTG | |
| NFκB-P50 | F | CGGAGCCCTCTTTCACAGTT |
| R | TTCAGCTTAGGAGCGAAGGC | |
| NFκB-P52 | F | AGGTGCTGTAGCGGGATTTC |
| R | AGAGGCACTGTATAGGGCAG | |
| Bcl2 | F | CTGCTGACATGCTTGGAAAA |
| R | ATTGGGCTACCCCAGCAATG | |
| BAX | F | AGCGCTCCCCCACTTACTTG |
| R | GACAGGGACATCAGTCGCTT | |
| Cyt | F | ATGAATGACCACTCTAGCCA |
| R | ATAGAAACAGCCAGGACCGC | |
| GAPDH | F | GTGGTCTCCTCTGACTTCAACA |
| R | CTCTTCCTCTTGTGCTCTTGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).