Prerpints.org logo
Preprint
Article

Homobrassinolide Delays Huanglongbing Progression in Newly Planted Citrus Trees

This version is not peer-reviewed.

Submitted:

08 April 2024

Posted:

09 April 2024

You are already at the latest version

A peer-reviewed article of this preprint also exists.

Abstract
Huanglongbing (HLB), or citrus greening, is a devastating disease impacting citrus trees worldwide, with severe effects particularly noted in Florida. Current strategies to combat HLB have focused on aggressive replanting despite the high susceptibility of young trees to infection. In this context, it is critical to explore agronomic practices that can enhance the health and resistance of young citrus trees to HLB. Here, we demonstrate that treatment with homobrassinolide (HBr), a type of brassinosteroid, on newly planted citrus trees can delay HLB infection and improve tree health amidst the high psyllid pressure conditions endemic to Florida. Our study reveals a significant reduction in HLB infection rates in HBr-treated trees compared to control trees, with only 25% of treated trees testing positive for HLB by six months, in contrast to 100% infection in untreated trees. This delay in infection may be attributed to HBr inducing an immune response and negatively impacting psyllid performance, as subsequently demonstrated in a greenhouse experiment. Our findings suggest that HBr applications could serve as a viable strategy to enhance the resilience of citrus production against HLB, underscoring the need for further investigation into their mechanisms of action and potential role in a comprehensive pest and disease management strategy.
Keywords: 
Brassinosteroids
;  
citrus greening
;  
Diaphorina citri
;  
immune response
;  
infection rates
;  
plant health
Subject: 
Biology and Life Sciences  -   Horticulture

1. Introduction

Huanglongbing (HLB), also known as citrus greening, is the main threat facing citrus worldwide [1,2]. In Florida, the disease is associated with the gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas), with the Asian citrus psyllid (ACP) Diaphorina citri Kuwayama (Hemiptera: Liviidae) being the natural vector [3,4,5]. Currently, HLB is considered endemic in Florida [6]. Since the disease was first detected in 2005, citrus acreage and fruit production have been reduced by more than 70% in Florida [6,7] and continue to decline. The bacteria propagate within the phloem of citrus trees, producing blotchy mottle and chlorotic patterns on leaves, callose deposition in phloem, canopy die-back, root loss, poor-quality fruit, and premature fruit drop [8,9,10]. The decline of mature trees over the years due to the disease has driven the industry to adopt a very aggressive replanting strategy of new trees, either in whole blocks after removing the dead trees or by replacing individual affected trees (resetting). The risk of new plantings becoming infected is exceptionally high because young trees frequently flush, attracting more psyllids. These psyllids feed on the new flushes and transmit the bacteria to the plant’s vascular system, making them more vulnerable to infection than mature trees [11,12]. This is particularly important in the case of reset trees, as the surrounding environment usually contains mature declining trees that are heavily infected, which act as a source of inoculum for the psyllids. In this scenario of widespread infection and severe symptoms of HLB in Florida, agronomic practices that improve plant health in the presence of the disease are needed. It has been shown that epibrassinolide, a form of brassinosteroid (Br), can reduce bacterial titers and alleviate symptoms of greening in HLB-affected citrus trees in trials in Cuba. The effect seems to be mediated by the activation of many defense-related pathways in the tree [13]. Brs are a unique class of polyhydroxylated steroidal phytohormones. Among the more than 70 types of Br reported so far, 24-epibrassinolide and 28-homobrassinolide are the two most active forms of Brs, which are also available commercially [14]. Br signaling was initially studied in the context of growth and development. Still, more recently functional roles of Br in stress responses have been accumulating [15,16,17], and several crosstalk models of Br signaling and immune signaling have been proposed. Brs apparently integrate immune system function with normal growth and developmental programs, thus serving as essential regulators of the innate trade-off between disease resistance and plant growth. This seems to be plant-species specific, with disparate effects [18]. The role of Brs in plant responses to pathogens also appears to be complex, as the regulation of immunity occurs at multiple levels [19,20,21]. Recently, it has been demonstrated that Brs can coordinate and enhance salicylic acid-mediated immune responses in Arabidopsis thaliana [22]. Interestingly, the interplay between jasmonic acid (JA) and Brs in modulating responses to phloem-feeding insects has also been recently elucidated in plants. For instance, Br induces JA in response to phloem-feeding planthoppers in rice [23], and in citrus Canales et al. [13] have shown that allene oxidase synthase, a key enzyme in the JA synthesis pathway, is induced by epibrassinolide treatment.
In Florida, a formulation of homobrassinolide is available and labeled for use in citrus at the commercial level. Studies on the effects of homobrassinolides (HBr) on responses to plant diseases or biotic stress are still scarce, and to the best of our knowledge, such studies have not yet been conducted in citrus. In this work, we provide the first evidence that HBr, when applied to newly planted citrus trees in an area of high psyllid pressure and endemic HLB conditions, can reduce the rate of HLB infection and improve tree performance. The possible mechanisms of action are presented and discussed.

2. Results

2.1. Field Experiment

In this work, we have assessed the effect of HBr treatments on HLB incidence in newly planted citrus trees. Trees were planted from the nursery when they were 18 months old. Then, trees received HBr treatment monthly. After planting, 80% of trees that did not receive the HBr treatment tested positive for HLB by 6 months, and by 1 year, all trees were infected (Figure 1). In contrast, only 25% of trees treated monthly with HBr tested positive for HLB by 6 months, and still some trees (15%) were HLB-negative after 1 year (Figure 1). After one year post-transplantation, during which the trees had not received any pesticide treatment, it was decided to assess the status of two key pests in Florida citrus cultivation: the citrus rust mite (CRM), Phyllocoptruta oleivora (Ashmead) (Acari: Eriophyidae) and the ACP. To do this, the attack of the CRM was evaluated first by counting the number of mites per surface and the percentage of surface scarred by CRM on the fruit peel. The number of CRM was similar in both treatments (t = 0.5838; df = 1, 8; P = 0.575; Figure 2a), but the scarred surface was significantly smaller in fruits sampled from HBr-treated trees compared to those from the control (t = 3.800; df = 1, 8; P = 0.0052; Figure 2b). To sample ACP, an initial adult population was estimated using stem-tap sampling, which yielded similar results in both treatments (t = 0.138; df = 1, 8; P = 0.894; Figure 2c). However, upon further evaluation of the number of eggs, nymphs, and adults present per tender flush, a lower number of individuals were found in the flushes of HBr-treated- compared to the control (t = 2.358; df = 1, 8; P = 0.046; Figure 2d).

