Submitted:
04 April 2024
Posted:
04 April 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. SSADH Deficiency Patient Description
2.2. Molecular Characterization of the SSADH Deficiency Patient Variants
2.3. Bioinformatic Analyses of the SSADH Variants
2.4. Spectroscopic and Kinetic Features of the SSADH Variants
2.5. Folding Therapy Approaches for the SSADH Variants
3. Discussion
4. Materials and Methods
4.1. SSADH Deficiency Patient
4.2. Chemicals
4.3. Site Directed Mutagenesis of SSADH Expression Constructs
4.4. Eukaryotic Cell Culture
4.5. Generation of an SSADH-Deficient ALDH5A1 Knockout Flp-InTM-293 Cell Line
4.6. Generation of Stable SSADH Knock-in Cell Lines
4.7. Transient Overexpression
4.8. Treatment of the Cells with Betaine and Hsp-Inducing Agents
4.9. Western Blotting
4.10. SSADH Enzyme Activity
4.11. Immunocytochemistry
4.12. Bioinformatic Analyses
4.13. Expression, Purification and Enzymatic Assays of the Recombinant SSADH Species
4.14. Spectroscopic Analyses and Determination of the Equilibrium Dissociation Constant for NAD+
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Didiasova, M.; Banning, A.; Brennenstuhl, H.; Jung-Klawitter, S.; Cinquemani, C.; Opladen, T.; Tikkanen, R. Succinic Semialdehyde Dehydrogenase Deficiency: An Update. Cells 2020, 9. [CrossRef]
- Lee, H.H.C.; McGinty, G.E.; Pearl, P.L.; Rotenberg, A. Understanding the Molecular Mechanisms of Succinic Semialdehyde Dehydrogenase Deficiency (SSADHD): Towards the Development of SSADH-Targeted Medicine. Int J Mol Sci 2022, 23. [CrossRef]
- Gibson, K.M.; Sweetman, L.; Nyhan, W.L.; Jakobs, C.; Rating, D.; Siemes, H.; Hanefeld, F. Succinic semialdehyde dehydrogenase deficiency: An inborn error of gamma-aminobutyric acid metabolism. Clin Chim Acta 1983, 133, 33-42. [CrossRef]
- Jakobs, C.; Bojasch, M.; Mönch, E.; Rating, D.; Siemes, H.; Hanefeld, F. Urinary excretion of gamma-hydroxybutyric acid in a patient with neurological abnormalities. The probability of a new inborn error of metabolism. Clinica chimica acta; international journal of clinical chemistry 1981, 111, 169–178. [CrossRef]
- Chambliss, K.L.; Hinson, D.D.; Trettel, F.; Malaspina, P.; Novelletto, A.; Jakobs, C.; Gibson, K.M. Two exon-skipping mutations as the molecular basis of succinic semialdehyde dehydrogenase deficiency (4-hydroxybutyric aciduria). Am J Hum Genet 1998, 63, 399-408. [CrossRef]
- Pearl, P.L.; Acosta, M.T.; Theodore, W.H.; Novotny, E.J.; Bennett, H.D. Human SSADH Deficiency – Phenotype and Treatment. 2006.
- Pearl, P.L.; Gibson, K.M.; Acosta, M.T.; Vezina, L.G.; Theodore, W.H.; Rogawski, M.A.; Novotny, E.J.; Gropman, A.; Conry, J.A.; Berry, G.T.; Tuchman, M. Clinical spectrum of succinic semialdehyde dehydrogenase deficiency. Neurology 2003, 60, 1413–1417. [CrossRef]
- Pearl, P.L.; Gibson, K.M.; Cortez, M.A.; Wu, Y.; Carter Snead, O., 3rd; Knerr, I.; Forester, K.; Pettiford, J.M.; Jakobs, C.; Theodore, W.H. Succinic semialdehyde dehydrogenase deficiency: Lessons from mice and men. J Inherit Metab Dis 2009, 32, 343-352. [CrossRef]
- Pearl, P.L.; Parviz, M.; Vogel, K.; Schreiber, J.; Theodore, W.H.; Gibson, K.M. Inherited disorders of gamma-aminobutyric acid metabolism and advances in ALDH5A1 mutation identification. Dev Med Child Neurol 2015, 57, 611-617. [CrossRef]
- Akaboshi, S.; Hogema, B.M.; Novelletto, A.; Malaspina, P.; Salomons, G.S.; Maropoulos, G.D.; Jakobs, C.; Grompe, M.; Gibson, K.M. Mutational spectrum of the succinate semialdehyde dehydrogenase (ALDH5A1) gene and functional analysis of 27 novel disease-causing mutations in patients with SSADH deficiency. Hum Mutat 2003, 22, 442-450. [CrossRef]
- Pop, A.; Smith, D.E.C.; Kirby, T.; Walters, D.; Gibson, K.M.; Mahmoudi, S.; van Dooren, S.J.M.; Kanhai, W.A.; Fernandez-Ojeda, M.R.; Wever, E.J.M.; Koster, J.; Waterham, H.R.; Grob, B.; Roos, B.; Wamelink, M.M.C.; Chen, J.; Natesan, S.; Salomons, G.S. Functional analysis of thirty-four suspected pathogenic missense variants in ALDH5A1 gene associated with succinic semialdehyde dehydrogenase deficiency. Molecular genetics and metabolism 2020, 130, 172–178. [CrossRef]
- Tokatly Latzer, I.; Roullet, J.B.; Cesaro, S.; DiBacco, M.L.; Arning, E.; Rotenberg, A.; Lee, H.H.C.; Opladen, T.; Jeltsch, K.; Garcia-Cazorla, A.; Julia-Palacios, N.; Gibson, K.M.; Bertoldi, M.; Pearl, P.L. Phenotypic correlates of structural and functional protein impairments resultant from ALDH5A1 variants. Hum Genet 2023, 142, 1755-1776. [CrossRef]
- ClinVar Database. Available online: https://www.ncbi.nlm.nih.gov/clinvar (accessed on 07.03.2024).
