Submitted:
29 August 2023
Posted:
30 August 2023
You are already at the latest version
Abstract
Keywords:
Introduction
2. Materials and Methods
2.1. Sampling and Treatments
2.2. DNA Extraction and Sequencing
2.3. Assembly and Annotation
2.4. Molecular Phylogenetic Analyses
2.5. RT-qPCR
3. Results
3.1. Genome Organization and Gene Arrangement
3.2. ATP8 Annotation
3.3. Long non-coding RNA
3.4. Gene Expression of P. megacephalus under Low-Temperature Stress
3.5. The genetic distances and phylogenetic relationships of Polypedates
4. Discussion
4.1. Gene Rearrangements and Rearrangement Mechanisms
4.2. Possible Causes for Misdiagnosis of a “single” ND5 Gene
4.3. Long non-coding RNA
4.4. Reviving the Lost ATP8 Gene in Polypedates
4.5. Transcriptional Levels of Mitochondrial Genes
4.6. Correlations Between Phylogenetic Relationships and Gene Rearrangements
5. Conclusion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Amphibian Species of the World: An Online Reference (Version 6). Reference Reviews 2014, 28, 32–32. [CrossRef]
- Yuan, L.M.; Deng, X.L.; Jiang, D.C.; Klaus, S.; Orlov, N.L.; Yang, K.; Li, J.T. Geographical range evolution of the genus Polypedates (Anura: Rhacophoridae) from the Oligocene to present. Zoological Research 2021, 42, 116. [Google Scholar] [CrossRef] [PubMed]
- Chong, R.A.; Mueller, R.L. Low metabolic rates in salamanders are correlated with weak selective constraints on mitochondrial genes. Evolution 2013, 67, 894–899. [Google Scholar] [CrossRef] [PubMed]
- Teets, N.M.; Dalrymple, E.G.; Hillis, M.H.; Gantz, J.D.; Spacht, D.E.; Lee, R.E.; Denlinger, D.L. Changes in energy reserves and gene expression elicited by freezing and supercooling in the Antarctic midge. Insects 2020, 11, 18. [Google Scholar] [CrossRef]
- Ramirez, L.; Luna, F.; Mucci, C.A.; Lamattina, L. Fast weight recovery, metabolic rate adjustment and gene-expression regulation define responses of cold-stressed honey bee brood. J. Insect Physiol. 2021, 128, 104178. [Google Scholar] [CrossRef]
- Rider, M.H.; Hussain, N.; Dilworth, S.M.; Storey, J.M.; Storey, K.B. AMP-activated protein kinase and metabolic regulation in cold-hardy insects. J. Insect Physiol. 2011, 57, 1453–1462. [Google Scholar] [CrossRef]
- Colinet, H.; Nguyen, T.T.A.; Cloutier, C.; Michaud, D.; Hance, T. Proteomic profiling of a parasitic wasp exposed to constant and fluctuating cold exposure. Insect Biochem. Mol. Biol. 2007, 37, 1177–1188. [Google Scholar] [CrossRef]
- Joanisse, D.R.; Storey, K.B. Mitochondrial enzymes during overwintering in two species of cold-hardy gall insects. Insect Biochem. Mol. Biol. 1994, 24, 145–150. [Google Scholar] [CrossRef]
- Storey, J.M.; Wu, S.; Storey, K.B. Mitochondria and the Frozen Frog. Antioxidants 2021, 10, 543. [Google Scholar] [CrossRef]
- Jin, W.T.; Guan, J.Y.; Dai, X.Y.; Wu, G.J.; Zhang, L.P.; Storey, K.B.; Zhang, J.Y.; Zheng, R.Q.; Yu, D.N. Mitochondrial gene expression in different organs of Hoplobatrachus rugulosus from China and Thailand under low-temperature stress. BMC Zoology 2022, 7, 1–14. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Luu, B.E.; Yu, D.N.; Zhang, L.P.; Al-attar, R.; Storey, K.B. The complete mitochondrial genome of Dryophytes versicolor: Phylogenetic relationship among Hylidae and mitochondrial protein-coding gene expression in response to freezing and anoxia. Int. J. Biol. Macromol. 2019, 132, 461–469. [Google Scholar] [CrossRef]
