Submitted:
27 February 2024
Posted:
28 February 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Ethics
2.2. Human Samples: Blood Outgrowth Endothelial Cells Isolation and Cultivation
2.3. RNA Extraction, Reverse Transcription and Quantitative PCR
2.4. Proliferation Assay
2.5. Western Blot
2.6. Immunofluorescent Microscopy
2.7. Tubulogenesis: Endothelial Cell Tube Formation Assay
2.8. Wound Healing
3. Results
3.1. Endothelial Cells from Primary Cultures of the CCM1 Patient and Mutation of the CCM1 Case
3.2. Analysis of Endothelial Gene Differential Expression between Control and Mutated Cells from a Patient with Familial Cavernomatosis Type 1
3.3. CCM1 Endothelial Cells Proliferate Less Than Control Cells
3.4. CCM1-BOECs Show Enhanced Actin Stress Fibers in the Cytoskeleton Compared to C-BOECs
3.5. Functional Analysis in Control and CCM1 BOECs: Wound Healing Tubulogenesis Assays
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Calandriello, L.; Grimaldi, G.; Petrone, G.; Rigante, M.; Petroni, S.; Riso, M.; & Savino, G. Cavernous venous malformation (cavernous hemangioma) of the orbit: Current concepts and a review of the literature. Surv Ophthalmol, 2017; 62, 393–403. [CrossRef]
- Sartages, M.; García-Colomer, M.; Iglesias, C.; Howell, B.W.; Macía, M. J.; Peña, P.; Pombo, C. M.; & Zalvide, J. GCKIII (Germinal Center Kinase III) Kinases STK24 and STK25 (Serine/Threonine Kinase 24 and 25) Inhibit Cavernoma Development. Stroke, 2022; 53, 976–986. [CrossRef]
- Moore, S. A.; Brown, R. S.; Christianson, T. J.; & Flemming, K. D. Long-term natural history of incidentally discovered cavernous malformations in a single-center cohort. J Neurosurg, 2014; 120, 1188–1192. [CrossRef]
- Labauge, P.; Brunereau, L.; Levy, C.; Laberge, S.; & Jp, H. The natural history of familial cerebral cavernomas: a retrospective MRI study of 40 patients. Neuroradiol, 2000; 42, 327–332. [CrossRef] [PubMed]
- Horne, M.; Flemming, K. D. , Su, I.; Stapf, C., Jeon, J. Y., Li, D., Maxwell, S. S.; White, P. J.; Christianson, T. J.; Agid, R.; et al. Clinical course of untreated cerebral cavernous malformations: a meta-analysis of individual patient data. Lancet Neurol, 2016; 15, 166–173. [Google Scholar] [CrossRef]
- Scimone, C.; Bramanti, P.; Alafaci, C.; Granata, F.; Piva, F.; Rinaldi, C.; Donato, L.; Greco, F.; Sidoti, A.; & D'Angelo, R. Update on Novel CCM Gene Mutations in Patients with Cerebral Cavernous Malformations. J Mol Neurosci . 2017; 61, 189–198. [CrossRef]
- Glading, A.; Han, J.; Stockton, R.A.; & Ginsberg, M.H. KRIT-1/CCM1 is a Rap1 effector that regulates endothelial cell cell junctions. J Cell Biol, 2007; 179, 247–254. [CrossRef]
- Glading, A.; & Ginsberg, M. H. Rap1 and its effector KRIT1/CCM1 regulate β-catenin signaling. DMM Dis Models Mech, 2010; 3, 73–83. [CrossRef]
- Sartages, M.. Thesis; Fisiopatología de las malformaciones cavernomas cerebrales: papel del EGFR y de las GCKIII quinasas. 2022. Centro de Investigación en Medicina Molecular y Enfermedades Crónicas (CiMUS), Universidad de Santiago de Compostela, A Coruña, España, April 1st 2022.
