Submitted:
20 December 2023
Posted:
21 December 2023
You are already at the latest version
Abstract
Cancer have been known as a most important global mortality reason, which in spite of novel therapeutic ways, the leading death is still considerable. Molecular targeted diagnosis and therapy using aptamers with high affinity have converted to a popular technique for pathological angiogenesis and cancer therapy scientists. In this paper several aptamer-based diagnostic and therapeutic techniques such as aptamer-nanomaterial conjugation, aptamer-drug conjugation (physically or covalently) and biosensors, which successfully designed for biomarkers, are critically reviewed. The results obviously demonstrated that aptamer have potentially incorporated with targeted delivery systems and biosensors for detection of biomarkers which expressed by cancer cells. Aptamer-based therapeutic and diagnostic methods, as the main field of medical sciences, possess high potential in cancer therapy, pathological angiogenesis and increase of community health. The clinical use of aptamer is so limited due to unreliability resulted from targets impurities, inaccuracy in SELEX stages process, and in vitro synthesis which led to the lower selectivity for in vivo targets. Moreover, size behavior, probable toxicity, low-distribution and unpredictable behavior of nanomaterials in in vivo media make critical their usage in clinical assays. This review can be helpful for implementation and designing the future studies which are effective and applicable for clinical use.

Keywords:
Aptamer
; Cancer
; Diagnosis
; Therapy
; Biosensor
1. Introduction
Aptamer is known as a synthetic nucleic acid strand which can specifically bind to a wide range of targets such as proteins, cells, bacteria, toxins, DNA, miRNA, ions, drugs molecules with high affinity [1]. Aptamer was firstly introduced at 1990 by Larry Gold and his colleagues at Colorado University during process of systematic evolution of ligands by exponentialenrichment (SELEX). Briefly this technique includes introduction of target into a library of the random sequences of ssRNA or ssDNA (1013-1016), cleaning up the unbounded strands, washing and reproduction of bounded strands with PCR (6 to 15 times) [2].
Although antibody and aptamer, which known as chemical antibody, possess the same role in the specific binding to the targets, but some advantages of aptamer over the antibodies make preference use of aptamer for designing the targeted delivery and biosensing platforms. The interesting features of aptamers are specificity to molecules in cells and also monoclonal antibodies, easy penetration to the tissue and cells, easy and inexpensive production, and lower size [3,4,5,6].
The folding of aptamer with secondary and tertiary conformation lead to high affinity to the targets [1,7]. This feature enables usage of aptamer as a targeting and nanocarrier agent for the delivery of therapeutic and imaging agents to the tumor cell through recognize of biomarkers. Moreover, aptamer can be used as a therapeutic agent. According to the food and drug administration (FDA) approval, age-related macular degeneration can be treated with an aptamer-based drug Macugen ® (pegaptanib) [8]. From the other side, aptamer can be used for detection of various biomarkers related to the various diseases such as cardiovascular, cancer, neurodegenerative, infections, organ harms. So, as shown in Scheme 1, aptamer can be introduced as a powerful therapeutic and diagnosis agent.
Based on the American Cancer Society, about 1,918,030 cancer cases and 609,360 cancer deaths were estimated in 2022 in united state. Moreover, about 350 deaths per day were recorded for lung cancer which was the most leading reason of death. But the statical studies of the National Center for Health Statistics (NCHS) of USA demonstrated that the mortality patterns contain stagnated progression for prostate and breast cancers and increase for lung cancer [9]. This statical estimation shows the importance of cancer survival, which can be achieved by timely treatment and diagnosis. Due to importance of this subject, in this paper we review application of aptamer in designing targeted delivery systems and biosensors and critically discuss methods, which can be helpful for future studies.
2. Aptamer-Based Targeted Delivery Systems
Targeted-delivery as a main field of medical sciences, have highly applied for cancer therapy and pathological angiogenesis. This field can be performed in the both form of aptamer-nanomaterials conjugations and aptamer-drug conjugates (ApDC). The former is benefited from high surface area of nanomaterials for loading the different anticancer drugs and possible therapeutic effects of nanomaterials like thermal or ROS production. The later mainly used for loading the intercalating drugs such as doxorubicin (DOX) which reduce the toxicity on the normal cells, by targeting the specific cells [10,11]. The combination of aptamer with therapeutic agents can resolve some problems such as low in vivo sensitivity and selectivity, high toxicity of drugs, and tumor imaging difficulty, etc. These systems are able to cancer diagnosis or prognosis, and cancer signal pathways blocking [7]. In this section the studies which employed the aptamer in targeted-delivery systems are discussed and their information are summarized in Table 1.
2.1. Aptamer-Nanomaterials Conjugation
Nanomaterials as an inseparable part of targeted delivery systems can be incorporated with aptamer for aims of therapeutic and imaging systems. Nanomaterials are known as a favorable candidate for functionalization with aptamer due to properties of biodegradability, high loading capacity, easy bioconjugation, high permeability, and easy release of drugs. Targeted delivery of drugs to cells and tissues, can considerably reduce the cytotoxicity and enhance drug efficacy [33]. Moreover, controllable release of drug can be happened because of easy and fast response of nanoparticle carriers to the environmental condition or stimuli in cells [34]. This kind of targeted delivery synergically benefits from advantages of both parts including high surface area of nanomaterials for binding of aptamers, protected situation of aptamer from nuclease degradation, high sensitivity and selectivity [35,36]. Here we will discuss more on the nanoparticles which have frequently used for designing the drug delivery systems such as gold nanoparticles (AuNPs) [37], carbon-based nanoparticles [38], quantum dots (QDs) [39,40], silica nanoparticles [41], polymeric nanomaterials [42], liposomes [43], magnetic nanoparticles [44], metal organic frameworks (MOFs) and upconversion nanoparticles (UCNPs) [45].
Gold nanoparticles with advantages of unique optical and electrochemical properties, surface plasmonic effect, considerable biosafety, high easy bioconjugation with Au-S chemistry have been widely applied for designing the targeted delivery platforms [37]. The AuNPs can be used as a carrier for delivery of therapeutic or imaging agents to the cancer cells or tissues. Mohammadinejad et al. introduced a nanocomplex for specific diagnosis, and imaging of MCF-7 based on detection of ATP molecules in cancer cells [12]. Nanocomplex was designed based on conjugation of AuNPs with MUC-1 aptamer (MUC1 apt – AuNPs) and conjugation of QDs with ATP aptamer (ATP apt-QDs). As shown in Figure 1A after adsorption of ATP apt-QDs on the MUC1 apt – AuNPs, the intensity of the QDs was quenched due to fluorescence resonance energy transfer, resonance energy transfer (FRET) phenomena. In the following internalization of complex in the MCF-7 cells through binding to the MUC 1 biomarkers on the MCF-7 cells, ATP apt-QDs can bind to ATP molecules leading to separation from MUC1 apt – AuNPs and ends up recovery of the intensity.
Carbon-based nanoparticles which mainly includes graphene oxide (GO), carbon nanotubes (CNTs), and carbon dots (CDs) possess features of easy functionalization, low toxicity, great surface area which is suitable for drug loading, and considerable in vivo stability. This feature makes possible frequently use of carbon-based nanoparticles incorporated with aptamer as a biorecognition element. This platform can be a powerful platform for aims of therapeutic and delivery systems. Benefiting from these materials Mohammadi et al. designed a nanocarrier for siRNA based on conjugation of RNA aptamer of EpCAM with single-walled carbon nanotube (SWNT)/ piperazine–polyethylenimine non-viral vector. This platform was able to successfully suppress BCL9l in positive EpCAM cell line MCF-7 [13].
QDs are assigned to the semiconductor nanoparticles containing periodic elements II/VI or III/V groups with interesting features such as tunable size and emission (UV to near-infrared), high intensity fluoresces intensity with narrow width, and considerable photostability [46]. Akbarzadeh et al. introduced a drug delivery and imaging platform based on loading the DOX on the silica coated-Gd-Zn-Cu-In-S/ZnS QDs/PEG/EpCAM DNA (Figure 1B) toward 4T1 and MCF-7 cell lines [14]. In vitro studies demonstrated high toxicity of platform for cell lines and high efficiency of proposed platform. Moreover in vivo studies on the 4T1 tumor-bearing Balb/c mice proved applicability of designed platform by prevention of tumor growth.
Recently silica nanoparticles have received huge consideration of scientists for designing of targeted delivery due to high porous structure for loading the therapeutic agents, easy modification and high biocompatibility. Yang et al. synthesized a silica-based platform for targeted delivery of DOX to CCRF-CEM human acute T lymphocyte leukemia cells [15]. In this design they used Sgc8 aptamer-conjugated mesoporous silica nanoparticles and results demonstrated successful designing with good releasing and cell killing.
The polymeric nanomaterials are assigned to a wide range of particles such as micelles, hydrogels, and polymeric nanoparticles. The micelles are structured from self-assembling the copolymers with amphiphilicity feature which can be produced in a critical micelle concentration (CMC) [16]. Hydrogels with high hydrophilicity are designed from cross-linking structure of polymers which possess the high elasticity with considerable diffusivity of bifunctional molecules [47].
This nanocarriers with advantages of great drug loading and easy release, biocompatibility, high biodegradability is a potent candidate for incorporation with aptamer for therapeutic and imaging aims. Polymeric nanoparticles are a wide range of hydrophilic polymers such as polyethylenimine (PEI), polyethylene glycol (PEG), polyethyleneimine (PEI), polycaprolactone (PCL), etc., which can be formed as nanoparticles [48] or a coating for other nanoparticles [13,18].
Benefiting from conjugation of the aptamers with polymeric nanoparticles, Zhao et al, introduced a irradiation therapy platform using AgNPs functionalized with PEG and aptamer As141 [18]. The proposed platform with synergically advantages, showed an interesting radiosensitizing effect with high rate of apoptotic cell death on the C6 glioma cells tumor cells. Moreover in vivo studies showed more accumulation of synthesized nanoparticles in tumor tissues.
Liposomes are known as a phospholipid bag with a core made of aquas media which allows loading the drug in different parts of core, bilayer, or interface layer. This nanocarriers have interesting features super biocompatibility, hydrophilic drugs delivery, and negligible toxicity [49]. Taking advantages of this nanocarriers, Li et al, introduced a liposomes-based delivery system for loading the aptamer-DOX conjugation and delivery to the reversing drug resistance of MCF-7/Adr cells [17]. The nanoparticles successfully were applicable to up taking with cells, entrance and release of the Ap-Dox complex. Afterwards the interaction between aptamer AS1411 and nucleolin lead to the entrance of Dox into the nucleus and prevention of drug efflux.
Recently incorporation of aptamer with magnetit nanoparticles has widely applied for targeted delivery systems due to super and para magnetism features which enables the drug delivery, magnetic resonance imaging (MRI), and hyperthermia therapy for cancer [50]. Sun et al. designed a targeted delivery chemo-photodynamic platform using conjugation of aptamer strand to the superparamagnetic iron oxide nanoparticles (SPION) [19]. The sequences of aptamer contained the AS1411 sequence with G-quadruplex folding and stem loop folding. The nanocarrier sequences loaded 5, 10, 15, 20-tetra (phenyl-4-N-methyl-4-pyridyl) porphyrin (TMPyP) as a photosensitizer molecule and anticancer drug of daunomycin (DNM), respectively. The nanocarrier (TMPyP&DNM&Apt-S8@SPION) can show high cytotoxicity to nucleolin-overexpressed C26 and A549 cells with producing cytotoxic reactive oxygen species (ROS).