2.2. Greenhouse Experiment

To confirm the results obtained in the field and delve deeper into the effects that HBr treatments may have on the ACP, we decided to set up a greenhouse experiment under controlled conditions. To accomplish this, we released 5 pairs of D. citri per two-year-old plant (Valencia grafted onto X-639). We assessed their performance on plants previously treated with HBr, followed by weekly treatments, comparing them with control plants treated with water. The number of D. citri individuals that developed on HBr-treated plants was significantly lower than that of the control treatment (F = 28.823; df = 1, 34; P < 0.001) (Figure 3a). When we analyzed the population dynamics of D. citri by developmental instar/stage, these differences persisted across all cases. The number of eggs laid was higher in the control group compared to the HBr-treated plants (F = 14.794; df = 1, 34; P = 0.001) (Figure 3b). Accordingly, the number of young nymphs (N1, N2, and N3) and the number of mature nymphs (N4 and N5) was higher in the control treatment than in the HBr-treated plants [F = 7.101; df = 1, 16; P = 0.012 and F = 5.703; df = 1, 25; P = 0.025, respectively) (Figure 3c,d). Additionally, the resulting number of adults was also more significant in the control treatment compared to the HBr-treated group (F = 9.701; df = 1, 36; P = 0.007) (Figure 3e). The structure of the sampled population data allowed us to estimate the mortality rates for each stage transition of D. citri, enabling us to observe that the mortality of D. citri, including eggs, nymphs, and total (from egg to adult), was higher in the HBr-treated plants than in the control plants (Table 1).
In addition to observing the psyllid’s performance, we studied how this treatment affected the plants’ immune system by analyzing the expression of salicylic acid, jasmonic acid, and an antimicrobial peptide (SAMP) markers 48 hours after the first application of HBr. In response to HBr treatment, differential regulation of genes was observed in both the salicylic acid and jasmonic acid metabolic pathways, along with the SAMP marker, with higher expression in the HBr-treated plants. In the salicylic acid pathway, the upstream genes ICS (Isochorismate Synthase) and PAL (Phenylalanine Ammonia-Lyase) showed significant increases in their expression (t = 3.295, df = 1, 7, P = 0.006 and t = 4.276, df = 1, 7, P = 0.009, respectively), indicating early activation of this pathway. Simultaneously, there was a notable surge in the expression of the downstream gene NPR1 (Nonexpressor of Pathogenesis-Related Genes 1) (t = 5.167, df = 1, 7, P = 0.001), indicative of a robust activation of associated defense mechanisms. In the jasmonic acid pathway, the upstream genes AOS (Allene Oxide Synthase) and LOX2 (Lipoxygenase 2) increased their expression (t = 3.009, df = 1, 7, P = 0.010 and t = 2.472, df = 1, 7, P = 0.021, respectively), while the downstream genes MYC2 (Transcription Factor MYC2) and JAR1 (Jasmonate Resistant 1) also showed significant increases (t = 4.072, df = 1, 7, P = 0.024 and t = 2.917, df = 1, 7, P = 0.011, respectively), indicating pathway activation and modulation of the plant’s response. Lastly, the SAMP peptide marker reflected an increase in its expression (t = 2.014; df = 1, 7; P = 0.042) induced by HBr treatment (Figure 4).