- Van Nieuw Amerongen, G. P.; Koolwijk, P.; Versteilen, A. M. G.; & Van Hinsbergh, V. W. Involvement of RhoA/Rho Kinase Signaling in VEGF-Induced Endothelial Cell Migration and Angiogenesis In Vitro. Arterioscler Thromb Vasc Biol 2023, 23, 211–217. [CrossRef] [PubMed]
- Fernandez-L, A.; Sanz-Rodriguez, F.; Zarrabeitia, R.; Pérez-Molino, A.; P. Hebbel, R.; Nguyen, J.; Bernabéu, C.; & Botella, L Blood outgrowth endothelial cells from Hereditary Haemorrhagic Telangiectasia patients reveal abnormalities compatible with vascular lesions. Cardiovasc Res 2005, 68, 235–248. [Google Scholar] [CrossRef]
- Wojciak-Stothard, B.; Potempa, S.; Eichholtz, & T. , Ridley, A.J. Rho and Rac but not Cdc42 regulate endothelial cell permeability. J Cell Sci 2001, 114, 1343–1355. [Google Scholar] [CrossRef]
- Gunel, M.; Laurans, M.S.; Shin, D.; DiLuna, M.L.; Voorhees, J.; Choate, K.; Nelson-Williams, C.; & Lifton, R.P. KRIT1, a gene mutated in cerebral cavernous malformation, encodes a microtubule-associated protein. Proc Natl Acad Sci U S A 2002, 99, 10677–10682. [CrossRef] [PubMed]
- Snellings, D.A.; Hong, C.C.; Ren, A.A.; Lopez-Ramirez, M.A.; Girard, R.; Srinath, A.; Marchuk, D.A.; Ginsberg, M.H.; Awad, I.A.; & Kahn, M.L. Cerebral Cavernous Malformation: From Mechanism to Therapy. Circ Res 2021, 129, 195–215. [CrossRef] [PubMed]
- Dejana, E. The Role of Wnt Signaling in Physiological and Pathological Angiogenesis. Circ Res 2010, 107, 943–952. [Google Scholar] [CrossRef] [PubMed]
- Sun, F.; & Hu, K. Krüppel-Like Factor 4 Inhibits the Transforming Growth Factor-β1-Promoted Epithelial-to-Mesenchymal Transition via Downregulating Plasminogen Activator Inhibitor-1 in Lung Epithelial Cells. Dis Markers, 2015; 2015, 473742. [CrossRef]
- Goitre, L.; Balzac, F.; Degani, S.; Degan, P. Marchi S, et al. KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species. PLoS ONE 2010, 5, e11786. [Google Scholar] [CrossRef] [PubMed]
- Gore, A.V. , Lampugnani, M.G.; Dye, L.; Dejana, E.; & Weinstein, B.M. Combinatorial interaction between CCM pathway genes precipitates hemorrhagic stroke. DMM Dis Model Mech, 2008; 1, 275–281. [Google Scholar] [CrossRef]
- Whitehead, K.J.; Chan, A.C.; Navankasattusas, S.; Koh, W.; London, N.R.; Ling, J.; Mayo, A.H.; Drakos, S.G.; Jones, C.A.; Zhu, W.; et al. The cerebral cavernous malformation signaling pathway promotes vascular integrity via Rho GTPases. Nat Med 2009, 15, 177–184. [Google Scholar] [CrossRef] [PubMed]
- Bayless, K.J.; & Davis, G.E. Microtubule depolymerization rapidly collapses capillary tube networks in vitro and angiogenic vessels in vivo through the small GTPase Rho. J Biol Chem 2004, 279, 11686–11695. [CrossRef] [PubMed]
- Girard, R.; Khanna, O.; Shenkar, R.; Zhang, L.; Wu, M.; Jesselson, M.; Zeineddine, H.A.; Gangal, A.; Fam, M.D.; & Gibson, C.C. Peripheral plasma vitamin D and non-HDL cholesterol reflect the severity of cerebral cavernous malformation disease. Biomark Med 2016, 10, 255–264. [CrossRef]
- Polster, S.P.; Cao, Y.; Carroll, T.; Flemming, K.; Girard, R.; Hanley, D.; Hobson, N. , Kim, H.; Koenig, J.; & Koskimaki, J. Trial Readiness in Cavernous Angiomas With Symptomatic Hemorrhage (CASH). Neurosurgery 2019, 84, 954–964. [Google Scholar] [CrossRef]
- Polster, S.P.; Stadnik, A.; Akers, A.L.; Cao, Y.; Christoforidis, G.A. , Fam, M.D.; Flemming, K.D.; Girard, R.; Hobson, N.; & Koenig, J.I. Atorvastatin Treatment of Cavernous Angiomas with Symptomatic Hemorrhage Exploratory Proof of Concept (AT CASH EPOC) Trial. Neurosurgery 2019, 85, 843–853. [Google Scholar] [CrossRef]
- Cuesta, A.M.; Gallardo-Vara, E.; Casado-Vela, J.; Recio-Poveda, L.; Botella, L.M.; & Albiñana V. The Role of Propranolol as a Repurposed Drug in Rare Vascular Diseases. Int J Mol Sci 2022, 23, 4217. [CrossRef]
- Albiñana, V.; Gallardo-Vara, E.; Casado-Vela, J.; Recio-Poveda, L.; Botella, L.M.; Cuesta, A.M. Propranolol: A "Pick and Roll" Team Player in Benign Tumors and Cancer Therapies. J Clin Med 2022, 11, 4539. [Google Scholar] [CrossRef] [PubMed]






| GENE | Fwd 5’-3’ | Rev 5’-3’ |
|---|---|---|
| 18S | CTCAACACGGGAAACCTCAC | CGCTCCACCAACTAAGAACG |
| ENG | AGCCACATCGCTCAGACAC | GCCAATACGACCAAATCC |
| CCM1 | CTGTAAGAACATGCGCTGAAG | TCCATCGTACCTGTTACCAAAC |
| ANGPT2 | TGCAAATGTTCACAAATGCTAA | AAGTTGGAAGGACCACATGC |
| CCNB2 | TGGAAAAGTTGGCTCCAAAG | CTTCCTTCATGGAGACATCCTC |
| PECAM-1 | AGAAAACCACTGCAGAGTACCAG | GGCCTCTTTCTTGTCCAGTGT |
| PTGS2 | TCACGCATCAGTTTTTCAAGA | TCACCGTAAATATGATTTAAGTCCAC |
| KDR | GAGTGAGGAAGGAGGACGAAGG | CCGTAGGATGATGACAAGAAGTAGC |
| NOS3 | GACCCTCACCGCTACAACAT | CCGGGTATCCAGGTCCAT |
| CDH5 | GGAGGAGCTCACTGTGGATT | CTGATGCAGCAAGGACAGC |
| SERPINE-1 | TCCAGCAGCTGAATTCCTG | GCTGGAGACATCTGCATCCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).