Metal-organic frameworks (MOFs) with advantages of high porosity, crystalline-like structure structures, and synthetic adjustability can be used in the different field of biosensor [51], separation [52], energy saving [53], catalytic effect [54], thermal stability, and loading protection against enzymatic degradation [55]. Alijani et al. designed core-shell Fe3O4@MOF nanocarrier (Figure 1C) using zirconium 2-amino-1,4-benzenedicarboxylate (UiO-66-NH2) MOF loaded DOX, CDs and then conjugated to AS1411 [20]. The proposed nanocarrier successfully applied for selective delivery to triple-negative MDA-MB-231 human breast cancer cells resulted in pH-depend release, inhibition of cell proliferation and induction of apoptosis.
Due to some problems for in vivo imaging of photodynamic therapy, and poor penetration of UV or visible wavelength into deeper tissues for excitation of photosensitizer (PS), in the recent years NIR-excitable up conversion nanoparticles (UCNP) have gained considerable attention of science due to excitation with NIR and emission of UV-vis wavelength. Also, they have some superiors such as auto-fluorescent background free, deep penetration accessibility for excitation, and photochemical stability [56]. In this regard, Lin et al., introduced a NaYF4:Yb (20%), Er (2%) nanocluster (UCNP) for photodynamic therapy [21]. For this purpose, they used AS1411 for targeting the MCF-7 and Hella cells. In this design a photosensitizer protoporphyrin IX was loaded on the aptamer which can be excited by UV-Vis which emitted from UCNP to produce the ROS.
Recently in order to application of aptamer for evaluation of molecular and metabolic changes in living cells, radiolabeled approach was proposed using radionuclide agent bound to the strand. Radionuclide agents can be gamma-emitting probe including indium-111 (111In), iodine-123 (123I), and 99mTc which can be used in single-photon emission computed tomography tomography (SPECT) system. Also, other agents are gallium-68 (68 Ga) or fluorine-18 (18 F) which can be used in positron emission tomography (PET). In this way Kim et al. proposed 18F-fluoride- HER2 aptamer (Figure 1D) for in vivo molecular imaging [32].
2.2. Critical Note
The most important disadvantages of the nanoparticles-based targeted delivery systems are lack of nanoparticles clearance studies in the in vivo systems. So, it is proposed to add more details about biodistribution and clearance pathways in the future. Although most studies have used core-shell nanoparticles for targeted delivery, but administration of some nanoparticles such as QDs for in vivo studies may have some toxic effect in the bio-environmental due to some inevitable heterogeneous distribution and leakages phenomena. So, it is better in the future the long-term toxicity is done for designed platforms which use nanoparticles specially QDs in the formulation. Moreover, another problem can be related to the carbon-based nanoparticle which benefited from a wide range of advantages but poor solubility and low dispersion in liquid media can limit the delivery systems. Also, another problem of some of nanoparticles as AuNPs is the agglomeration in the culture media which make critical the condition of targeted delivery system. From the other side, quenching and low intensity of fluorescent nanoparticles due to FRET or inner filter effect in the culture and biologic media can limit the activation of scientists [57]. Another limitation of use of fluorescent nanoparticles like QDs for in vivo imaging is poor penetration of UV-Vis into deep tissues. Moreover, the wide range of UV-Vis may have the toxicity effect on the normal cells and tissues. So, near-infrared (NIR) wavelength with the range of 700 nm to 1000 nm light which possess low phototoxicity can be used [58,59,60]. For this purpose, UCNPs can be applied as a valuable luminescent alternative due to unique advantages with high contrast for in vivo imaging. But some disadvantages may limit usage of UCNPs for clinical or preclinical procedures. One of the challenges is suitable excitation power to reach the enough conversion luminescence and brightness, due to tissue damage. This may be resolved by modification of cross section of absorption and increase of quantum yield. Moreover, the use of excitation wavelength more than 980 nm can resolve the probability of tissue damage [61]. Another challenge can be providing a microscope which is equipped with an external 980-nm laser which can increase the price and accessibility.
Another alternative for imaging can be radio-labeled aptamer, which can use lower energy for excitation of radioactive material. Although this technology can be used for killing, slowing the cancer cells growth and imaging but use of this material has some inevitable problems for human healthy. Some of this side effects are feeling exhausted, memory problems and distracting, hair loss, skin defects, and vomiting [62].
Although the proposed platforms for targeted-delivery show high sensitivity toward considered cell, but it may be better some other studies are performed in the future such as scalability for entrance to cells, and comparison with other clinical methods for assessment of applicability and evaluation of entrance of nanocomplex to the tissues and release of therapeutic or imaging agent. The most important problem of the studies [14] with pH-sensitive release claim, is low release (e.g. 15%) after 24 hours at acidic condition which can be critical for drug delivery systems. Also, in vivo stability is another problem of studies [15] which must be more conducted in the future. Although the covalent binding of aptamer to nanoparticles possesses advantages of strongness, and stability in different conditions of pH and temperature, but the problem of probable denaturation during chemical reaction for covalently binding, may limit its applicability. This phenomena lead to the poor functionality of aptamer and less efficiency of the targeted delivery system [63]. In this way incorporation of aptamer with liposomes can be performed in the both form of noncovalently and covalently. Former can be created electrostatic interaction with cationic liposomes, and later can be trough chemical conjugation, which both of them lead to placing the aptamer in core or on the surface of liposomes. Moreover, stability of the encapsulation with liposome in various physiological conditions must be evaluated which the study of Li et al. [17] lacks it.
Although the application of magnetite nanoparticles for targeted-delivery possess extraordinary features, but some disadvantages such as difficulty to use outer magnetic field for delivery of magnetite nanocarriers to organs, limitations of frequency, exposure time, and intensity of magnetic field for patients [64].
Application of MOF possess some deficiencies which may limit its applications includes weak stability of some of them which may lead to prompt release and leakage of drugs or high stability in aqueous media which can reduce the precent of drug release and efficiency of method. Moreover, due to lack of metal-carboxylate sites which can be necessary for modifications, some pretreatments must be done for MOF which may lead to structural failures and material amorphization [65].
2.3. Aptamer-Drug Conjugation (ApDC)
Aptamers with advantages of high stability, reversible conformation, powerful targeting and easy conjugation and modification, and programable conformation can be used as a carrier for ApDC technique. This technique possesses three main members includes aptamer as a ligand for targeting and delivery to sites or biomarker, warhead which is therapeutic agent (drug), and linker with function of loading the therapeutic agent [66,67]. According to the covalently or non-covalently of linker, two modes of physical conjugation or intercalation and chemical linker can be described.
2.3.1. Physical Conjugation (Intercalation)
The DNA nanostructures are known as the biodegradable carriers with high biocompatibility which don’t need any elements for internalization into the cells and possess more bio-friendly features in comparison with inorganic and polymeric nanomaterials. Due to folding ability of aptamer the anticancer drugs, mainly anthraquinone family specially doxorubicin (DOX), are able to intercalate into between bases of DNA double helix. The intercalation can be through opening the deoxyribose-phosphate and laminated interaction with plane aromatic base. The intercalation process lead to unzipping two strands of dsDNA and after internalizing the intercalated agent can be released. This process can be reversible, if the DNA structure is not destroyed. This method is easy to performance, without any chemical synthesis process, and inexpensive [68,69].
In this way, icosahedral DNA complexes was formed and used as nanoparticles for carrying doxorubicin toward MCF7 cells [22]. The 3D DNA nanostructures was formed through assembling five DNA strands to form five-point-star motif. The internalization to cells was happened through recognize of MUC1 on the surface of cells. DOX was able to release from DNA nanostructures in the acidic medium of lysosomes resulting in prevention of side effect to considerable extent and increasing effectiveness.
Taking advantages of DNA complexes Liu et al. designed a similar nanostructure includes a DNA aptamer with G-quadruplex structure for interaction with MUC1 biomarker on the MCF 7 cell surface and double-stranded DNA, for loading DOX [23].
In another study by Lopes et al., a delivery system was designed based on the conjugation of the pancreatic cancer RNA aptamer P19 to therapeutic agents such as gemcitabine, 5-fluorouracil (5-FU), monomethyl auristatin E (MMAE) and derivative of maytansine 1 (DM1) [24]. The results demonstrated that delivery systems were able to inhibit the proliferation of PANC-1 and AsPC-1 cell lines with mechanism of phosphorylation of histone H2AX protein on Ser139 (γ-H2AX). Moreover, mitotic G2/M phase arrest was mechanism of action of delivery systems of MMAE and DM1.
Li et al. introduced an innovative design based on hybridization chain reaction (HCR) with scaffold formation for delivery of DOX to SMMC-7721 cell [26]. In this design a short DNA trigged the self-assembly process of biotinylated hairpin DNAs (Figure 2A). After formation of scaffold hybridization, streptavidin-aptamers (Zy1) were able to conjugate to hybridization trough streptavidin-biotin binding. The DOX was loaded on the scaffold hybridization body and aptamers Zy1 as legs was used for targeting.
Benefiting from one-step self-assembly method, a cross hybridization formation of DNA (C-DNA) nanohydrogels was designed using eight ssDNA [27]. As shown in Figure 2B this nanostructure formed by S1−S4 DNA sequences and linker L1−L4 DNA sequences which mainly includes unmethylated cytosine-phosphate-guanine oligonucleotides (CpG ODNs), I-motif cytosine (C)-rich single-stranded DNA with quadruplex formation ability in acidic conditions, and MUC1 aptamer. After internalization in cells, in the acidic condition, I-motif desire to form quadruplex leading to dissembling C-DNA and release of DOX.
2.3.2. Covalent Conjugation
Covalent and chemical bonding of drugs to the aptamers have been widely used for designing the drug delivery systems due to advantages of simple modifications of aptamer and easy cleavage of drugs. The linkers can be non-cleavable or cleavable. The cleavage of linkers can be depended to the enzymatic reaction, pH, and temperature. But non-cleavable are applied when therapeutic agent is usually a sequence such as small interfering RNAs (siRNAs) or nucleotide analogs and nucleobases which is conjugated to targeting aptamer through a sequence [31].
There are three kinds of chemical linkers which usually applied for conjugation of drugs such as hydrazone, thiol-to-thiol and dipeptide bonds. Hydrazone is formed by reaction of hydrazine on aldehydes and ketones with hydroxyl group. This linker can be dissociated by hydrolysis in acidic condition of endosomes and lysosome [70]. The thiol-to-thiol linker can be used for bonding thiolated drugs with thiolated aptamers. Sometimes in order to increase of stability, the thiolated maleimide or PEG can be used between drug and aptamer. The disulfides can be decomposed in acidic conditions of endosomes. The dipeptide bonds which are created between amino acids, such as valine-citruline (Val-Cit) and phenylalanine-lysine (Phe-Lys), can specifically decomposed by Cathepsin B as a lysosome protease which is overexpressed in cancer cells.
Nucleotide analogs and nucleobases with different functionalities of antiviral and immunosuppressive, anticancer, etc. [71,72] can be inserted as a sequence in aptamer strands. In this design both functionality of targeting of aptamer and therapeutic effect of nucleotide analogs strand can be retained to a high extent with more safety in comparison with chemical linkers.