3. Discussion

Our results provide evidence that treatment with homobrassinolides (HBr) has an impact on reducing the incidence of Huanglongbing (HLB) in newly planted citrus under high psyllid pressure and endemic HLB conditions in Florida. This study adds to the growing body of knowledge about the positive physiological effects of brassinosteroids, such as the advancement of flowering, acceleration of fruit maturation, and increased fruit yield [24,25,26]. Furthermore, our work aligns with previous studies that demonstrated the capacity of other brassinosteroids to enhance the health of citrus affected by HLB through the activation of plant defense pathways [13].
In our greenhouse experiment, HBr treatment induced differential regulation of genes in the SA and JA metabolic pathways and increased the expression of an antimicrobial peptide marker (SAMP). The coordination between the salicylic and jasmonic acid pathways and the induction of SAMP illustrates a sophisticated mechanism by which HBr may confer citrus plants with increased capacity to resist or delay HLB progression.
It has been suggested that Brs enhance SA-mediated defense responses, and it has been proposed that an adequately sized endogenous Brs pool should be maintained to support SA responses and downstream signaling [22]. Our data strongly support this finding, as exogenous Brs treatment of young citrus plants induced both pathways leading to SA biosynthesis, the chorismate mutase and the isochorismate synthase pathways, and also induced downstream immune-related gene expression.
The early activation of the salicylic acid pathways, as indicated by a significant increase in the expression of ICS and PAL genes, suggests that HBr treatment could prime plants for a rapid and effective response against pathogens. This early activation is crucial, as salicylic acid plays a central role in acquired systemic resistance [27], allowing the plant to bolster its defenses before the pathogen can establish itself. Furthermore, the notable increase in NPR1 expression, a key regulator of salicylic acid-mediated gene expression, underscores the potent activation of related defense mechanisms, potentially explaining the delay in HLB progression in HBr-treated plants. NPR1 is crucial in controlling HLB due to its role in regulating the immune balance of plants [28,29,30,31]. CLas infection triggers unbalanced immune responses, leading to an overaccumulation of callose and reactive oxygen species (ROS), which causes phloem obstruction and the development of HLB symptoms [32]. However, it has been discovered that overexpression of the AtNPR1 gene from Arabidopsis thaliana in susceptible varieties confers robust HLB tolerance [33]. The overexpression of AtNPR1 suppresses the overaccumulation of callose and ROS induced by CLas in citrus and Arabidopsis, respectively [34]. The function of NPR1 is centered on its interaction with SA, where NPR1 acts as an SA receptor, promoting redox changes that convert NPR1 from an oligomeric complex to monomers that move to the nucleus. There, NPR1 interacts with TGA transcription factors to activate the transcription of defense genes, including PR genes [32]. Sarkar et al. [32] suggest that NPR1 overexpression is a promising route for the development of HLB-tolerant citrus through genetic manipulation. In our work, we have demonstrated that plants treated with HBr significantly overexpress the NPR1 gene.
Concurrently, activation of the jasmonic acid pathway, evidenced by increased expression of AOS and LOX2 genes, along with significant increases in MYC2 and JAR1, reflects modulation of another critical pathway in the plant’s response to stress and pathogen attack. This pathway, complementary to the salicylic acid pathway, is associated with defense against herbivores and certain types of microbial infections [35,36], suggesting an integrated defense strategy that could limit the effectiveness of HLB vectors, as observed in the greenhouse experiment. The AOS and LOX2 genes play essential roles in the initial stages of JA biosynthesis. At the same time, MYC2 and JAR1 are fundamental in the signaling and response to JA, modulating the expression of defensive genes and resistance to herbivores [35]. The observed overexpression of AOS and LOX2 indicates an activation of JA metabolism in response to HBr treatment, suggesting increased JA production. MYC2, a key transcription factor in the JA pathway, and JAR1, involved in the conjugation of JA with isoleucine to form the active JA-Ile complex, also showed increased expression. This confirms the pathway’s activation and suggests a refined modulation of the plant’s defensive response upon HBr treatment. This activation of the JA pathway could explain the relationship between HBr treatment and increased D. citri mortality in HBr-treated plants. The overexpression of these genes indicates that plants are potentially amplifying their arsenal of defensive responses, which include the production of toxic or repellent secondary metabolites for herbivores, the induction of defense-related proteins such as protease inhibitors, and the fortification of physical structures of the plant [37]. The results obtained in the greenhouse experiment can explain the observed decrease in populations of D. citri and the damage caused by the CRM on HBr-treated plants in the field experiment. Previous research demonstrates the connection between JA signaling and herbivore resistance, showing that increased protease activity induced by JA can reduce the incidence of mites and other herbivores on plants [38,39,40,41,42,43]. These proteases interfere with protein digestion in herbivores, limiting their growth and survival in the host plant [44,45]. Therefore, HBr treatment appears to exert a systemic effect on plants, inducing JA-mediated defense responses resulting in reduced susceptibility to herbivore attacks. Although the quantity of CREM was similar in both treatments, the surface affected by these mites on the fruit was significantly smaller in HBr-treated plants, suggesting that while the treatment did not directly affect the mite population, it did improve the plant’s ability to mitigate damage caused by them. This protective effect could be related to the induction of specific proteins or changes in the plant surface composition that hinder mite feeding or reproduction. The lower quantity of ACP on tender shoots of HBr-treated plants also highlights the treatment’s impact on reducing herbivore viability.
The increase in SAMP peptide expression underscores a broad response to stress induced by HBr treatment, suggesting that HBr activates specific defense pathways and enhances the plant’s ability to handle stress, potentially improving its overall resilience to various threats. This peptide was described by Huang et al. [43] with potent antimicrobial activity that directly targets CLas but also activates innate immunity in citrus trees, offering both therapeutic and preventative capabilities. In our case, the HBr treatment increased its content in the HBr-treated plants.
The finding that HBr delays HLB progression in young trees opens up an exciting possibility in areas where HLB is endemic, such as Florida. Currently, citrus growers in Florida are increasingly using psyllid exclusion methods, such as Individual Protective Covers (IPCs). These are polyethylene mesh bags with pores smaller than the size of the psyllid’s body, effectively excluding the insect vector. The effectiveness of this tool in maintaining newly planted citrus trees free from disease has been recently reported [47,48]. IPCs have proven to be a promising strategy for protecting young trees from HLB, keeping them symptom-free and negative for HLB in trials. Trees under IPCs show faster growth and higher chlorophyll accumulation, suggesting that this approach could be helpful in extending tree productivity and improving the health of infected ones. However, eventually, IPCs have to be removed due to tree growth (typically 2 or 3 years after planting), leaving young trees exposed to infection. Any treatment that could prolong tree health is highly desirable in this scenario. We are currently investigating the effectiveness of a system that combines a physical barrier (the IPCs) followed by treatments with HBr.
In conclusion, HBr treatment represents a promising strategy for HLB management in citrus, offering an additional tool in the arsenal against this disease. The role of brassinosteroids, specifically HBr, in modulating plant immune response to biotic stress is becoming increasingly evident. However, much remains to be elucidated. Future research should focus on understanding more thoroughly the underlying molecular mechanisms of HBr’s observed effects and optimizing dosage and application timings to maximize benefits under commercial conditions. Additionally, it would be interesting to explore the interaction between HBr and other HLB management methods, such as the aforementioned IPCs, integrated management of ACP, and other citrus pests, and their effect on different citrus varieties, to develop more holistic and sustainable management approaches.

4. Materials and Methods

4.1. Field Experiment

4.1.1. Plant Material, Experimental Design, and Treatments

Six replicated plots of three 18-month-old ‘Valencia’ trees on ‘Cleopatra’ rootstock per treatment in a randomized complete block design were planted at the Southwest Florida Research and Education Center in Collier County, Florida (26.466966 N, 81.446917 W). Trees were fertilized using conventional granular fertilizer (8N-4P-8K; Diamond R, Fort Pierce, FL). Irrigation was by under-tree microjets. No insect management was performed in the experimental block during the experiment. Treatments were water (control) and 1 μM HBr (Homobrassinolide 0.1%, Repar Corp, Maryland, USA), and were performed monthly for 1 year.