- Cai, Q.; Storey, K.B. Anoxia-Induced Gene Expression in Turtle Heart. Eur. J. Biochem. 1996, 241, 83–92. [Google Scholar] [CrossRef]
- Shadel, G.S.; Clayton, D.A. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 1997, 66, 409–435. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Zhang, L.P.; Yu, D.N.; Storey, K.B.; Zheng, R.Q. Complete mitochondrial genomes of Nanorana taihangnica and N. yunnanensis (Anura: Dicroglossidae) with novel gene arrangements and phylogenetic relationship of Dicroglossidae. BMC Evol. Biol. 2018, 18, 1–13. [Google Scholar] [CrossRef]
- Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Research 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [PubMed]
- Arndt, A.; Smith, M.J. Mitochondrial gene rearrangement in the sea cucumber genus Cucumaria. Mol. Biol. Evol. 1998, 15, 1009–1016. [Google Scholar] [CrossRef] [PubMed]
- Levinson, G.; Gutman, G.A. Slipped-strand mispairing: a major mechanism for DNA sequence evolution. Mol. Biol. Evol. 1987, 4, 203–221. [Google Scholar] [PubMed]
- Sano, N.; Kurabayashi, A.; Fujii, T.; Yonekawa, H.; Sumida, M. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the bell-ring frog, Buergeria buergeri (family Rhacophoridae). Genes Genet. Syst. 2004, 79, 151–163. [Google Scholar] [CrossRef] [PubMed]
- Huang, M.; Lv, T.; Duan, R.; Zhang, S.; Li, H. The complete mitochondrial genome of Rhacophorus dennysi (Anura: Rhacophoridae) and phylogenetic analysis. Mitochondrial DNA Part A 2016, 27, 3719–3720. [Google Scholar] [CrossRef]
- Sano, N.; Kurabayashi, A.; Fujii, T.; Yonekawa, H.; Sumida, M. Complete nucleotide sequence of the mitochondrial genome of Schlegel’s tree frog Rhacophorus schlegelii (family Rhacophoridae): duplicated control regions and gene rearrangements. Genes Genet. Syst. 2005, 80, 213–224. [Google Scholar] [CrossRef]
- Cui, L.; Huang, A.; He, Z.; Ao, L.; Ge, F.; Fan, X.; Zeng, B.; Yang, M.; Yang, D.; Ni, Q. et al. Complete mitogenomes of Polypedates tree frogs unveil gene rearrangement and concerted evolution within Rhacophoridae. Animals 2022, 12, 2449. [Google Scholar] [CrossRef]
- Liu, Y.; Yang, M.; Jiang, Y.; Han, F.; Li, Y.; Ni, Q.; Yao, Y.; Xu, H.; Zhang, M. The near complete mitochondrial genome of white-lipped treefrog, Polypedates braueri (Anura, Rhacophoridae). Mitochondrial DNA Part A 2017, 28, 271–272. [Google Scholar] [CrossRef]
- Zhang, P.; Zhou, H.; Liang, D.; Liu, Y.F.; Chen, Y.Q.; Qu, L.H. The complete mitochondrial genome of a tree frog, Polypedates megacephalus (Amphibia: Anura: Rhacophoridae), and a novel gene organization in living amphibians. Gene 2005, 346, 133–143. [Google Scholar] [CrossRef] [PubMed]
- Huang, A.; Liu, S.; Li, H.; Luo, H.; Ni, Q.; Yao, Y.; Xu, H.; Zeng, B.; Li, Y.; Wei, Z. et al. The revised complete mitogenome sequence of the tree frog Polypedates megacephalus (Anura, Rhacophoridae) by next-generation sequencing and phylogenetic analysis. PeerJ 2019, 7, e7415. [Google Scholar] [CrossRef] [PubMed]