- GnomAD Database. Available online: https://gnomad.broadinstitute.org (accessed on 07.03.2024).
- ALDH5A1 variants GnomAD Database. Available online: https://gnomad.broadinstitute.org/gene/ALDH5A1?dataset=gnomad_r3 (accessed on 07.03.2024).
- Menduti, G.; Biamino, E.; Vittorini, R.; Vesco, S.; Puccinelli, M.P.; Porta, F.; Capo, C.; Leo, S.; Ciminelli, B.M.; Iacovelli, F.; Spada, M.; Falconi, M.; Malaspina, P.; Rossi, L. Succinic semialdehyde dehydrogenase deficiency: The combination of a novel ALDH5A1 gene mutation and a missense SNP strongly affects SSADH enzyme activity and stability. Mol Genet Metab 2018, 124, 210-215. [CrossRef]
- Didiasova, M.; Banning, A.; Tikkanen, R. Development of precision therapies for rare inborn errors of metabolism: Functional investigations in cell culture models. J Inherit Metab Dis 2023. [CrossRef]
- Brennenstuhl, H.; Didiasova, M.; Assmann, B.; Bertoldi, M.; Molla, G.; Jung-Klawitter, S.; Kuseyri Hubschmann, O.; Schroter, J.; Opladen, T.; Tikkanen, R. Succinic Semialdehyde Dehydrogenase Deficiency: In Vitro and In Silico Characterization of a Novel Pathogenic Missense Variant and Analysis of the Mutational Spectrum of ALDH5A1. Int J Mol Sci 2020, 21. [CrossRef]
- O'Gorman, S.; Fox, D.T.; Wahl, G.M. Recombinase-mediated gene activation and site-specific integration in mammalian cells. Science 1991, 251, 1351-1355. [CrossRef]
- Kim, Y.G.; Lee, S.; Kwon, O.S.; Park, S.Y.; Lee, S.J.; Park, B.J.; Kim, K.J. Redox-switch modulation of human SSADH by dynamic catalytic loop. EMBO J 2009, 28, 959-968. [CrossRef]
- Xiong, P.; Zhang, C.; Zheng, W.; Zhang, Y. BindProfX: Assessing Mutation-Induced Binding Affinity Change by Protein Interface Profiles with Pseudo-Counts. J Mol Biol 2017, 429, 426-434. [CrossRef]
- Sehnal, D.; Bittrich, S.; Deshpande, M.; Svobodova, R.; Berka, K.; Bazgier, V.; Velankar, S.; Burley, S.K.; Koca, J.; Rose, A.S. Mol* Viewer: Modern web app for 3D visualization and analysis of large biomolecular structures. Nucleic Acids Res 2021, 49, W431-W437. [CrossRef]
- Murtas, G.; Marcone, G.L.; Peracchi, A.; Zangelmi, E.; Pollegioni, L. Biochemical and Biophysical Characterization of Recombinant Human 3-Phosphoglycerate Dehydrogenase. Int J Mol Sci 2021, 22. [CrossRef]
- Mohamed, F.E.; Al-Gazali, L.; Al-Jasmi, F.; Ali, B.R. Pharmaceutical Chaperones and Proteostasis Regulators in the Therapy of Lysosomal Storage Disorders: Current Perspective and Future Promises. Frontiers in pharmacology 2017, 8, 448. [CrossRef]
- Parenti, G.; Andria, G.; Valenzano, K.J. Pharmacological Chaperone Therapy: Preclinical Development, Clinical Translation, and Prospects for the Treatment of Lysosomal Storage Disorders. Mol Ther 2015, 23, 1138-1148. [CrossRef]
- Parenti, G.; Moracci, M.; Fecarotta, S.; Andria, G. Pharmacological chaperone therapy for lysosomal storage diseases. Future Med Chem 2014, 6, 1031-1045. [CrossRef]
- Parenti, G.; Pignata, C.; Vajro, P.; Salerno, M. New strategies for the treatment of lysosomal storage diseases (review). Int J Mol Med 2013, 31, 11-20. [CrossRef]