Huang et al. designed a targeted drug delivery using sgc8ca apt-DOX conjugate to tumor cells [25]. In this study the DOX was conjugated to the aptamer through hydrazone binding while the applicability and naturality of the aptamer was maintained (Figure 2C). The results of several assays such as selective internalization, and toxicity confirmed successful targeted drug delivery to tumor cells and specific killing the Human T-cell ALL (CCRF-CEM) and human B-cell Burkitt’s lymphoma (Ramos) cell lines. The evaluation of fluorescence intensity, obviously proved the successful uptake of conjugation to cells. After recognition of proteins on the cells, the drug can be released from the acid-labile linkages inside the endosomes to transport to nuclei.
Benefiting from linker-based therapeutic agent binding, Wang et al. introduced a therapeutic conformation to low-density lipoprotein receptor (LDL-R) as a biomarker target on the surface of cancer cells such as Huh-7 liver cancer cells and MDA-MB-231 breast cancer cells [28]. In this design antimiR-21 DNAzyme was linked to the aptamer through a bridge containing 5 sequential deoxythymidine (d-TTTTT-) to retain the applicability of both aptamer and DNAzyme. The results showed that expression of miR-21 decreased up to 56%.
In this way, paclitaxel (PTX) with hydroxyl group at 2′ position of PTX was covalently bound to the nucleolin aptamer (NucA) through dipeptide (S-S) bond [29]. After entrance of NucA- PTX to tumor cells, the linker was cleaved through cathepsin as intracellular lysosomal protease leading to release of PTX.
Also Theil et al. introduced a delivery system based on conjugation of HER2 aptamer to siRNAs targeting the anti-apoptotic gene, Bcl-2. This system was able to potentially internalize the HER2 positive cells (N202.1A cells) to silence and prevent Bcl-2 gene expression [31].
Benefiting from covalently binding, HER2-specific aptamer was conjugated to the mertansine (DM1), through disulfide bonding between DM1 and 3′ end of aptamer which can be cleaved in early and late endosomes [30]. This cleavage can increase anticancer activity of drug through facilitation of DM1 release from the endocytic pathways. Moreover, in this design PEG molecule was bound to the 5′ end of aptamer to increase of biocompatibility and circulation ability in vivo. In this study aptamer-DM1 conjugation was used for in vivo studies mouse xenografts with BT-474 breast cancer.
2.3.3. Critical Note
The studies demonstrated that incorporation of aptamer and drugs have been formed as well for targeting delivery to the cells. This promising technique is potentially more applicable in the human treatment domain provided that a lot of completed procedures and assays are done. Although these studies have been so valuable but may be limited with some disadvantages. In most studies it is not well detailed in description of characterization and synthesis of aptamer-drug conjugation. Although studies reported successful conjugation for targeted drug delivery but some disadvantages such as the in vivo applicability and cancer treatment effects including immune system reactions could be tested. Most of papers deals with in vitro evaluation to validate the applicability of delivery systems. Also, it was better to discuss more on the off-target, toxicity and side effects of the designed ApDC on the normal cells or tissues [11]. Moreover, covalently bonding required the chemical process and reagents which may reduce the nature of aptamer and increase the toxicity of delivery system. Besides, other challenges can be the low amount of drug loading, expensive reagents requirements, and several boring steps requirement for covalently conjugation. On the other hand, physical conjugation of drugs may face to the loading challenge, especially in the in vivo environment, which contains a lot of macromolecules and interreferences, while lead to release of drug, low loading and low efficiency of drug delivery. Moreover, probable changes of formation and folding during processes, which contain different media and conditions, can be inevitable leading to the low selectivity and failed efficiency. In order to evaluation of therapeutic efficacy of results, the designed delivery system can be replicated in other animal models or even human clinical assays.
3. Biosensors
The timely diagnosis of cancers is an inseparable part of fast therapeutic aims, has a highlighted role in the increase of community health. In order to diagnosis of cancers and biomarkers a lot of traditional methods such as enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (RT-PCR), flow cytometry, mass spectrometry [73] have been applied. Unfortunately, aforementioned methods suffer from some disadvantages such as expensiveness, highly expert persons requirement, and time-consuming. So, development of simple, sensitive, easy to operate techniques is urgent. Nowadays biosensors can be a potent alternative for traditional methods. Biosensors are known as a potent diagnosis technique for detection of a wide range of molecules including proteins, toxins, cells, bacteria, DNAs, miRNAs, etc, which are important in different fields of medical, food and the environment. Biosensors are able to record and transmutation the biological response to readable signal through transduction system during processes of collection, amplification of signal. In term of manner of traducing, different biosensing systems can be introduced such as optical, electrochemical, piezoelectric thermometrical and magnetical [63]. Biosensor should be designed so that they can diagnosis the biomolecules with high selectivity among the interferences of biological system. Recently several biosensors have been designed for diagnosis of cancers through detection of biomarkers in medical sciences. In this way various sensors have been fabricated using bioreceptors such as antibody, enzyme, aptamer, etc. Among them aptamer have received high attention due to some advantages such as small size (12-30 KDa), wide range of targets, simple synthesis, high stability, easy modification, long term storage, inexpensive, low immunogenicity [74]. In the recent years point-of-care (POC) technique has been pervasive for the clinical aims. The usual medical assays which are centralized in clinical or hospital labs, need large amount of sample and long time for interpretation of results. POC devices enable person-centered assays in the short time which required small amount of sample, and enable cheaper test in emergency condition [75]. Due to unique features of aptasensors, they can be accomplished for development of POC devices. Concerning the kind of the platforms, aptasensors which mainly designed for cancer cell lines, can be classified into optical, electrochemical, paper based, microfluidic and smartphones. The summarized data of studies are shown in the Table 2.
Optical platforms contain three main members such as the light source, the sensor of target – light, and a detector which collect the light from sensor and evaluate it. Optical biosensors with advantages of high sensitivity, simplicity and easy miniaturization have been highly desired to incorporation with aptamer.
In this way florescence resonance energy fluorescence resonance energy transfer (FRET)-based aptasenors frequently have designed for detection of cancer cells biomarkers. FRET as a nonradiative phenomenon usually happens through transmission of energy of fluorophore as donor to an acceptor which may able to emit the energy to longer wavelength [85]. Benefiting from this phenomenon several biosensors have designed FRET biosensor based on energy transfer between fluorophore-conjugated aptamer and GO as a quencher. As an example, in this filed Feng et al. designed a FRET system based on the selective adsorption of exosome on the molecularly imprinted polymer (MIP)-coated Fe3O4 nanoparticles followed by competition with aptamer in the GO/aptamer-FAM system (Figure 3A) [76]. This competition led to release of aptamer-FAM and recovery of fluorescence intensity.
Taking advantage of aptamer-incorporated FRET, molecular aptamer beacon (MAB), which possesses both fluorophore and quencher moieties at two ends of strand have been introduced with aim of imaging and quantification. The design of molecular is based on switching the folding of stem-loop structure to recognize the target by on/off yielding [86]. Yue et al. designed an interesting targeted delivery system combining tetrahedral DNA nanoprobe (TDNp) and MAB which contains fluorophores Cy3 as donor and Cy5 as acceptor [77]. As shown in Figure 3B in this system TDNp prepared from L1–L4 which includes primer (TP) at strand L2 end and hybridization section for MAB at L3. The delivery was able to internalize to cell trough pathway of caveolin-medicated endocytosis. In absence of telomerase, after hybridization and folding change, the Cy3 and Cy5 can stay at far distance leading to the FRET inhibition. But presence of telomerase lead to duplication of TP at 3’ end of L2 which extended to L3 with consecutive TTAGGG sequences. The hybridization with L3 resulted in the release of MAB and FRET phenomena.
Nowadays, colorimetric biosensors with advantages of easy to use, simple interpretation, inexpensive, visibility, etc, have been frequently incorporated with biomarker detection. In this way AuNPs-based colorimetry have been widely applied for designing this kind of sensors through color change from red to purple which happens through aggregation of AuNPs and variation of wavelength at 520 nm. AuNPs with dispersion form possess inter-nanoparticles distance more than the particle diameter which can seem red, but in aggregation form this distance becomes lower leading to seem purple [87]. The most interesting design of AuNPs-aptamer colorimetric biosensor is aggregation-resulted by adding the salt. In this design the aptamer remained among AuNPs preventing aggregation in presence of NaCl salt. By adding the target, it can be bind to the aptamer leading to the conformation changes and poor defense from AuNPs against aggregation. Hasan et al designed this kind of biosensor for detection of platelet-derived growth factor (PDGF) (Figure 3C) [78].
Surface plasmon resonance (SPR) can be happened through nanoplasmonic phenomena using noble metal nanoparticles which are able to focus the light into nanoscale regions. This incidence of light lead to the increase of collective oscillation which is produced by surface free electrons. This phenomenon results in the scattering or absorption of light leading to the plasmon resonance frequency change. This technique includes the advantages of label-free possibility, inexpensive, easy sample preparation [88]. Taking advantages of SPR, Shahbazlou et al. introduced a SPR platform (Figure 3D) designed by immunization of CA125 aptamer, through streptavidin–biotin, on a bare gold chip [79]. This design was used for detection of CA125 in human serum samples.
Electrochemical biosensors which synergically contains sensitivity of electrochemical transducer and specificity of bioreceptors, can be classified to biocatalytic and affinity sensors according to the kind of biorecognition element. The biocatalytic sensors usually use enzymes, tissue slices, etc, and affinity sensors use antibody, aptamer, DNA [63]. Among different kind of electrochemical sensors, aptasensor have frequently applied due to simple design, sensitivity and low price. According to the labeling with electrocatalytic agent, aptasensors classified to the label-free and labeled-based. Ni el al. designed a label-free aptasensor for cancer antigen 125 (CA125) by modification of electrode using magnetic α-Fe2O3/Fe3O4/Au nanocomposite followed by immobilization of the partial complementary strand on the electrode. As shown in Figure 4A, in presence of CA125, aptamer is released from complementary strand, and current increased [80]. Moreover, recently a new generation of electrochemical sensors was developed based on the CRISPR-Cas systems. Cas12a nuclease is known as a powerful tool for detection of nucleic acids strands and known as an RNA-guided DNases which possesses advantages of considerable sensitivity and specificity, and efficient cutting ability. Cas12a which directed by CRISPR RNA (crRNA), contains T-rich protospacer adjacent motif (PAM), create a Cas12a/crRNA complex to specifically detect DNA with trans-cleavage and cis-cleavage activities to indiscriminate ssDNA or detect DNA. Taking advantages of this technique, Liu et al. designed an electrochemical biosensor for detection of EGFR L858R as a circulating tumor DNA (ctDNA) in lung cancer [81]. In this design MB /Fe3O4@COF/PdAu bound to a complementary strand and another complementary strand was immobilized on the electrode. As shown in Figure 4B, the resulted ssDNA from Cas12a trans-cleavage activity, can be hybridized by complementary strands leading to the increase of MB signal.