4.1.2. Candidatus Liberibacter asiaticus (CLas) Detection

For bacterial infection estimation, leaves were collected from each individual tree every 3 months. Detection was performed as in [48]. Briefly, three to four mature leaves from recent flushes were randomly collected from the middle tree of each replicated plot every 3 months for 1 year. Petioles and midribs of leaves were excised, minced with a razor blade, lyophilized in a FreeZone 6 freeze-dry system (Labconco, Kansas City, MO, USA), and pulverized using a mini bead beater (Biospec products, INC. OK, USA). According to the manufacturer’s instructions, DNA from 100 mg of pulverized leaves was extracted using the Wizard Magnetic 96 DNA Plant System (Promega Corporation, Madison, WI, USA). DNA was quantified using a microplate reader (Synergy HTX Multimode Reader, Biotek instruments, INC, VT, USA) and normalized to 10 ng/µl. CLas was detected by quantitative real-time polymerase chain reaction (qRT-PCR) using a 7500 Fast Real-Time PCR system (Applied Biosystem, Foster City, CA, USA). The primers and probes used for detection were HLBas and HLBr and probe HLBp, respectively, as described in [49]. Samples with a Ct-value of less than 36 were considered as CLas-positive.

4.1.4. CRM and ACP Samplings

Trees set fruit for the first time 1 year after planting. We estimated the damage caused by rust mites and their number per fruit in these fruits. For this purpose, we counted in 8 randomly selected fruits on each central tree of each repetition the number of mites present in 1 cm2 of fruit surface using a 15x magnifying lens. Two measurements were taken per fruit. Additionally, the scarred surface caused by CRM damage was estimated for each fruit [50]. In each of the trees, the population of adult D. citri present was estimated using two stem-tap samples [51], and from two randomly selected shoots with tender leaves, the number of eggs, nymphs, and adult D. citri present was counted.

4.2. Greenhouse Experiment

4.2.1. Plants and Insects

Two-year-old “Valencia” cultivar plants, grafted onto rootstock “X-639,” a hybrid cross of Cleopatra mandarin [Citrus reshni (Tanaka)] and Poncirus trifoliata (L) Raf., were used. These citrus plants were obtained directly from a certified nursery. They were left undisturbed for two months without receiving any chemical treatment in an isolated and well-protected greenhouse before being used in the experiments. Three weeks before the start of the experiments, the plants were defoliated entirely and pruned, leaving 4-5 lateral branches on each one, with approximately 4-5 buds. They were allowed to re-sprout in the greenhouse where the experiment was conducted, each inside its corresponding cage. After three weeks, all the plants had an average of feather shoots of 7.2 ± 0.8, the preferred state for ACP oviposition [52].
Adults of D. citri were obtained from colonies established at the Southwest Florida Research & Education Center (SWFREC). These colonies were reared on Murraya paniculata (L.) Jack plants, with initial specimens collected from experimental fields at SWFREC. A binocular stereo microscope was used to isolate the psyllids and distinguish between females and males.

4.2.2. Diaphorina Citri Performance on HBr-Treated Plants

The experiment was conducted in a 20 x 6 m greenhouse located at SWFREC. The greenhouse was accessed through a double door. One Datalogger (HOBO U23 Pro v2 External Temperature/Relative Humidity Data Logger, HOBO dataloggers, Bourne, MA, USA) was placed in the center of the greenhouse to record temperature and relative humidity. This experiment was conducted in August 2022 and the environmental conditions were: average night/day temperature in the greenhouse: 34/20 °C; relative humidity varied between 45% and 96%. Natural photoperiods were about 11 h.
Five replicates were conducted for each treatment to be tested. The two treatments included water (control) and 1 μM HBr (Homobrassinolide 0.1%, Repar Corp, Maryland, USA), which were directly sprayed onto the plants 48 hours before releasing the D. citri adults and then weekly. Each replicate involved introducing a plant with receptive flushes for D. citri oviposition into an individual entomological cage measuring 60 × 60 × 90 cm (Insect Rearing Cage, Entomological Livestock Supplier, Parma, Italy), with five pairs of D. citri carefully selected and placed on the plants. Plants were watered twice a week. Four weekly evaluations assessed the numbers of D. citri (adults, eggs, and nymphs) per plant.

4.2.3. RNA Extraction and qRT PCR Analysis of Gene Expression

For gene expression determination, apical parts from five control and five treated plants were collected 48 hours after HBr treatment. Each sample was crushed in liquid nitrogen using a mortar and pestle. Total RNAs from 0.1 g of fresh leaf tissue was extracted with the RNeasy Plant Mini kit (Qiagen, Valencia, CA), following the manufacturer’s instructions. The RNA was quantified, and its purity was confirmed using a nanodrop. Following the manufacturer’s instructions, one µg of total RNA was used for gDNA removal and cDNA synthesis using QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA). The cDNA samples were stored at -80°C to further assay the defense genes’ expression in citrus.
Real-time PCR amplification was performed in a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), using NZYSupreme qPCR Green Master Mix (2x) (NZYTech, Lisboa, Portugal). Reactions were performed in a 10 μl volume containing 0.5 μM of each primer and 1 μg of cDNA template. The cycling program was set to 2 min of the pre-cycling stage (95 °C), 40 cycles of 5 s at 95 °C, 25 s at 58 °C and 15 s at 72 °C. Primer sequences of defensive genes ICS, PAL, NPR1, AOS, LOX2, MYC2, JAR1, SAMP, and the housekeeping gene GADPH used as a standard control gene for normalization are represented in Table 1).