- Banning, A.; Gulec, C.; Rouvinen, J.; Gray, S.J.; Tikkanen, R. Identification of Small Molecule Compounds for Pharmacological Chaperone Therapy of Aspartylglucosaminuria. Sci Rep 2016, 6, 37583. [CrossRef]
- Zhang, R.; Chen, L.; Jiralerspong, S.; Snowden, A.; Steinberg, S.; Braverman, N. Recovery of PEX1-Gly843Asp peroxisome dysfunction by small-molecule compounds. Proc Natl Acad Sci U S A 2010, 107, 5569-5574. [CrossRef]
- Craig, S.A. Betaine in human nutrition. Am J Clin Nutr 2004, 80, 539-549. [CrossRef]
- Pfanner, N.; Warscheid, B.; Wiedemann, N. Mitochondrial proteins: From biogenesis to functional networks. Nat Rev Mol Cell Biol 2019, 20, 267-284. [CrossRef]
- Kirkegaard, T.; Gray, J.; Priestman, D.A.; Wallom, K.-L.; Atkins, J.; Olsen, O.D.; Klein, A.; Drndarski, S.; Petersen, N.H.T.; Ingemann, L.; Smith, D.A.; Morris, L.; Bornæs, C.; Jørgensen, S.H.; Williams, I.; Hinsby, A.; Arenz, C.; Begley, D.; Jäättelä, M.; Platt, F.M. Heat shock protein-based therapy as a potential candidate for treating the sphingolipidoses. Science translational medicine 2016, 8, 355ra118. [CrossRef]
- Mengel, E.; Patterson, M.C.; Da Riol, R.M.; Del Toro, M.; Deodato, F.; Gautschi, M.; Grunewald, S.; Grønborg, S.; Harmatz, P.; Héron, B.; Maier, E.M.; Roubertie, A.; Santra, S.; Tylki-Szymanska, A.; Day, S.; Andreasen, A.K.; Geist, M.A.; Havnsøe Torp Petersen, N.; Ingemann, L.; Hansen, T.; Blaettler, T.; Kirkegaard, T.; Í Dali, C. Efficacy and safety of arimoclomol in Niemann-Pick disease type C: Results from a double-blind, randomised, placebo-controlled, multinational phase 2/3 trial of a novel treatment. Journal of inherited metabolic disease 2021, 44, 1463–1480. [CrossRef]
- Mu, T.-W.; Ong, D.S.T.; Wang, Y.-J.; Balch, W.E.; Yates, J.R.; Segatori, L.; Kelly, J.W. Chemical and biological approaches synergize to ameliorate protein-folding diseases. Cell 2008, 134, 769–781. [CrossRef]
- Mussche, S.; Devreese, B.; Nagabhushan Kalburgi, S.; Bachaboina, L.; Fox, J.C.; Shih, H.J.; Van Coster, R.; Samulski, R.J.; Gray, S.J. Restoration of cytoskeleton homeostasis after gigaxonin gene transfer for giant axonal neuropathy. Hum Gene Ther 2013, 24, 209-219. [CrossRef]
- E-Crispr tool. Available online: http://www.e-crisp.org (accessed on 23.04.2021).
- Consurf Server. Available online: https://consurf.tau.ac.il (accessed on 23.07.2023).








| Substitution | Sequence |
|---|---|
| Val90Ala | F: CGCTCTGGGCATGGCAGCCGACTGCGGGG R: CCCCGCAGTCGGCTGCCATGCCCAGAGCG |
| Cys93Phe | F: GGGCATGGTAGCCGACTTCGGGGTGCG R: CGCACCCCGAAGTCGGCTACCATGCCC |
| His180Tyr | F: GTGTTTACGGAGACATTATCTACACCCCGGCAAAG R: CTTTGCCGGGGTGTAGATAATGTCTCCGTAAACAC |
| Asn255Asp | F: GATTCCTTCAGGTGTATACGATGTTATTCCCTGTTCTCG R: CGAGAACAGGGAATAACATCGTATACACCTGAAGGAATC |
| Substitution | Sequence |
|---|---|
| Val90Ala | F: GCTGGGCATGGCTGCGGATTGCGGTG R: CACCGCAATCCGCAGCCATGCCCAGC |
| Cys93Phe | F: GCATGGTTGCGGATTTCGGTGTTCGTGAAGC R: GCTTCACGAACACCGAAATCCGCAACCATGC |
| His180Tyr | F: GTTTATGGTGACATCATTTACACCCCGGCGAAGG R: CCTTCGCCGGGGTGTAAATGATGTCACCATAAAC |
| Asn255Asp | F: GCGGCGTTTACGACGTGATTCCGTGCAG R: CTGCACGGAATCACGTCGTAAACGCCGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).