In order to improvement of the sensitivity of biosensors, incorporation with microfluidic systems always have been a good idea for scientists due to enhancement of mass transfer to the surface of biosensor. Microfluidic technique is able to donate valuable features to the biosensors such as low sample requirement, high-throughput and fast detection, miniaturization and portability [89]. Taking advantages of microfluidic assay, Khaksari et al. introduced a platform for electrochemical detection of A549 cells. In this design screen-printed gold electrode was modified by integrin α6β4-specific DNA aptamer (IDA) and inserted in on-chip gas-actuated microvalves microfluidic platform to provide the flows (Figure 4C) [82].
Lateral flow assay (LFA) as a paper-based technique, which possess valuable advantages including low cost, simple design, visual results interpretation, can be used as POC device for diagnosis of cancer[90]. It can be used for detection of a wide range of targets such as bacteria, toxins, hormones, biomarkers, etc. Recently application of aptamers instead of antibodies have been pervasive due to superior advantages of aptamer over antibodies which was discussed in aforementioned sections. The LFA strips contains the sample pad for sample loading, the conjugated pad for loading the labeled-bioreceptors, the test pad which is a nitrocellulose (NC) membrane for capillary migration of sample and separation, the absorbent pad for absorption of buffer and sample, and the support back for retaining the components of LFA strips. Moreover, the NC normally coated with two lines of test line (T-line) and control line (C-line). T-line usually can be dispensed target bioreceptor and C-line also is bioreceptor for labeled-bioreceptor [91]. As shown in Figure 4D, Yu et al. fabricated a lateral flow test strip for diagnosis of identification of CD63 on the non-small cell lung cancer (NSCLC) exosomes [83]. In this design, they dispensed streptavidin (SA)-biotin-CD63 aptamer complementary on the T-line, and AuNPs-CD63 aptamer was used as probe.
Smartphone is known as a new generation of POC devices which possess high integrability with different type of biosensors, simple design and portability. This kind of biosensors enable control of reaction process of biosensor with a simple software on the smartphone [92]. Sanati et al. designed a lab-in-a-tube technique for detection of MUC1 on the circulating tumor cells (CTCs) using gold nanoclusters (GNCs)-aptamer as emitter and polyurethane (PU) - coated with GO as quencher [84]. As shown in Figure 4E they designed the dark chamber equipped with UV-LED emitters, aluminum heat sink for exhaust of heat, and a cylindrical chamber for reaction tube which can be controlled through a smartphone with imgeJ software from top of chamber.
4. Critical Note
Although designed biosensors can be introduced as the most potent technique for early diagnosis of cancer, but some disadvantages and failures such as inaccessibility of some methods for public and non-expert persons may prevent development of these methods as POC devices. For example, microfluidic device which is designed with Khaksari et al., [82] although resulted acceptable sensitivity, but design of this platform requited large and expensive equipment which can be used with highly expert persons. Also, FRET based techniques which are based on the transmission of energy, may suffer from autofluorescence interferences or FRET between fluorophore and macromolecules in biological samples leading to the negative or positive errors. Colorimetric methods based on AuNPs, seriously exposed to aggravation in biological samples. On the other hand, sensitivity of some technique like MAB, which are highly depended to the aptamer folding, may be changed by conformation and 3D folding change in different conditions such as PH, solutions, and temperature. Moreover, LFA and smartphones, although provided some conditions such as simplicity and accessibility for development of POC techniques, but low sensitivity and lack of validity of results may affect on development of them as potent POC technique. Some enzymatic methods such as Cas12a may suffer from instability for long term, which lead to poor accuracy of biosensors. The electrochemical and SPR sensors are most important, reliable, and accurate techniques which have potential of miniaturization for accessibility and label-free ability for use of bioreceptors. The hand-held platforms with easy interpretation of results and low price can be designed using these techniques which possess heighted role in healthcare and treatment.
5. Conclusion and Future Perspective
This review potentially demonstrates that aptamer have been successfully introduced as a therapeutic and diagnostic tool for designing the imaging, drug delivery and biosensors due to unique features of aptamers including the high selectivity, affinity, and compatibility with different methods. The targeted-delivery technology significantly benefited from aptamer advantages for efficacy cancer therapy and decrease of toxicity. Studies obviously demonstrated that aptamers potentially played role of targeting and nanocarriers for drug delivery systems with drug intercalation, or chemical linkers, and also nucleotide analogs. There are still some challenges in aptamer-based targeted-delivery systems such as fast clearance from body and kidneys excretion, nucleus degradation, and in vivo thermal instability [93]. Moreover drug-aptamer conjugation mostly limited to DOX use which can easily intercalate into the nucleic acid strands. So, developing the delivery systems with different drugs can be the most important challenge which must be evaluated in the future. This review demonstrated that incorporation of aptamer with biosensors platforms was implemented as well to produce the accurate, selective and sensitive diagnosis tools for biomarkers. But the most important shortcoming of these biosensing platforms is being inaccessibility and most of them remain limited to articles and studies. So, it is highly required to development of POC devices for cancers which are accessible for public, like glucometers or pregnancy checkers. Although it is mentioned that aptamer possess superior features in comparison with antibodies for therapeutic aims, but actually application of aptamers is limited which must be more assessment in the future.
This review demonstrated aptamer well-incorporated with in-vitro and in-vivo assays for diagnosis and therapy of different kinds of cancers in preclinical stages. Although a lot of commercialized aptamer-based drugs have been introduced in the recent years but there has been also a considerable desire for biomarker diagnosis and therapeutic aims using antibodies in clinical assays. The main reason for distrust of implementation of aptamer in clinical assays can be some defects in SELEX stages due to some inaccuracy in process, impurity of targets, and mostly in vitro synthesis which lead to the lower selectivity and interaction with other in vivo targets. One of the powerful and effective technique which can be applied for resolving the poor tissue permeability problem is in vivo SELEX which can be directly performed in a live media [94]. In this technique nucleic acid strands which are nuclease-resistant, injected intravenously to the tumor-bearing mice followed by separation of tissue, isolated of nucleic acid strands, and in vitro amplification. This strategy assumed to create an effective targeted delivery system which enable the diagnostic and therapeutic aims in clinics. Unfortunately, this technique may suffer from some disadvantages, which may limit clinical applications, such as differences in specificity, polymerases inability in amplification, costly extraction and unreliability for in vivo screening. So, future developments in this area must be focused in the low cost, fast, and improved identification after screening. In the next few years some technologies such as single molecule or cell screening, identification and sequencing can be so promising to resolve the problems. Moreover, artificial nucleotide bases can be developed to increase the biostability of screened aptamers for clinical assays. The detailed information clearly demonstrated that nanoparticles possess the undeniable role for the diagnosis and therapeutic aims. But some conditions such as size, low-distribution and unpredictable behavior of materials in in vivo media make critical their production and usage in clinical assays. Nanomaterials mainly assigned to the unbound particles with size distribution of < 100 nm, where at least 50% of particles must meet that condition without agglomeration. So, it is required to performance of safe-by-design assays for clinical development due to changes of physicochemical and magnetic properties at range size of < 10 nm and also biological properties at range size of > 200 nm [95]. Moreover, another anxiety in this field is toxicity of nanoparticles in body which may be remained unresolved in the future. Specially the aptamer-nanoparticles conjugation required chemical agents which increase the possibility of toxicity for body. The reported information by articles and studies contains some characterizations which cannot be used as a citable reference for companies in order to production of diagnostic and therapeutic products. Some efforts in this filed have been performed for evaluation of materials toxicity which more limited to the cosmetics without any nano-toxicology evaluations. So, in future it is expected more efforts are done in in vivo studies including computational biology, biostability, size effects, nano- toxicity, coating, biodegradability, biocompatibility, dose of therapeutic agent-incorporated with size, evaluation of penetration and diffusion, etc. The biotechnology companies must focus on the evaluation and reduce of toxicological effects of nanoparticles to produce the medicinal products. Moreover, drug delivery studies should describe and explain predictive effects more than simple report of results. Recently aptamer-based CRISPR-Cas, as a new generation of biosensors, have gained attention of scientists for diagnosis of biomarkers and toxins. This new design of sensors is a promising field which can be helpfully and powerfully applied in different fields such as bioanalytical sensors, molecular biology, and enzymatic engineering. Although some shortcomings such as complicated processes, optimization of acting conditions of Cas proteins, and highly expert requirement may limit its application and accessibility, but due to high accuracy, this method must be more developed and incorporated with electrochemical methods for designing handheld and smartphone platforms which can be simply used in clinics.
Author Contributions
Conceptualization, A.M., and L.E.G.; Methodology, A.M., L.E.G., and M.B., Software, A.M.; validation, A.M., L.G., S.A.M., M.A.M., and M.B.; Formal analysis, A.M., L.E.G., and G.A.; writing—original draft preparation, A.M., L.E.G., and G.A.; writing—review and editing, A.M., L.G., S.A.M., M.A.M., and M.B.; Supervision; A.M. and M.B.; Project administration, A.M. and M.B.
Funding
This research received no external funding.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Acknowledgments
The authors gratefully acknowledge the, Faculty of Medicine, Research and Development Institute of Transilvania University of Brasov, Romania and Faculty of Medicine, University of Medicine and Pharmacy “Carol Davila” Bucharest, Romania for supporting this work.
Conflicts of Interest
The authors declare no conflict of interest.
Abbreviations
| AuNPs | Gold nanoparticles |
| ApDC | Aptamer-drug conjugates |
| β-CD-PELA | Beta-cyclodextrin-linked poly (ethylene glycol)-b-polylactide block copolymers |
| ctDNA | Circulating tumor DNA |
| COFs | Covalent organic frameworks |
| CNTs | Carbon nanotubes |
| CDs | Carbon dots |
| C-DNA | Cross hybridization formation of DNA |
| CCRF-CEM | Human lymphoblasts T-cell ALL |
| CTCs | Circulating tumor cells |
| CpG ODNs | Cytosine-phosphate-guanine oligonucleotides |
| crRNA | CRISPR RNA |
| CA125 | Cancer antigen 125 |
| DOX | Doxorubicin |
| DNM | Daunomycin |
| DM1 | Maytansine 1 |
| EGFR L858R | Exon 21 mutations in L858R substitution |
| ELISA | Enzyme-linked immunosorbent assay |
| FDA | Food and drug administration |
| 5-FU | 5-fluorouracil |
| FRET | Fluorescence resonance energy transfer, resonance energy transfer |
| GNCs | Gold nanoclusters |
| GO | Graphene oxide |
| HCR | Hybridization chain reaction |
| IDA | Integrin α6β4-specific DNA aptamer |
| LDL-R | Low-density lipoprotein receptor |
| LFA | Lateral flow assay |
| MMAE | Monomethyl auristatin E |
| MAB | Molecular aptamer beacon |
| MOFs | Metal organic frameworks |
| MB | Methylene Blue |
| NSCLC | Non-small cell lung cancer |
| NCHS | National Center for Health Statistics |
| PAM | Protospacer adjacent motif |
| PDGF | Platelet-derived growth factor |
| PTX | Paclitaxel |
| QDs | Quantum dots |
| Ramos | Human B-cell Burkitt’s lymphoma |
| RT-PCR | Real time polymerase chain reaction |
| ROS | Reactive oxygen species |
| SELEX | Systematic evolution of ligands by exponential enrichment |
| SPION | Superparamagnetic iron oxide nanoparticles |
| TMPyP | 5, 10, 15, 20-tetra (phenyl-4-N-methyl-4-pyridyl) |
| TDNp | Tetrahedral DNA nanoprobe |
| UCNP | Up conversion nanoparticles |
References
- Zhang: P.-L.; Wang, Z.-K.; Chen, Q.-Y.; Du, X.; Gao, J., Biocompatible G-Quadruplex/BODIPY assembly for cancer cell imaging and the attenuation of mitochondria. Bioorganic & Medicinal Chemistry Letters 2019, 29, 1943–1947ia.