4.3. Statistical Analysis

The number of preyed E. kuehniella eggs by males and females of N. tenuis, necrotic rings, and wilted during the zoophagy and phytophagy trial were subjected to a t-test (P < 0.05). Likewise, the duration of the biological cycle of both tested strains from egg to adult, for both males and females, was also subjected to a t-test (P < 0.05). The progeny and the longevity of the females were also analyzed using a t-test (P < 0.05). The greenhouse experiment aimed to assess the impact of HBr treatments on D. citri performance by studying various variables. A Generalized Linear Mixed Model (GLMM) was employed to analyze the total number of ACP, eggs, young, and mature instars, allowing for repeated measures. We utilized a Poisson distribution and a logarithmic link function to detect differences between the HBr-treated plants and the control group. Treatment was considered a fixed factor, while the week was treated as a random one. To explore variations among treatment levels, a post hoc analysis was conducted using the LSD test (P < 0.05). Dates with zero values (such as nymphs in the first week) were excluded from the statistical analysis. Mortality rates in both treatments were compared using a t-test (P < 0.05).
Table 2. List of genes and primers used to analyze the expression of defense-associated genes in citrus.
Table 2. List of genes and primers used to analyze the expression of defense-associated genes in citrus.
Genea Gene name Citrus ID Primer Sequence (5’→3’)
GAPDH Glyceraldehyde-3-phosphate dehydrogenase, LOC102624117 FW: GGAAGGTCAAGATCGGAATCAA
RV: CGTCCCTCTGCAAGATGACTCT
PAL Phenylalanine ammonia-lyase-like LOC102620464 FW: CACATTCTTGGTAGCGCTTTG
RV: AGCTACTTGGCTGACAGTATTC
ICS Isochorismate synthase 2, Chloroplastic LOC102630235 FW: GGAGGAGGAGAGAGTGAATTTG
RV: GGGTTGCTTCCTTCTACTATCC
NPR1 BTB/POZ domain and ankyrin repeat-containing protein LOC102617188 FW: GTACCTTGAAAACAGAGTTGGACTGG
RV: TGCTCCTCTTGCATTTTGAAAGGTG
MYC2 Transcription factor MYC2 LOC102626457 FW: TGCATCTACAGCCGACCC
RV: TAGGTCCAGCCCTCACGA
LOX2 Linoleate 13S-lipoxygenase 2-1, chloroplastic-like LOC102629656 FW: GAACCATATTGCCACTTTCG
RV: CGTCATCAATGACTTGACCA
AOS Allene oxide synthase AY243478 FW: AGATCTTATTCCCGAACATGGT
RV: CGGACTTCATCAACGGCAT
JAR1 Jasmonate Resistant 1 LOC102611440 FW: AAGGCGATGCAGTCACAATG
RV: TGGTGGAAATCAGGACCAAAG
SAMP response A/B barrel domain-containing protein HS1 LOC102628374 FW: AACAGGGGCAAGAATGTGAGCAT
RV: ACACGTACTGTTGTCGGTTTGTAGTCA

Author Contributions

Conceptualization, M.P.-H., A.U., and F.A.; methodology, M.P.-H., A.U., and F.A.; validation, M.P.-H., A.U., and F.A.; formal analysis, M.P.-H., A.U., and F.A.; investigation, M.P.-H., A.U., and F.A.; resources, M.P.-H., A.U., and F.A.; data curation, M.P.-H., A.U., and F.A.; writing—original draft preparation, M.P.-H., A.U., and F.A.; writing—review and editing, M.P.-H., A.U., and F.A.; project administration, M.P.-H., A.U., and F.A.; funding acquisition, M.P.-H., A.U., and F.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially supported by grants from the Citrus Research and Development Foundation (CRDF, project 22-003) and USDA NIFA SCRI, project 2022-70029-38481 and by the Spanish Ministry of Economy and Competitiveness, MINECO (PID2020-113234RR-I00), and by the Valencian Institute of Agricultural Research from the Valencian Regional Ministry of Agriculture, Fisheries, and Food (project “Sostenible” IVIA-52202F, which is eligible for co-financing by the European Union through the ERDF Operational Program). M.P.-H. and A.U. were the recipients of a research fellowship for the Mobility Stays Program funded by the Spanish Ministry of Universities (CAS21/00544 and PRX21/00719, respectively). Both fellows were included in the FULBRIGHT program 2022.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