- Inagaki, H.; Haramoto, Y.; Kubota, H.Y.; Shigeri, Y. Complete mitochondrial genome sequence of Japanese forest green tree frog (Rhacophorus arboreus). Mitochondrial DNA Part B 2020, 5, 3347–3348. [Google Scholar] [CrossRef]
- Kurabayashi, A.; Usuki, C.; Mikami, N.; Fujii, T.; Yonekawa, H.; Sumida, M.; Hasegawa, M. Complete nucleotide sequence of the mitochondrial genome of a Malagasy poison frog Mantella madagascariensis: evolutionary implications on mitochondrial genomes of higher anuran groups. Mol. Phylogenet. Evol. 2006, 39, 223–236. [Google Scholar] [CrossRef] [PubMed]
- Kurabayashi, A.; Sumida, M.; Yonekawa, H.; Glaw, F.; Vences, M.; Hasegawa, M. Phylogeny, recombination, and mechanisms of stepwise mitochondrial genome reorganization in mantellid frogs from Madagascar. Mol. Biol. Evol. 2008, 25, 874–891. [Google Scholar] [CrossRef]
- Alam, M.S.; Kurabayashi, A.; Hayashi, Y.; Sano, N.; Khan, M.M.R.; Fujii, T.; Sumida, M. Complete mitochondrial genomes and novel gene rearrangements in two dicroglossid frogs, Hoplobatrachus tigerinus and Euphlyctis hexadactylus, from Bangladesh. Genes Genet. Syst. 2010, 85, 219–232. [Google Scholar] [CrossRef] [PubMed]
- Yu, D.; Zhang, J.; Zheng, R.; Shao, C. The complete mitochondrial genome of Hoplobatrachus rugulosus (Anura: Dicroglossidae). Mitochondrial DNA 2012, 23, 336–337. [Google Scholar] [CrossRef]
- Zheng, C.; Nie, L.; Wang, J.; Zhou, H.; Hou, H.; Wang, H.; Liu, J. Recombination and evolution of duplicate control regions in the mitochondrial genome of the Asian big-headed turtle. PLoS one 2013, 8, e82854. [Google Scholar] [CrossRef]
- Eberhard, J.R.; Wright, T.F.; Bermingham, E. Duplication and concerted evolution of the mitochondrial control region in the parrot genus Amazona. Mol. Biol. Evol. 2001, 18, 1330–1342. [Google Scholar] [CrossRef]
- Kumazawa, Y.; Ota, H.; Nishida, M.; Ozawa, T. Gene rearrangements in snake mitochondrial genomes: highly concerted evolution of control-region-like sequences duplicated and inserted into a tRNA gene cluster. Mol. Biol. Evol. 1996, 13, 1242–1254. [Google Scholar] [CrossRef] [PubMed]
- Inoue, J.G.; Miya, M.; Tsukamoto, K.; Nishida, M. Evolution of the deep-sea gulper eel mitochondrial genomes: large-scale gene rearrangements originated within the eels. Mol. Biol. Evol. 2003, 20, 1917–1924. [Google Scholar] [CrossRef] [PubMed]
- Akiyama, T.; Nishida, C.; Momose, K.; Onuma, M.; Takami, K.; Masuda, R. Gene duplication and concerted evolution of mitochondrial DNA in crane species. Mol. Phylogenet. Evol. 2017, 106, 158–163. [Google Scholar] [CrossRef] [PubMed]
- Saraste, M. Oxidative phosphorylation at the fin de siècle. Science 1999, 283, 1488–1493. [Google Scholar] [CrossRef]
- Hahn, A.; Parey, K.; Bublitz, M.; Mills, Deryck J. ; Zickermann, V.; Vonck, J.; Kühlbrandt, W.; Meier, T. Structure of a complete ATP synthase dimer reveals the molecular basis of inner mitochondrial membrane morphology. Mol. Cell 2016, 63, 445–456. [Google Scholar] [CrossRef] [PubMed]