- Kong, H. Y.; Byun, J., Nucleic acid aptamers: New methods for selection, stabilization, and application in biomedical science. Biomolecules & therapeutics 2013, 21, 423.
- Bavi, R.; Hang, Z.; Banerjee, P.; Aquib, M.; Jadhao, M.; Rane, N.; Bavi, S.; Bhosale, R.; Kodam, K.; Jeon, B.-H., Doxorubicin-conjugated innovative 16-mer DNA aptamer-based Annexin A1 targeted anti-cancer drug delivery. Molecular Therapy-Nucleic Acids 2020, 21, 1074–1086.
- Lan, J.; Wu, X.; Luo, L.; Liu, J.; Yang, L.; Wang, F. Fluorescent Ag clusters conjugated with anterior gradient-2 antigen aptamer for specific detection of cancer cells. Talanta 2019, 197, 86–91. [Google Scholar] [CrossRef]
- You, X.; Gopinath, S. C.; Lakshmipriya, T.; Li, D. High-affinity detection of alpha-synuclein by aptamer-gold conjugates on an amine-modified dielectric surface. Journal of analytical methods in chemistry 2019, 2019. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Deng, Z.; Wang, D.; He, J.; Zhang, D.; Tan, Y.; Peng, T.; Wang, X.-Q.; Tan, W. Conjugating aptamer and mitomycin C with reductant-responsive linker leading to synergistically enhanced anticancer effect. Journal of the American Chemical Society 2020, 142, 2532–2540. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Lai, B. S.; Juhas, M. Recent advances in aptamer discovery and applications. Molecules 2019, 24, 941. [Google Scholar] [CrossRef] [PubMed]
- Ng, E. W.; Shima, D. T.; Calias, P.; Cunningham Jr, E. T.; Guyer, D. R.; Adamis, A. P. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease. Nature reviews drug discovery 2006, 5, 123–132. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R. L.; Miller, K. D.; Fuchs, H. E.; Jemal, A. Cancer statistics, 2021. Ca Cancer J Clin 2021, 71, 7–33. [Google Scholar] [CrossRef] [PubMed]
- Stein, C. A.; Castanotto, D. FDA-approved oligonucleotide therapies in 2017. Molecular Therapy 2017, 25, 1069–1075. [Google Scholar] [CrossRef]
- Tsuchikama, K.; An, Z., Antibody-drug conjugates: recent advances in conjugation and linker chemistries. Protein & cell 2018, 9, 33–46.
- Mohammadinejad, A.; Taghdisi, S. M.; Es' haghi, Z.; Abnous, K.; Mohajeri, S. A. Targeted imaging of breast cancer cells using two different kinds of aptamers-functionalized nanoparticles. European Journal of Pharmaceutical Sciences 2019, 134, 60–68. [Google Scholar] [CrossRef] [PubMed]
- Mohammadi, M.; Salmasi, Z.; Hashemi, M.; Mosaffa, F.; Abnous, K.; Ramezani, M. Single-walled carbon nanotubes functionalized with aptamer and piperazine–polyethylenimine derivative for targeted siRNA delivery into breast cancer cells. International journal of pharmaceutics 2015, 485, 50–60. [Google Scholar] [CrossRef]
- Akbarzadeh, M.; Babaei, M.; Abnous, K.; Taghdisi, S. M.; Peivandi, M. T.; Ramezani, M.; Alibolandi, M. Hybrid silica-coated Gd-Zn-Cu-In-S/ZnS bimodal quantum dots as an epithelial cell adhesion molecule targeted drug delivery and imaging system. International journal of pharmaceutics 2019, 570, 118645. [Google Scholar] [CrossRef]
- Yang, Y.; Zhao, W.; Tan, W.; Lai, Z.; Fang, D.; Jiang, L.; Zuo, C.; Yang, N.; Lai, Y. An efficient cell-targeting drug delivery system based on aptamer-modified mesoporous silica nanoparticles. Nanoscale Research Letters 2019, 14, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Yu, Y.; Ji, Q.; Qiu, L., Targeted delivery of anticancer drugs by aptamer AS1411 mediated Pluronic F127/cyclodextrin-linked polymer composite micelles. Nanomedicine: Nanotechnology, Biology and Medicine 2015, 11, 175–184.
- Li, X.; Wu, X.; Yang, H.; Li, L.; Ye, Z.; Rao, Y., A nuclear targeted Dox-aptamer loaded liposome delivery platform for the circumvention of drug resistance in breast cancer. Biomedicine & Pharmacotherapy 2019, 117, 109072.
- Zhao, J.; Liu, P.; Ma, J.; Li, D.; Yang, H.; Chen, W.; Jiang, Y. Enhancement of radiosensitization by silver nanoparticles functionalized with polyethylene glycol and aptamer As1411 for glioma irradiation therapy. International journal of nanomedicine 2019, 9483–9496. [Google Scholar] [CrossRef]
- Sun, X.; Liu, B.; Chen, X.; Lin, H.; Peng, Y.; Li, Y.; Zheng, H.; Xu, Y.; Ou, X.; Yan, S. Aptamer-assisted superparamagnetic iron oxide nanoparticles as multifunctional drug delivery platform for chemo-photodynamic combination therapy. Journal of Materials Science: Materials in Medicine 2019, 30, 1–15. [Google Scholar]
- Alijani, H.; Noori, A.; Faridi, N.; Bathaie, S. Z.; Mousavi, M. F. Aptamer-functionalized Fe3O4@ MOF nanocarrier for targeted drug delivery and fluorescence imaging of the triple-negative MDA-MB-231 breast cancer cells. Journal of Solid State Chemistry 2020, 292, 121680. [Google Scholar] [CrossRef]
- Lin, H.-C.; Li, W.-T.; Madanayake, T. W.; Tao, C.; Niu, Q.; Yan, S.-Q.; Gao, B.-A.; Ping, Z. Aptamer-guided upconversion nanoplatform for targeted drug delivery and near-infrared light-triggered photodynamic therapy. Journal of Biomaterials Applications 2020, 34, 875–888. [Google Scholar] [CrossRef] [PubMed]
- Chang, M.; Yang, C.-S.; Huang, D.-M. Aptamer-conjugated DNA icosahedral nanoparticles as a carrier of doxorubicin for cancer therapy. ACS nano 2011, 5, 6156–6163. [Google Scholar] [PubMed]
- Liu, J.; Wei, T.; Zhao, J.; Huang, Y.; Deng, H.; Kumar, A.; Wang, C.; Liang, Z.; Ma, X.; Liang, X.-J. Multifunctional aptamer-based nanoparticles for targeted drug delivery to circumvent cancer resistance. Biomaterials 2016, 91, 44–56. [Google Scholar] [CrossRef] [PubMed]
- Yoon, S.; Huang, K.-W.; Reebye, V.; Spalding, D.; Przytycka, T. M.; Wang, Y.; Swiderski, P.; Li, L.; Armstrong, B.; Reccia, I., Aptamer-drug conjugates of active metabolites of nucleoside analogs and cytotoxic agents inhibit pancreatic tumor cell growth. Molecular Therapy-Nucleic Acids 2017, 6, 80–88.
- Huang, Y. F.; Shangguan, D.; Liu, H.; Phillips, J. A.; Zhang, X.; Chen, Y.; Tan, W. Molecular assembly of an aptamer–drug conjugate for targeted drug delivery to tumor cells. ChemBioChem 2009, 10, 862–868. [Google Scholar] [CrossRef]
- Li, W.; Yang, X.; He, L.; Wang, K.; Wang, Q.; Huang, J.; Liu, J.; Wu, B.; Xu, C., Self-assembled DNA nanocentipede as multivalent drug carrier for targeted delivery. ACS applied materials & interfaces 2016, 8, 25733–25740.
- Wei, H.; Zhao, Z.; Wang, Y.; Zou, J.; Lin, Q.; Duan, Y., One-step self-assembly of multifunctional DNA nanohydrogels: an enhanced and harmless strategy for guiding combined antitumor therapy. ACS applied materials & interfaces 2019, 11, 46479–46489.
- Wang, T.; Rahimizadeh, K.; Veedu, R. N., Development of a novel DNA oligonucleotide targeting low-density lipoprotein receptor. Molecular Therapy-Nucleic Acids 2020, 19, 190–198.
- Li, F.; Lu, J.; Liu, J.; Liang, C.; Wang, M.; Wang, L.; Li, D.; Yao, H.; Zhang, Q.; Wen, J. A water-soluble nucleolin aptamer-paclitaxel conjugate for tumor-specific targeting in ovarian cancer. Nature communications 2017, 8, 1390. [Google Scholar] [PubMed]
- Jeong, H. Y.; Kim, H.; Lee, M.; Hong, J.; Lee, J. H.; Kim, J.; Choi, M. J.; Park, Y. S.; Kim, S.-C. Development of HER2-specific aptamer-drug conjugate for breast cancer therapy. International journal of molecular sciences 2020, 21, 9764. [Google Scholar]
- Thiel, K. W.; Hernandez, L. I.; Dassie, J. P.; Thiel, W. H.; Liu, X.; Stockdale, K. R.; Rothman, A. M.; Hernandez, F. J.; McNamara, J. O.; Giangrande, P. H. Delivery of chemo-sensitizing siRNAs to HER2+-breast cancer cells using RNA aptamers. Nucleic acids research 2012, 40, 6319–6337. [Google Scholar] [CrossRef]
- Kim, H. J.; Park, J. Y.; Lee, T. S.; Song, I. H.; Cho, Y. L.; Chae, J. R.; Kang, H.; Lim, J. H.; Lee, J. H.; Kang, W. J. PET imaging of HER2 expression with an 18F-fluoride labeled aptamer. PLoS One 2019, 14, e0211047. [Google Scholar] [CrossRef] [PubMed]
- Alshaer, W.; Hillaireau, H.; Fattal, E. Aptamer-guided nanomedicines for anticancer drug delivery. Advanced drug delivery reviews 2018, 134, 122–137. [Google Scholar] [CrossRef] [PubMed]
- Serrano, C. M.; Freeman, R.; Godbe, J.; Lewis, J. A.; Stupp, S. I. DNA-peptide amphiphile nanofibers enhance aptamer function. ACS applied bio materials 2019, 2, 2955–2963. [Google Scholar] [CrossRef] [PubMed]
- Vazquez-Gonzalez, M.; Willner, I., Aptamer-functionalized micro-and nanocarriers for controlled release. ACS Applied Materials & Interfaces 2021, 13, 9520–9541.