The authors would like to express their gratitude to the Citrus Horticulture laboratory team at SWFREC , Ana Redondo, Barry Kostyk, Mónica Triana, and Jean-Yves Berisse (SWFREC), and Omar Ruiz-Rivero (IVIA) for their assistance and collaboration in the development of this work, to Dr. Ozgur Batuman for allowing us to use his laboratory for the molecular portion of this study, and to Dr. Jawwad Qureshi for providing us with all the facilities to obtain individuals of D. citri and to use his facilities. A.U. and M.P.-H. would like to thank the Fulbright Foundation for granting the fellowship and for facilitating all the necessary permissions and documentation to carry out the stay at the University of Florida.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Urbaneja, A.; Grout, T.G.; Gravena, S.; Wu, F.; Cen, Y.; Stansly, P.A. Citrus Pests in a Global World. In The Genus Citrus; Elsevier, 2020; pp. 333–348.
  2. Ferrarezi, R.S.; Vincent, C.I.; Urbaneja, A.; Machado, M.A. Editorial: Unravelling Citrus Huanglongbing Disease. Front Plant Sci 2020, 11, 609655. [CrossRef]
  3. Bové, J.M. Huanglongbing: A Destructive Newly Emerging, Century-Old Disease of Citrus. Journal of Plant Pathology 2006, 88, 7–37.
  4. Gottwald, T.R. Current Epidemiological Understanding of Citrus Huanglongbing. Annu Rev Phytopathol 2010, 48, 119–139. [CrossRef]
  5. Hall, D.G.; Richardson, M.L.; Ammar, E.; Halbert, S.E. Asian Citrus Psyllid, <scp>D</Scp> Iaphorina Citri , Vector of Citrus Huanglongbing Disease. Entomol Exp Appl 2013, 146, 207–223. [CrossRef]
  6. Graham, J.; Gottwald, T.; Setamou, M. Status of Huanglongbing (HLB) Outbreaks in Florida, California and Texas. Trop Plant Pathol 2020, 45, 265–278. [CrossRef]
  7. Graham, J.; Morgan, K. Why Bicarbonates Matter for HLB Management. Citrus Industry 2017, 98, 16–21, doi:2017_April_bicarbonates.pdf (ufl.edu).
  8. Pustika, A.B.; Subandiyah, S.; Holford, P.; Beattie, G.A.C.; Iwanami, T.; Masaoka, Y. Interactions between Plant Nutrition and Symptom Expression in Mandarin Trees Infected with the Disease Huanglongbing. Australas Plant Dis Notes 2008, 3, 112–115. [CrossRef]
  9. Etxeberria, E.; Gonzalez, P.; Achor, D.; Albrigo, G. Anatomical Distribution of Abnormally High Levels of Starch in HLB-Affected Valencia Orange Trees. Physiol Mol Plant Pathol 2009, 74, 76–83. [CrossRef]
  10. Tang, L.; Chhajed, S.; Vashisth, T. Preharvest Fruit Drop in Huanglongbing-Affected ‘Valencia’ Sweet Orange. Journal of the American Society for Horticultural Science 2019, 144, 107–117. [CrossRef]
  11. Rogers, M.E.; Stansly, P.A.; Stelinski, L.L. 2012 Florida Citrus Pest Management Guide: Asian Citrus Psyllid and Citrus Leafminer 1 Asian Citrus Psyllid Psyllid Management. Entomol. Nematol. Dept., Fla. Coop. 2012, doi:00003029.pdf (ufl.edu).
  12. Hall, D.G.; Albrecht, U.; Bowman, K.D. Transmission Rates of ‘ Ca. Liberibacter Asiaticus’ by Asian Citrus Psyllid Are Enhanced by the Presence and Developmental Stage of Citrus Flush. J Econ Entomol 2016, 109, 558–563. [CrossRef]
  13. Canales, E.; Coll, Y.; Hernández, I.; Portieles, R.; Rodríguez García, M.; López, Y.; Aranguren, M.; Alonso, E.; Delgado, R.; Luis, M.; et al. ‘Candidatus Liberibacter Asiaticus’, Causal Agent of Citrus Huanglongbing, Is Reduced by Treatment with Brassinosteroids. PLoS One 2016, 11, e0146223. [CrossRef]
  14. Sirhindi, G.; Kumar, S.; Bhardwaj, R.; Kumar, M. Effects of 24-Epibrassinolide and 28-Homobrassinolide on the Growth and Antioxidant Enzyme Activities in the Seedlings of Brassica Juncea L. Physiology and Molecular Biology of Plants 2009, 15, 335–341. [CrossRef]
  15. Choudhary, S.P.; Yu, J.-Q.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.-S.P. Benefits of Brassinosteroid Crosstalk. Trends Plant Sci 2012, 17, 594–605. [CrossRef]
  16. Yu, M.-H.; Zhao, Z.-Z.; He, J.-X. Brassinosteroid Signaling in Plant–Microbe Interactions. Int J Mol Sci 2018, 19, 4091. [CrossRef]
  17. Bürger, M.; Chory, J. Stressed Out About Hormones: How Plants Orchestrate Immunity. Cell Host Microbe 2019, 26, 163–172. [CrossRef]
  18. De Bruyne, L.; Höfte, M.; De Vleesschauwer, D. Connecting Growth and Defense: The Emerging Roles of Brassinosteroids and Gibberellins in Plant Innate Immunity. Mol Plant 2014, 7, 943–959. [CrossRef]
  19. Khripach, V. Twenty Years of Brassinosteroids: Steroidal Plant Hormones Warrant Better Crops for the XXI Century. Ann Bot 2000, 86, 441–447. [CrossRef]
  20. Wang, Z.-Y. Brassinosteroids Modulate Plant Immunity at Multiple Levels. Proceedings of the National Academy of Sciences 2012, 109, 7–8. [CrossRef]
  21. Ali, S.S.; Kumar, G.B.S.; Khan, M.; Doohan, F.M. Brassinosteroid Enhances Resistance to Fusarium Diseases of Barley. Phytopathology 2013, 103, 1260–1267. [CrossRef]
  22. Kim, Y.-W.; Youn, J.-H.; Roh, J.; Kim, J.-M.; Kim, S.-K.; Kim, T.-W. Brassinosteroids Enhance Salicylic Acid-Mediated Immune Responses by Inhibiting BIN2 Phosphorylation of Clade I TGA Transcription Factors in Arabidopsis. Mol Plant 2022, 15, 991–1007. [CrossRef]
  23. Pan, G.; Liu, Y.; Ji, L.; Zhang, X.; He, J.; Huang, J.; Qiu, Z.; Liu, D.; Sun, Z.; Xu, T.; et al. Brassinosteroids Mediate Susceptibility to Brown Planthopper by Integrating with the Salicylic Acid and Jasmonic Acid Pathways in Rice. J Exp Bot 2018, 69, 4433–4442. [CrossRef]
  24. Alférez, F.; Vincent, C.; Vashisth, T. Update on Brassinosteroids for HLB Management. Citrus Industry 2019, June, 16–18.
  25. Yao, T.; Xie, R.; Zhou, C.; Wu, X.; Li, D. Roles of Brossinosteroids Signaling in Biotic and Abiotic Stresses. J Agric Food Chem 2023, 71, 7947–7960. [CrossRef]