- Bai, J.; Luo, Y.; Wang, X.; Li, S.; Luo, M.; Yin, M.; Zuo, Y.; Li, G.; Yao, J.; Yang, H. A protein-independent fluorescent RNA aptamer reporter system for plant genetic engineering. Nature Communications 2020, 11, 3847. [Google Scholar] [CrossRef] [PubMed]
- Nooranian, S.; Mohammadinejad, A.; Mohajeri, T.; Aleyaghoob, G.; Kazemi Oskuee, R. Biosensors based on aptamer-conjugated gold nanoparticles: a review. Biotechnology and Applied Biochemistry 2022, 69, 1517–1534. [Google Scholar] [CrossRef] [PubMed]
- Debnath, S. K.; Srivastava, R. Drug delivery with carbon-based nanomaterials as versatile nanocarriers: progress and prospects. Frontiers in Nanotechnology 2021, 3, 644564. [Google Scholar] [CrossRef]
- Nair, A.; Haponiuk, J. T.; Thomas, S.; Gopi, S., Natural carbon-based quantum dots and their applications in drug delivery: A review. Biomedicine & Pharmacotherapy 2020, 132, 110834.
- Mohammadinejad, A.; Es' haghi, Z.; Abnous, K.; Mohajeri, S. A. Tandem determination of mitoxantrone and ribonucleic acid using mercaptosuccinic acid-capped CdTe quantum dots. Journal of Luminescence 2017, 190, 254–260. [Google Scholar] [CrossRef]
- Croissant, J. G.; Butler, K. S.; Zink, J. I.; Brinker, C. J. Synthetic amorphous silica nanoparticles: toxicity, biomedical and environmental implications. Nature Reviews Materials 2020, 5, 886–909. [Google Scholar] [CrossRef]
- Ghosh, B.; Biswas, S. Polymeric micelles in cancer therapy: State of the art. Journal of Controlled Release 2021, 332, 127–147. [Google Scholar] [CrossRef]
- Malam, Y.; Loizidou, M.; Seifalian, A. M. Liposomes and nanoparticles: nanosized vehicles for drug delivery in cancer. Trends in pharmacological sciences 2009, 30, 592–599. [Google Scholar] [CrossRef]
- Vangijzegem, T.; Stanicki, D.; Laurent, S. Magnetic iron oxide nanoparticles for drug delivery: applications and characteristics. Expert opinion on drug delivery 2019, 16, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Deng, K.; Hou, Z.; Li, X.; Li, C.; Zhang, Y.; Deng, X.; Cheng, Z.; Lin, J. Aptamer-mediated up-conversion core/MOF shell nanocomposites for targeted drug delivery and cell imaging. Scientific reports 2015, 5, 7851. [Google Scholar] [CrossRef] [PubMed]
- Abdelhamid, H. N. Nanoparticle assisted laser desorption/ionization mass spectrometry for small molecule analytes. Microchimica Acta 2018, 185, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Soontornworajit, B.; Zhou, J.; Shaw, M. T.; Fan, T.-H.; Wang, Y. Hydrogel functionalization with DNA aptamers for sustained PDGF-BB release. Chemical communications 2010, 46, 1857–1859. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.-Y.; Chen, L.-Q.; Sun, W.; Du, H.-H.; Dong, S.; Ahmed, A. M. Q.; Cao, D.; Cui, J.-H.; Zhang, Y.; Cao, Q.-R. Collagenase IV and clusterin-modified polycaprolactone-polyethylene glycol nanoparticles for penetrating dense tumor tissues. Theranostics 2021, 11, 906. [Google Scholar] [CrossRef] [PubMed]
- Patil, Y. P.; Jadhav, S. Novel methods for liposome preparation. Chemistry and physics of lipids 2014, 177, 8–18. [Google Scholar] [CrossRef]
- Gao, J.; Gu, H.; Xu, B. Multifunctional magnetic nanoparticles: design, synthesis, and biomedical applications. Accounts of chemical research 2009, 42, 1097–1107. [Google Scholar] [CrossRef]
- Azzouz, A.; Goud, K. Y.; Raza, N.; Ballesteros, E.; Lee, S.-E.; Hong, J.; Deep, A.; Kim, K.-H. Nanomaterial-based electrochemical sensors for the detection of neurochemicals in biological matrices. TrAC Trends in Analytical Chemistry 2019, 110, 15–34. [Google Scholar] [CrossRef]
- Wen, M.; Li, G.; Liu, H.; Chen, J.; An, T.; Yamashita, H., Metal–organic framework-based nanomaterials for adsorption and photocatalytic degradation of gaseous pollutants: recent progress and challenges. Environmental Science: Nano 2019, 6, 1006–1025.
- Mehtab, T.; Yasin, G.; Arif, M.; Shakeel, M.; Korai, R. M.; Nadeem, M.; Muhammad, N.; Lu, X. Metal-organic frameworks for energy storage devices: batteries and supercapacitors. Journal of Energy Storage 2019, 21, 632–646. [Google Scholar] [CrossRef]
- Yan, Y.; Li, C.; Wu, Y.; Gao, J.; Zhang, Q. From isolated Ti-oxo clusters to infinite Ti-oxo chains and sheets: recent advances in photoactive Ti-based MOFs. Journal of Materials Chemistry A 2020, 8, 15245–15270. [Google Scholar] [CrossRef]
- Wang, S.; Chen, Y.; Wang, S.; Li, P.; Mirkin, C. A.; Farha, O. K. DNA-functionalized metal–organic framework nanoparticles for intracellular delivery of proteins. Journal of the American Chemical Society 2019, 141, 2215–2219. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Liu, Q.; Feng, W.; Sun, Y.; Li, F. Upconversion luminescent materials: advances and applications. Chemical reviews 2015, 115, 395–465. [Google Scholar] [CrossRef]
- Mohammadinejad, A.; Abnous, K.; Nameghi, M. A.; Yahyazadeh, R.; Hamrah, S.; Senobari, F.; Mohajeri, S. A., Application of green-synthesized carbon dots for imaging of cancerous cell lines and detection of anthraquinone drugs using silica-coated CdTe quantum dots-based ratiometric fluorescence sensor. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 2023, 288, 122200.
- Yang, Q.; Zhao, C.; Zhao, J.; Ye, Y. Synthesis and singlet oxygen activities of near infrared photosensitizers by conjugation with upconversion nanoparticles. Optical Materials Express 2017, 7, 913–923. [Google Scholar] [CrossRef]
- Lim, C.-K.; Heo, J.; Shin, S.; Jeong, K.; Seo, Y. H.; Jang, W.-D.; Park, C. R.; Park, S. Y.; Kim, S.; Kwon, I. C. Nanophotosensitizers toward advanced photodynamic therapy of Cancer. Cancer letters 2013, 334, 176–187. [Google Scholar] [CrossRef] [PubMed]
- Yano, S.; Hirohara, S.; Obata, M.; Hagiya, Y.; Ogura, S.-i.; Ikeda, A.; Kataoka, H.; Tanaka, M.; Joh, T., Current states and future views in photodynamic therapy. Journal of Photochemistry and Photobiology C: Photochemistry Reviews 2011, 12, 46–67.
- Del Rosal, B.; Jaque, D. Upconversion nanoparticles for in vivo applications: limitations and future perspectives. Methods and Applications in Fluorescence 2019, 7, 022001. [Google Scholar] [CrossRef] [PubMed]
- Institute, N. C. Radiation Therapy Side Effects. https://www.cancer.gov/about-cancer/treatment/types/radiation-therapy/side-effects.
- Mohammadinejad, A.; Oskuee, R. K.; Eivazzadeh-Keihan, R.; Rezayi, M.; Baradaran, B.; Maleki, A.; Hashemzaei, M.; Mokhtarzadeh, A.; de la Guardia, M. Development of biosensors for detection of alpha-fetoprotein: As a major biomarker for hepatocellular carcinoma. TrAC Trends in Analytical Chemistry 2020, 130, 115961. [Google Scholar] [CrossRef]
- Schneider-Futschik, E. K.; Reyes-Ortega, F. Advantages and disadvantages of using magnetic nanoparticles for the treatment of complicated ocular disorders. Pharmaceutics 2021, 13, 1157. [Google Scholar] [CrossRef]
- Gu, K.; Meng, F. In Former research and recent advances of metal-organic frameworks (MOF) for anti-cancer drug delivery, Journal of Physics: Conference Series, IOP Publishing: 2021; p 012021.
- Hu, R.; Zhang, X.; Zhao, Z.; Zhu, G.; Chen, T.; Fu, T.; Tan, W. DNA nanoflowers for multiplexed cellular imaging and traceable targeted drug delivery. Angewandte Chemie 2014, 126, 5931–5936. [Google Scholar] [CrossRef]
- Huang, F.; You, M.; Chen, T.; Zhu, G.; Liang, H.; Tan, W. Self-assembled hybrid nanoparticles for targeted co-delivery of two drugs into cancer cells. Chemical Communications 2014, 50, 3103–3105. [Google Scholar] [CrossRef]
- Chen, X.; Zhou, L.; Wang, J.; Jiang, G.; Cheng, H.; Pei, R. The Study of the Interaction between Doxorubicin and Single-Stranded DNA. ChemistrySelect 2016, 1, 3823–3828. [Google Scholar] [CrossRef]
- Richards, A. D.; Rodger, A. Synthetic metallomolecules as agents for the control of DNA structure. Chemical Society Reviews 2007, 36, 471–483. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Chen, X. Aptamer-based targeted therapy. Advanced drug delivery reviews 2018, 134, 65–78. [Google Scholar] [CrossRef] [PubMed]
- Keefe, A. D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nature reviews Drug discovery 2010, 9, 537–550. [Google Scholar] [CrossRef] [PubMed]
- Zhu, G.; Niu, G.; Chen, X. Aptamer–drug conjugates. Bioconjugate chemistry 2015, 26, 2186–2197. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Lifson, M. A.; Inci, F.; Liang, L.-G.; Sheng, Y.-F.; Demirci, U. Advances in addressing technical challenges of point-of-care diagnostics in resource-limited settings. Expert review of molecular diagnostics 2016, 16, 449–459. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.-H.; Seo, J.-M.; Shin, K.-J.; Yang, S.-G. Design and clinical developments of aptamer-drug conjugates for targeted cancer therapy. Biomaterials Research 2021, 25, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Testing.com Point-of-Care Testing. https://www.testing.com/articles/point-of-care-testing/.
- Feng, D.; Ren, M.; Miao, Y.; Liao, Z.; Zhang, T.; Chen, S.; Ye, K.; Zhang, P.; Ma, X.; Ni, J. Dual selective sensor for exosomes in serum using magnetic imprinted polymer isolation sandwiched with aptamer/graphene oxide based FRET fluorescent ignition. Biosensors and Bioelectronics 2022, 207, 114112. [Google Scholar] [CrossRef] [PubMed]
- Yue, X.; Qiao, Y.; Gu, D.; Wu, Z.; Zhao, W.; Li, X.; Yin, Y.; Zhao, W.; Kong, D.; Xi, R., Reliable FRET-ON imaging of telomerase in living cells by a tetrahedral DNA nanoprobe integrated with structure-switchable molecular beacon. Sensors and Actuators B: Chemical 2020, 312, 127943.
- Hasan, M. R.; Sharma, P.; Pilloton, R.; Khanuja, M.; Narang, J., Colorimetric biosensor for the naked-eye detection of ovarian cancer biomarker PDGF using citrate modified gold nanoparticles. Biosensors and Bioelectronics: X 2022, 11, 100142.
- Shahbazlou, S. V.; Vandghanooni, S.; Dabirmanesh, B.; Eskandani, M.; Hasannia, S. Biotinylated aptamer-based SPR biosensor for detection of CA125 antigen. Microchemical Journal 2023, 194, 109276. [Google Scholar] [CrossRef]
- Ni, Y.; Ouyang, H.; Yu, L.; Ling, C.; Zhu, Z.; He, A.; Liu, R. Label-free electrochemical aptasensor based on magnetic α-Fe2O3/Fe3O4 heterogeneous hollow nanorods for the detection of cancer antigen 125. Bioelectrochemistry 2022, 148, 108255. [Google Scholar] [CrossRef]
- Liu, F.; Peng, J.; Lei, Y.-M.; Liu, R.-S.; Jin, L.; Liang, H.; Liu, H.-F.; Ma, S.-Y.; Zhang, X.-H.; Zhang, Y.-P., Electrochemical detection of ctDNA mutation in non-small cell lung cancer based on CRISPR/Cas12a system. Sensors and Actuators B: Chemical 2022, 362, 131807.
- Khaksari, S.; Ameri, A. R.; Taghdisi, S. M.; Sabet, M.; Bami, S. M. J. G.; Abnous, K.; Shaegh, S. A. M. A microfluidic electrochemical aptasensor for highly sensitive and selective detection of A549 cells as integrin α6β4-containing cell model via IDA aptamers. Talanta 2023, 252, 123781. [Google Scholar] [CrossRef]
- Yu, Q.; Zhao, Q.; Wang, S.; Zhao, S.; Zhang, S.; Yin, Y.; Dong, Y. Development of a lateral flow aptamer assay strip for facile identification of theranostic exosomes isolated from human lung carcinoma cells. Analytical biochemistry 2020, 594, 113591. [Google Scholar] [CrossRef]
- Sanati, A.; Esmaeili, Y.; Khavani, M.; Bidram, E.; Rahimi, A.; Dabiri, A.; Rafienia, M.; Jolfaie, N. A.; Mofrad, M. R.; Javanmard, S. H. Smartphone-assisted lab-in-a-tube device using gold nanocluster-based aptasensor for detection of MUC1-overexpressed tumor cells. Analytica Chimica Acta 2023, 1252, 341017. [Google Scholar] [CrossRef] [PubMed]
- Moutsiopoulou, A.; Broyles, D.; Dikici, E.; Daunert, S.; Deo, S. K. Molecular aptamer beacons and their applications in sensing, imaging, and diagnostics. Small 2019, 15, 1902248. [Google Scholar] [CrossRef]
- Liu, Z.; Zhao, J.; Zhang, R.; Han, G.; Zhang, C.; Liu, B.; Zhang, Z.; Han, M.-Y.; Gao, X. Cross-platform cancer cell identification using telomerase-specific spherical nucleic acids. ACS nano 2018, 12, 3629–3637. [Google Scholar] [CrossRef]
- Sharma, P.; Panchal, A.; Yadav, N.; Narang, J. Analytical techniques for the detection of glycated haemoglobin underlining the sensors. International journal of biological macromolecules 2020, 155, 685–696. [Google Scholar] [CrossRef] [PubMed]
- Hasanzadeh, M.; Shadjou, N.; Eskandani, M.; de la Guardia, M.; Omidinia, E. Electrochemical nano-immunosensing of effective cardiac biomarkers for acute myocardial infarction. TrAC Trends in Analytical Chemistry 2013, 49, 20–30. [Google Scholar] [CrossRef]
- Zhong, Q.; Ding, H.; Gao, B.; He, Z.; Gu, Z. Advances of microfluidics in biomedical engineering. Advanced materials technologies 2019, 4, 1800663. [Google Scholar] [CrossRef]
- Mohammadinejad, A.; Aleyaghoob, G.; Ertas, Y. N. Nanomaterials in Lateral Flow Assay. In Functionalized Smart Nanomaterials for Point-of-Care Testing, Springer: 2023; pp 49-81.
- Khandan-Nasab, N.; Askarian, S.; Mohammadinejad, A.; Aghaee-Bakhtiari, S. H.; Mohajeri, T.; Oskuee, R. K. Biosensors, microfluidics systems and lateral flow assays for circulating microRNA detection: A review. Analytical Biochemistry 2021, 633, 114406. [Google Scholar] [CrossRef]
- ul ain Zahra, Q.; Mohsan, S. A. H.; Shahzad, F.; Qamar, M.; Qiu, B.; Luo, Z.; Zaidi, S. A. Progress in smartphone-enabled aptasensors. Biosensors and Bioelectronics 2022, 215, 114509. [Google Scholar]
- Burnett, J. C.; Rossi, J. J., RNA-based therapeutics: current progress and future prospects. Chemistry & biology 2012, 19, 60–71.
- Mi, J.; Liu, Y.; Rabbani, Z. N.; Yang, Z.; Urban, J. H.; Sullenger, B. A.; Clary, B. M. In vivo selection of tumor-targeting RNA motifs. Nature chemical biology 2010, 6, 22–24. [Google Scholar] [CrossRef]
- He, C.; Hu, Y.; Yin, L.; Tang, C.; Yin, C. Effects of particle size and surface charge on cellular uptake and biodistribution of polymeric nanoparticles. Biomaterials 2010, 31, 3657–3666. [Google Scholar] [CrossRef] [PubMed]
Scheme 1.
Application of aptamer as a therapeutic and diagnosis agent for tumors.

Figure 1.
(A) Application of AuNPs and QDs in MCF-7 cells imaging: (a) preparation of MUC1 apt – AuNPs/ ATP apt-QDs complex; (b) Selective internalization of complex into MCF7 cell by interaction between MUC1 aptamer and MUC1 biomarker overexpressed on the MCF7 cell surface. (c) Failure to entrance of complex into CHO cell due to absence of MUC1 biomarker. (AuNP: GNP). “Reprinted from with [12] permission from Elsevier.” (B) Synthesis of Gd-Zn-Cu-In-S/ZnS QDs/PEG/EpCAM DNA and conjugation of thiolated-apatamer with maleimide group. “Reprinted from [14] with permission from Elsevier”. (C) Synthesis of Fe3O4@ UiO-66-NH2 MOF-DOX-CDs-Aps aptamer nanocarrier and selective entrance to MDA-MB-231 human breast cancer cells through interaction of AS1411 apatmer with nucleolin biomarker. “Reprinted from [20] with permission from Elsevier”. (D) Application of 18F-fluoride- HER2 aptamer: Up section: mechanism of entrance to tumor cells; Down section: in vivo application for radiography: (a) HER2-positive BT474 tumor; (b) HER2-negative MB-MDA231 tumor; (c) %ID/g of tumor estimated for 18F-labeled HER2 aptamer. “Adapted from [32] in accordance with the Creative Commons Attribution 4.0 International (CC BY 4.0) Creative Commons Attribution License”.
Figure 1.
(A) Application of AuNPs and QDs in MCF-7 cells imaging: (a) preparation of MUC1 apt – AuNPs/ ATP apt-QDs complex; (b) Selective internalization of complex into MCF7 cell by interaction between MUC1 aptamer and MUC1 biomarker overexpressed on the MCF7 cell surface. (c) Failure to entrance of complex into CHO cell due to absence of MUC1 biomarker. (AuNP: GNP). “Reprinted from with [12] permission from Elsevier.” (B) Synthesis of Gd-Zn-Cu-In-S/ZnS QDs/PEG/EpCAM DNA and conjugation of thiolated-apatamer with maleimide group. “Reprinted from [14] with permission from Elsevier”. (C) Synthesis of Fe3O4@ UiO-66-NH2 MOF-DOX-CDs-Aps aptamer nanocarrier and selective entrance to MDA-MB-231 human breast cancer cells through interaction of AS1411 apatmer with nucleolin biomarker. “Reprinted from [20] with permission from Elsevier”. (D) Application of 18F-fluoride- HER2 aptamer: Up section: mechanism of entrance to tumor cells; Down section: in vivo application for radiography: (a) HER2-positive BT474 tumor; (b) HER2-negative MB-MDA231 tumor; (c) %ID/g of tumor estimated for 18F-labeled HER2 aptamer. “Adapted from [32] in accordance with the Creative Commons Attribution 4.0 International (CC BY 4.0) Creative Commons Attribution License”.

Figure 2.
(A) Application of HCR in drug delivery: (a) Formation of nanocentipede and loading of DOX; (b) Eternalization of nanocentipede-DOX system into SMMC-7721 cell. “ Reprinted from [26] with permission from ACS.”; (B) Application of cross hybridization formation of DNA (C-DNA) (a) Formation of CpG-MUC1-hydrogel for (b) targeted drug delivery to cells with MUC1 biomarkers. “Reprinted from [27] with permission from ACS.”; (C) Covalently binding of sgc8ca to DOX through hydrazone. “ Reprinted from [25] with permission from John Wiley and Sons.” .
Figure 2.
(A) Application of HCR in drug delivery: (a) Formation of nanocentipede and loading of DOX; (b) Eternalization of nanocentipede-DOX system into SMMC-7721 cell. “ Reprinted from [26] with permission from ACS.”; (B) Application of cross hybridization formation of DNA (C-DNA) (a) Formation of CpG-MUC1-hydrogel for (b) targeted drug delivery to cells with MUC1 biomarkers. “Reprinted from [27] with permission from ACS.”; (C) Covalently binding of sgc8ca to DOX through hydrazone. “ Reprinted from [25] with permission from John Wiley and Sons.” .

Figure 3.
Optical aptasensors: (A) and (B) FRET-based; (C) colorimetric; (D) SPR. “Reprinted from [76,77,78,79] with permission from Elsevier”.

Figure 4.
Designing of aptasensor for cancers: (A) Label-free electrochemical sensor; (B) Cas12a/crRNA based electrochemical sensor ; (C) microfluidic; (D) LFA; (E) smartphone.” Reprinted from [80,81,82,83,84] with permission from Elsevier.”.

Table 1.