  26. Rashidi, H.; Amiri, J.; Shirzad, H. Effect of Postharvest Treatment with 24-Epibrassinolide and Fennel (Foeniculum Vulgare) Essential Oil on Quality Attributes and Storage Life of Orange (Citrus Sinensis Cv. ‘Valencia’). Erwerbs-Obstbau 2023, 65, 927–939. [CrossRef]
  27. Yu, Y.; Gui, Y.; Li, Z.; Jiang, C.; Guo, J.; Niu, D. Induced Systemic Resistance for Improving Plant Immunity by Beneficial Microbes. Plants 2022, 11, 386. [CrossRef]
  28. Ibanez, F.; Suh, J.H.; Wang, Y.; Stelinski, L.L. Long-Term, Sustained Feeding by Asian Citrus Psyllid Disrupts Salicylic Acid Homeostasis in Sweet Orange. BMC Plant Biol 2019, 19, 493. [CrossRef]
  29. Wu, Q.; Moniruzzaman, M.; Yan, H.; Lv, Y.; Jiang, B.; Jiang, N.; Zhong, Y. The CsNPR1 Gene Expression Modulation in Citrus and Understanding the Defense Mechanism against Huanglongbing by Screening CsNPR1-Interacting Proteins. Sci Hortic 2021, 288, 110375. [CrossRef]
  30. Zhang, S.; Wang, X.; He, J.; Zhang, S.; Zhao, T.; Fu, S.; Zhou, C. A Sec-Dependent Effector, CLIBASIA_04425, Contributes to Virulence in ‘Candidatus Liberibater Asiaticus.’ Front Plant Sci 2023, 14. [CrossRef]
  31. Peng, A.; Zou, X.; He, Y.; Chen, S.; Liu, X.; Zhang, J.; Zhang, Q.; Xie, Z.; Long, J.; Zhao, X. Overexpressing a NPR1-like Gene from Citrus Paradisi Enhanced Huanglongbing Resistance in C. Sinensis. Plant Cell Rep 2021, 40, 529–541. [CrossRef]
  32. Ma, W.; Pang, Z.; Huang, X.; Xu, J.; Pandey, S.S.; Li, J.; Achor, D.S.; Vasconcelos, F.N.C.; Hendrich, C.; Huang, Y.; et al. Citrus Huanglongbing Is a Pathogen-Triggered Immune Disease That Can Be Mitigated with Antioxidants and Gibberellin. Nat Commun 2022, 13, 529. [CrossRef]
  33. Robertson, C.J.; Zhang, X.; Gowda, S.; Orbović, V.; Dawson, W.O.; Mou, Z. Overexpression of the Arabidopsis NPR1 Protein in Citrus Confers Tolerance to Huanglongbing. J Citrus Pathol 2018, 5. [CrossRef]
  34. Sarkar, P.; El-Mohtar, C.; Turner, D.; Welker, S.; Robertson, C.J.; Orbovic, V.; Mou, Z.; Levy, A. NONEXPRESSOR OF PATHOGENESIS-RELATED GENES Control Huanglongbing Tolerance by Regulating Immune Balance in Citrus Plants. bioRxiv 2024.03.18.585579 2024, 03.18.585579. [CrossRef]
  35. Ruan, J.; Zhou, Y.; Zhou, M.; Yan, J.; Khurshid, M.; Weng, W.; Cheng, J.; Zhang, K. Jasmonic Acid Signaling Pathway in Plants. Int J Mol Sci 2019, 20, 2479. [CrossRef]
  36. Erb, M.; Reymond, P. Molecular Interactions Between Plants and Insect Herbivores. Annu Rev Plant Biol 2019, 70, 527–557. [CrossRef]
  37. van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of Inducible Defense-Related Proteins in Infected Plants. Annu Rev Phytopathol 2006, 44, 135–162. [CrossRef]
  38. Thaler, J.S.; Farag, M.A.; Paré, P.W.; Dicke, M. Jasmonate-Deficient Plants Have Reduced Direct and Indirect Defences against Herbivores. Ecol Lett 2002, 5, 764–774. [CrossRef]
  39. Dicke, M.; Gols, R.; Ludeking, D.; Posthumus, M.A. Jasmonic Acid and Herbivory Differentially Induce Carnivore-Attracting Plant Volatiles in Lima Bean Plants. J Chem Ecol 1999, 25, 1907–1922. [CrossRef]
  40. Pérez-Hedo, M.; Arias-Sanguino, Á.M.; Urbaneja, A. Induced Tomato Plant Resistance against Tetranychus Urticae Triggered by the Phytophagy of Nesidiocoris Tenuis. Front Plant Sci 2018, 9, 1419. [CrossRef]
  41. Cruz-Miralles, J.; Cabedo-López, M.; Guzzo, M.; Pérez-Hedo, M.; Flors, V.; Jaques, J.A. Plant Defense Responses Triggered by Phytoseiid Predatory Mites (Mesostigmata: Phytoseiidae) Are Species-Specific, Depend on Plant Genotype and May Not Be Related to Direct Plant Feeding. BioControl 2021, 66, 381–394. [CrossRef]
  42. Cabedo-López, M.; Cruz-Miralles, J.; Vacas, S.; Navarro-Llopis, V.; Pérez-Hedo, M.; Flors, V.; Jaques, J.A. The Olfactive Responses of Tetranychus Urticae Natural Enemies in Citrus Depend on Plant Genotype, Prey Presence, and Their Diet Specialization. J Pest Sci (2004) 2019, 92, 1165–1177. [CrossRef]
  43. Dahmane, M.; Urbaneja, A.; Ruíz-Rivero, O.; Alonso-Valiente, M.; Pérez-Hedo, M. The Zoophytophagous Predator Pilophorus Clavatus (Hemiptera: Miridae) Induces Plant Defences in Citrus. J Pest Sci (2004) 2022, 95, 1519–1530. [CrossRef]
  44. Pappas, M.L.; Steppuhn, A.; Geuss, D.; Topalidou, N.; Zografou, A.; Sabelis, M.W.; Broufas, G.D. Beyond Predation: The Zoophytophagous Predator Macrolophus Pygmaeus Induces Tomato Resistance against Spider Mites. PLoS One 2015, 10, e0127251. [CrossRef]
  45. Santamaria, M.E.; Cambra, I.; Martinez, M.; Pozancos, C.; González-Melendi, P.; Grbic, V.; Castañera, P.; Ortego, F.; Diaz, I. Gene Pyramiding of Peptidase Inhibitors Enhances Plant Resistance to the Spider Mite Tetranychus Urticae. PLoS One 2012, 7, e43011. [CrossRef]
  46. Huang, C.-Y.; Araujo, K.; Sánchez, J.N.; Kund, G.; Trumble, J.; Roper, C.; Godfrey, K.E.; Jin, H. A Stable Antimicrobial Peptide with Dual Functions of Treating and Preventing Citrus Huanglongbing. Proceedings of the National Academy of Sciences 2021, 118, e2019628118. [CrossRef]
  47. Alferez, F.; Albrecht, U.; Gaire, S.; Batuman, O.; Qureshi, J.; Zekri, M. Individual Protective Covers (IPCs) for Young Tree Protection from the HLB Vector, the Asian Citrus Psyllid. EDIS 2021, 2021. [CrossRef]
  48. Gaire, S.; Albrecht, U.; Batuman, O.; Qureshi, J.; Zekri, M.; Alferez, F. Individual Protective Covers (IPCs) to Prevent Asian Citrus Psyllid and Candidatus Liberibacter Asiaticus from Establishing in Newly Planted Citrus Trees. Crop Protection 2022, 152, 105862. [CrossRef]
  49. Li, W.; Hartung, J.S.; Levy, L. Quantitative Real-Time PCR for Detection and Identification of Candidatus Liberibacter Species Associated with Citrus Huanglongbing. J Microbiol Methods 2006, 66, 104–115. [CrossRef]
  50. McCoy, C.W.; Albrigo, L.G. Feeding Injury to the Orange Caused by the Citrus Rust Mite, Phyllocoptruta Oleivora (Prostigmata: Eriophyoidea)1. Ann Entomol Soc Am 1975, 68, 289–297. [CrossRef]
  51. Monzo, C.; Arevalo, H.A.; Jones, M.M.; Vanaclocha, P.; Croxton, S.D.; Qureshi, J.A.; Stansly, P.A. Sampling Methods for Detection and Monitoring of the Asian Citrus Psyllid (Hemiptera: Psyllidae). Environ Entomol 2015, 44, 780–788. [CrossRef]
  52. Grafton-Cardwell, E.E.; Stelinski, L.L.; Stansly, P.A. Biology and Management of Asian Citrus Psyllid, Vector of the Huanglongbing Pathogens. Annu Rev Entomol 2013, 58, 413–432. [CrossRef]
Preprints 103440 g001
Figure 1. Percentage of trees infected by HLB in HBr-treated plants and control plants in the field trial located in the experimental plots of SWFREC.
Figure 1. Percentage of trees infected by HLB in HBr-treated plants and control plants in the field trial located in the experimental plots of SWFREC.
Preprints 103440 g001
Preprints 103440 g002
Figure 2. Number (mean ± SE) of citrus rust mites (CRM) per square centimeter of orange fruit peel surface (a), Percentage (mean ± SE) of scarred surface area of orange fruit peel (b), number (mean ± SE) of adults of D. citri (ACP) per stem-tap sampling (c), number (mean ± SE) of eggs, nymphs, and adults of D. citri per flush (d), for HBr-treated plants and control plants in the field trial located in the experimental plots of SWFREC. * and ** indicate significant differences at the 5%, 1%, and 0.01% levels by t-test. “ns” indicates no significance by t-test.
Figure 2. Number (mean ± SE) of citrus rust mites (CRM) per square centimeter of orange fruit peel surface (a), Percentage (mean ± SE) of scarred surface area of orange fruit peel (b), number (mean ± SE) of adults of D. citri (ACP) per stem-tap sampling (c), number (mean ± SE) of eggs, nymphs, and adults of D. citri per flush (d), for HBr-treated plants and control plants in the field trial located in the experimental plots of SWFREC. * and ** indicate significant differences at the 5%, 1%, and 0.01% levels by t-test. “ns” indicates no significance by t-test.
Preprints 103440 g002
Preprints 103440 g003
Figure 3. Number of total D. citri (ACP) (eggs + nymphs + adults) (a), number of eggs (b), number of young nymphs (c), number of mature nymphs (d), and number of adults (e) per plant per week (mean ± SE) for HBr-treated plants and control plants. Different letters between treatments indicate significant differences (GLMM, Repeated Measures; P < 0.05).
Figure 3. Number of total D. citri (ACP) (eggs + nymphs + adults) (a), number of eggs (b), number of young nymphs (c), number of mature nymphs (d), and number of adults (e) per plant per week (mean ± SE) for HBr-treated plants and control plants. Different letters between treatments indicate significant differences (GLMM, Repeated Measures; P < 0.05).
Preprints 103440 g003
Preprints 103440 g004
Figure 4. Transcriptional response of the plant defense marker genes ICS (Isochoristame Synthase; from the upstream SA biosynthetic pathway), PAL (Phenylalanine Ammonia-Lyase; from the upstream SA biosynthetic pathway), NPR1 (Nonexpressor of Pathogenesis-Related Genes 1; from the downstream SA biosynthetic pathway), AOS (Allene Oxide Synthase; from the upstream JA biosynthetic pathway), LOX2 (Lipoxygenase 2; from the upstream JA biosynthetic pathway), MYC2 (Transcription Factor MYC2; from the downstream JA biosynthetic pathway), JAR1 (Jasmonate Resistant 1; from the downstream JA biosynthetic pathway) and SAMP (Small Anti Microbial Peptide marker), HBr-treated plants and control plants. Data are presented as the mean independent transcript expression analyses relative to the constitutive GAPDH gene ± SE. *, ** and *** indicate significant differences at the 5%, 1% and 0.01% by t-test.
Figure 4. Transcriptional response of the plant defense marker genes ICS (Isochoristame Synthase; from the upstream SA biosynthetic pathway), PAL (Phenylalanine Ammonia-Lyase; from the upstream SA biosynthetic pathway), NPR1 (Nonexpressor of Pathogenesis-Related Genes 1; from the downstream SA biosynthetic pathway), AOS (Allene Oxide Synthase; from the upstream JA biosynthetic pathway), LOX2 (Lipoxygenase 2; from the upstream JA biosynthetic pathway), MYC2 (Transcription Factor MYC2; from the downstream JA biosynthetic pathway), JAR1 (Jasmonate Resistant 1; from the downstream JA biosynthetic pathway) and SAMP (Small Anti Microbial Peptide marker), HBr-treated plants and control plants. Data are presented as the mean independent transcript expression analyses relative to the constitutive GAPDH gene ± SE. *, ** and *** indicate significant differences at the 5%, 1% and 0.01% by t-test.
Preprints 103440 g004
Table 1. Mortality rates of D. citri at different developmental stages on control and HBr-treated plants, along with corresponding statistical analysis (t-test; P < 0.05).
Table 1. Mortality rates of D. citri at different developmental stages on control and HBr-treated plants, along with corresponding statistical analysis (t-test; P < 0.05).
Mortality Control plants HBr-treated plants Statistics
Egg 49.9 ± 16.3 65.0 ± 10.2 t1, 7 = 0.817; P = 0.441
Nymphal 35.9 ± 18.2 68.6 ± 11.2 t1, 7 = 1.600; P = 0.158
Egg-adult 76.6 ± 5.33 85.7 ± 6.8 t1, 7 = 1.008; P = 0.347
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.

Downloads

153

Views

70

Comments

0

Subscription

Notify me about updates to this article or when a peer-reviewed version is published.

Email

Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
MDPI Initiatives
Important Links
Subscribe

Disclaimer

Terms of Use

Privacy Policy

© 2025 MDPI (Basel, Switzerland) unless otherwise stated