The summarized information aptamer-based targeted-delivery systems.
| Method of delivery | Sequences of aptamer (5’ to 3’) | Cell or animal | Marker | Therapeutic agent | Ref. |
|---|---|---|---|---|---|
| Nanocomplex of ATP aptamer/QDs and MUC-1 aptamer/ AuNPs | ATP-aptamer: NH2-AACCTGGGGGAGTATTGCGGAGGAAGGTMUC1-aptamer: 5′-SH-GAAGTGAAAATGACAGAACACAACA-3′ | MCF-7 | Muc-1, ATP | - | [12] |
| EpCAM aptamer-conjugated SWNT/piperazine–polyethylenimine | EpCAM aptamer: GCG ACU GGU UAC CCG GUC G SiRNA: GGAUGUUCAAGAUCCCAUGCAGCTC |
MCF-7 | EpCAM | siRNA for suppressing BCL9l | [13] |
| silica coated-Gd-Zn-Cu-In-S/ZnS QDs/PEG/EpCAM DNA | EpCAM aptamer: CAC TAC AGA GGT TGC GTC TGT CCC ACG TTG TCA TGG GGG GTT GGC CTG | 4T1, MCF-7 | EpCAM | DOX | [14] |
| Sgc8 aptamer-modified silica nanoparticles system | Sgc8 aptamer: ATCTAACTGCCGCCGCGGGAAAATGTACGGTTA G(T)10-COOH | CCRF-CEM human acute T lymphocyte leukemia | protein tyrosine kinase-7 (PTK-7) | DOX | [15] |
| As141 aptamer conjugated-pluronic F127 /beta-cyclodextrin-linked poly (ethylene glycol)-b-polylactide block copolymers (β-CD-PELA) | As141 aptamer: TTGGTGGTGGTGGTTGTGGTGGTGGTGG | MCF-7, female BALB/c nude mice |
Nucleolin | DOX | [16] |
| Encapsulation of aptamer-DOX in liposome | Aptamer AS1411: GGT GGT GGT GGT TGT GGT GGT GGT GGT T |
Human breast tumor MCF-7/Adr cells | nucleolin | DOX | [17] |
| irradiation therapy using AgNPs functionalized with PEG and As141 aptamer | As1411 aptamer: (CH2)6-NH2-GGTGGTGGTGGTTGTGGTGGTG GTGG | C6 glioma, C6 glioma-bearing mice |
nucleolin | - | [18] |
| Photodynamic therapy by aptamer-conjugated superparamagnetic iron oxide nanoparticles (SPION) loaded by daunomycin (DNM) and 5, 10, 15, 20-tetra (phenyl-4-N-methyl-4-pyridyl) (TMPyP) | As1411 and DNM aptamer: 5′-NH2-GGG GGG GGT TGT CCC CCC CCT TTT TTG GTG GTG GTG GTT GTG GTG GTG GTG G |
C26, A549 | nucleolin | DNM, TMPyP | [19] |
| Fe3O4@ UiO-66-NH2 MOF/DOX/CDs/AS1411 aptamer | As1411 aptamer: GGTGGTGGTGGTTGTGGTGGTG GTGG | MDA-MB-231 | nucleolin | DOX | [20] |
| photosensitizer protoporphyrin IX/ AS1411/NaYF4:Yb, Er nanocluster (UCNP) | As1411 aptamer: NH2–GG TGGTGGTGG TTG TGG TGGTGG TGG |
MCF7, Hella | nucleolin | photosensitizer protoporphyrin IX produced ROS | [21] |
| assembling five DNA strands to form five-point-star motif | strand I: ATAGTGAGTCGTATTAATTAACCCTCACTAAAAAGGATCCGGATCCTT strand II: TTTAGTGAGGGTTAATCATACGATTTAGGTGAAAGGATCCGGATCCTT strand III: TCACCTAAATCGTATGGGAGCTCTGCTTATATAAGGATCCGGATCCTT strand IV: ATATAAGCAGAGCTCCTAGAAGGCACAGTCGAAAGGATCCGGATCCTT strand V: TCGACTGTGCCTTCTATAATACGACTCACTATAAGGATCCGGATCCTT |
MCF7 | MUC1 | DOX | [22] |
| Assembling two strands contains a DNA aptamer with G-quadruplex and double-stranded DNA | CCCCCCCCCCTGTTGGGGGGGGGGTTTTTTTTTGGTGGTGGTGGTTGTGGTGGTGGTGG | MCF7 | MUC1 | DOX | [23] |
| Conjugation of aptamer P19 to gemcitabine, 5-fluorouracil (5-FU), monomethyl auristatin E (MMAE) and derivative of maytansine 1 (DM1) | GGGAGACAAGAAUAAACGCUCAAUGGCGAAUGCCCGCCUAAUAGGGCGUUAUGACUUGUUGAGUUCGACAGGAGGCUCACAACAGGC | PANC-1 AsPC-1 | cells | Gemcitabine 5-FU MMAE DM1 |
[24] |
| Covalently binding sgc8ca aptamer- doxorubicin | ATC TAA CTG CTG CGC CGC CGG GAA AAT ACT GTA CGG TTA GA | Human T-cell ALL (CCRF-CEM), human B-cell Burkitt’s lymphoma (Ramos) | kinase 7 (PTK7) | DOX | [25] |
| self-assembly of biotinylated hairpin DNAs followed by streptavidin-aptamers (Zy1) conjugation |
H1: Biotin-CGT CGT GCA GCA GCA GCA GCA GCA ACG GCT TGC TGC TGC TGC TGC TGC H2: Biotin-TGC TGC TGC TGC TGC TGC ACG ACG GCA GCA GCA GCA GCA GCA AGC CGT Trigger: TGC TGC TGC TGC TGC TGC ACG ACG Zy1: ACG CGC GCG CGC ATA GCG CGC TGA GCT GAA GAT CGT ACC GTG AGC GCG T(T)10- streptavidin |
SMMC-7721 | cell | DOX | [26] |
| self-assembly of 8 sequences of S1−S4 DNA and linker L1−L4 DNA to form nanohydrogels: -unmethylated cytosine-phosphate-guanine oligonucleotides (CpG ODNs) -DNA nanohydrogels (CpG-MUC1-hydrogel) - I-motif cytosine (C)-rich single-stranded DNA |
S1(I-motif): TCAACACTAATCCCCAATCCCAATCCCAATCCCAAACG A S2: TCAACACTAATCCGTTTGGGATTGGGACAAAACGACGAA S3(CpG-MUC1): TCAACACTAATCCCCAATCGTCGTTTTGTCGTTTTGTCGTT-S-S GCAGTTGATCCTTTGGATACCCTGG S4: TCAACACTAATCAAAACGACAAAACGATTGGGATTGGGA L1: GATTAGTGTTGAAACGACA-S-S-AAACG L2: ACAAAA-S-S-CGACGAGCCCTCCCCC L3: GATTAGTGTTGAGGGGGAGGGC L4 (CpG): TCGTCGTTTTGTCGTTTTGTCGTT |
MCF-7, A549, HepG-2, Female BALB/c (nu/nu) athymic nude mice (5−6 wk) |
MUC1 | DOX | [27] |
| antimiR-21 DNAzyme linked to the aptamer of low-density lipoprotein receptor (LDL-R) | TCA ACA GGC TAG CTA CAA CGA CAG TCT GAT AAG CTA TTTTTA GGA CAG GAC CAC ACC CAG CGC GGT CGG CGG GTG GGC GGG GGG AGA ACG AGG TAG GG | Huh-7, MDA-MB-231 | LDL-R | antimiR-21 DNAzyme | [28] |
| Covalently bonding paclitaxel (PTX) to the nucleolin AS1411 aptamer (NucA) through dipeptide bond | TTGGTGGTGGTGGTTGTGGTGGTGGTGG | SKOV3 (ATCC HTB-77), OVCAR3 (ATCC HTB-161) | Nucleolin and cathepsin | PTX | [29] |
| HER2- aptamer -conjugated to the mertansine (DM1) | AGC CGCGAG GGG AGG GAU AGG GUA GGG CGC GGC U | BT-474, MDA-MB-231 MCF-7, A549, mouse xenografts with BT-474 breast cancer |
HER2 | DM1 | [30] |
| conjugation of HER2 aptamer to siRNAs targeting Bcl-2 | GGGAGGACGAUGCGGCGAUGCUUACGUGCACGCGCCAGACGACUCGCCCGAGCUGUCACAGAGGGGCUACUU | N202.1A | HER2 | siRNAs targeting Bcl-2 | [31] |
| 18F-fluoride- HER2 aptamer | TCCTGGCATGTTCGATGGAGGCCTTTGATTACAGCCCAGA | tumor-bearing mice | HER2 | 18F-fluoride- HER2 aptamer | [32] |
Table 2.
Summarized data of aptasensors for detection of biomarkers.
| Method | Sequence | Biomarker | Linear range | LOD | Ref. |
|---|---|---|---|---|---|
| Exosomes on the molecularly imprinted polymer (MIP)-coated Fe3O4 release the aptamer-FAM from GO | CD63: FAM-CACCCCACCTCGCTCCCGTGACACTAATGCTA MUC1: FAM-CAGCCTGCACTCTAACGCAGTTGATCCTTTGGATAGCCTGGGTTAGA |
CD63, MUC1 | 1.19 × 10-6 - 4.76 × 10−5 mol/L |
2.27 × 10−6 mol/L |
[76] |
| tetrahedral DNA (L1–L4) hybridized with MAB | L1: ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGA GCCGCCATAGTA L2: TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTA TGGCGGCTCTTCTTTTTAATCCGTCGAGCAGAGTT L3: TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCG AGGGTCCAATACTTTTT/iBHQ2dT/TGCACCCTAACCCTAACCCT L4: TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTG GACCCTCGCAT MB: Cy3-AACGATTAGGGTTAGGGTCGTT-Cy5 |
telomerase | 50 - 2000 HeLa cells | 35 HeLa cells | [77] |
| Prevention of AuNPs aggregation by aptamer | CCGATCTCTCCCACTCTCTCCAACTCACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGGGTGTGTTGTTGATGGATCGGATCATCATGGTGAT | platelet-derived growth factor (PDGF) | 0.01–10 μg/ml | 0.01 μg/ml | [78] |
| Gold chip modified with CA125 aptamer through streptavidin–biotin | CTC ACT ATA GGG AGA CAA GAA TAA ACG CTC AA-biotin | Mucin 16 (MUC16) or cancer antigen 125 (CA125) | 10–100 U/mL |
0.01 U/mL |
[79] |
| Magnetic glass carbon electrode (MGCE)/α-Fe2O3/Fe3O4/Au/complementary strand/aptamer | Complementary strand: SH-TTTTTTTTTTTTTTTTTTTTCCCTATAGTGAG Aptamer: CTCACTATAGGGAGACAAGAATAAACGCTCAA |
cancer antigen 125 (CA125) | 5–125 U/mL | 2.99 U/mL | [80] |
| CRISPR/Cas12a + RPA + electrochemistry (Modified electrode with complementary 1 (CP1) and MB /Fe3O4@COF/PdAu modified with complementary 2 (CP2)) | crRNA template: AAGTACCCAGCAGTTTGGCCCGCCATCTACACTTAGTAGAAATTCCtatagtgagtcgtattag CP1: SH-ACACTTGAAGTGTATTTCCTAAATA CP2: AATTGCAAGTATGTAGAAGTTCACA-SH Synthetic target: ATGTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCG |
ctDNA EGFR L858R | 10 aM –100 pM | 3.3 aM | [81] |
| Microfluidic system incorporated with screen-printed gold electrode was modified with integrin α6β4-specific aptamer (IDA) | GCCTGTTGTGAGCCTCCTAACCGTGCGTATTCGTACTGGAACTGATATCGATGTCCCCATGCTTATTCTTGTCTCCC–SH | α6β4 integrin on A549 cells |
50–5 × 105 cells/mL | 14 cells/mL | [82] |
| Lateral flow assay (LFA) with streptavidin (SA)-biotin-CD63 aptamer on T-line | CD63 aptamer: 5′-GTGGGGTGGACGAGGGCACGTGATTACGTA-3′ complement aptamer: CACCCCACCTCGCTCCCGTGACACTAATGCTA -Biotin |
CD63 on the non-small cell lung cancer (NSCLC) | - | 6.4 × 109 particles/mL | [83] |
| Smartphone control of emission from gold nanoclusters (GNCs)-aptamer as emitter and polyurethane (PU) - coated with GO as quencher | SH-CCCCCCGATCCTTTGGATA | Mucin 1 (MUC1) | 250–20,000 cells /mL | 221 cells /mL |
[84] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.