- Dautant, A.; Meier, T.; Hahn, A.; Tribouillard-Tanvier, D.; di Rago, J.P.; Kucharczyk, R. ATP synthase diseases of mitochondrial genetic origin. Frontiers in Physiology 2018, 9, 329. [Google Scholar] [CrossRef]
- Gissi, C.; Iannelli, F.; Pesole, G. Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity 2008, 101, 301–320. [Google Scholar] [CrossRef]
- Uliano-Silva, M.; Americo, J.A.; Costa, I.; Schomaker-Bastos, A.; de Freitas Rebelo, M.; Prosdocimi, F. The complete mitochondrial genome of the golden mussel Limnoperna fortunei and comparative mitogenomics of Mytilidae. Gene 2016, 577, 202–208. [Google Scholar] [CrossRef]
- Steinauer, M.L.; Nickol, B.B.; Broughton, R.; Ortí, G. First sequenced mitochondrial genome from the phylum Acanthocephala (Leptorhynchoides thecatus) and its phylogenetic position within Metazoa. J. Mol. Evol. 2005, 60, 706–715. [Google Scholar] [CrossRef]
- Suga, K.; Mark Welch, D.B.; Tanaka, Y.; Sakakura, Y.; Hagiwara, A. Two circular chromosomes of unequal copy number make up the mitochondrial genome of the rotifer Brachionus plicatilis. Mol. Biol. Evol. 2008, 25, 1129–1137. [Google Scholar] [CrossRef]
- Lavrov, D.V.; Brown, W.M. Trichinella spiralis mtDNA: a nematode mitochondrial genome that encodes a putative ATP8 and normally structured tRNAs and has a gene arrangement relatable to those of coelomate metazoans. Genetics 2001, 157, 621–637. [Google Scholar] [CrossRef] [PubMed]
- Egger, B.; Bachmann, L.; Fromm, B. Atp8 is in the ground pattern of flatworm mitochondrial genomes. BMC Genomics 2017, 18, 414. [Google Scholar] [CrossRef]
- Monnens, M.; Thijs, S.; Briscoe, A.G.; Clark, M.; Frost, E.J.; Littlewood, D.T.J.; Sewell, M.; Smeets, K.; Artois, T.; Vanhove, M.P.M. The first mitochondrial genomes of endosymbiotic rhabdocoels illustrate evolutionary relaxation of atp8 and genome plasticity in flatworms. Int. J. Biol. Macromol. 2020, 162, 454–469. [Google Scholar] [CrossRef] [PubMed]
- Zhang, P.; Liang, D.; Mao, R.L.; Hillis, D.M.; Wake, D.B.; Cannatella, D.C. Efficient sequencing of anuran mtDNAs and a mitogenomic exploration of the phylogeny and evolution of frogs. Mol. Biol. Evol. 2013, 30, 1899–1915. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.Y.; Shen, S.Q.; Lu, L.X.; Storey, K.B.; Yu, D.-N.; Zhang, J.Y. The complete mitochondrial genome of Pyxicephalus adspersus: high gene rearrangement and phylogenetics of one of the world’s largest frogs. PeerJ 2019, 7, e7532. [Google Scholar] [CrossRef]
- Burland, T.G. DNASTAR’s Lasergene Sequence Analysis Software. In Bioinformatics Methods and Protocols; Misener, S., Krawetz, S. A., Eds.; Humana Press: Totowa, NJ, 1999; pp. 71–91. [Google Scholar]
- Lowe, T.M.; Chan, P.P. tRNAscan-SE On-line: integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016, 44, W54–W57. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Letunic, I.; Doerks, T.; Bork, P. SMART: recent updates, new developments and status in 2015. Nucleic Acids Res 2014, 43, D257–D260. [Google Scholar] [CrossRef] [PubMed]
- Wilkins, M.R.; Gasteiger, E.; Bairoch, A.; Sanchez, J.C.; Williams, K.L.; Appel, R.D.; Hochstrasser, D.F. Protein Identification and Analysis Tools in the ExPASy Server. In 2-D Proteome Analysis Protocols; Link, A. J., Ed.; Humana Press: Totowa, NJ, 1999; pp. 531–552. [Google Scholar]
- Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Žídek, A.; Potapenko, A. et al. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583–589. [Google Scholar] [CrossRef]
- Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T. The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics 2005, 22, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Benson, G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour 2020, 20, 348–355. [Google Scholar] [CrossRef]
- Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol. Biol. Evol. 2016, 34, 772–773. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [PubMed]
- Lalitha, S. Primer Premier 5. Biotech. Softw. Internet Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef]
- Macey, J.R.; Larson, A.; Ananjeva, N.B.; Fang, Z.; Papenfuss, T.J. Two novel gene orders and the role of light-strand replication in rearrangement of the vertebrate mitochondrial genome. Mol. Biol. Evol. 1997, 14, 91–104. [Google Scholar] [CrossRef]
- Lavrov, D.V.; Boore, J.L.; Brown, W.M. Complete mtDNA Sequences of Two Millipedes Suggest a New Model for Mitochondrial Gene Rearrangements: Duplication and Nonrandom Loss. Mol. Biol. Evol. 2002, 19, 163–169. [Google Scholar] [CrossRef]
- Yu, D.; Zhang, J.; Li, P.; Zheng, R.; Shao, C. Do Cryptic Species Exist in Hoplobatrachus rugulosus? An Examination Using Four Nuclear Genes, the Cyt b Gene and the Complete MT Genome. PLOS ONE 2015, 10, e0124825. [Google Scholar] [CrossRef]
- Boore, J.L.; Brown, W.M. Big trees from little genomes: mitochondrial gene order as a phylogenetic tool. Curr. Opin. Genet. Dev. 1998, 8, 668–674. [Google Scholar] [CrossRef] [PubMed]
- Moritz, C.; Brown, W.M. Tandem Duplication of D-Loop and Ribosomal RNA Sequences in Lizard Mitochondrial DNA. Science 1986, 233, 1425–1427. [Google Scholar] [CrossRef] [PubMed]
- Wu, N.; Liu, J.; Wang, S.; Guo, X. Comparative Analysis of Mitochondrial Genomes in Two Subspecies of the Sunwatcher Toad-Headed Agama (Phrynocephalus helioscopus): Prevalent Intraspecific Gene Rearrangements in Phrynocephalus. Genes 2022, 13, 203. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.M.; Prendini, E.; Wu, Y.H.; Zhang, B.L.; Suwannapoom, C.; Chen, H.M.; Jin, J.Q.; Lemmon, E.M.; Lemmon, A.R.; Stuart, B.L.; Raxworthy, C.J.; Murphy, R.W.; Yuan, Z.Y.; Che, J. An integrative phylogenomic approach illuminates the evolutionary history of Old World tree frogs (Anura: Rhacophoridae). Mol. Phylogenet. Evol. 2020, 145, 106724. [Google Scholar] [CrossRef]
- Li, J.T.; Li, Y.; Klaus, S.; Rao, D.Q.; Hillis, D.M.; Zhang, Y.P. Diversification of rhacophorid frogs provides evidence for accelerated faunal exchange between India and Eurasia during the Oligocene. Proc. Natl. Acad. Sci. U.S.A. 2013, 110, 3441–3446. [Google Scholar] [CrossRef]
- Excoffier, L. Evolution of human mitochondrial DNA: Evidence for departure from a pure neutral model of populations at equilibrium. J. Mol. Evol. 1990, 30, 125–139. [Google Scholar] [CrossRef]
- Mattick, J.S.; Amaral, P.P.; Carninci, P.; Carpenter, S.; Chang, H.Y.; Chen, L.L.; Chen, R.; Dean, C.; Dinger, M.E.; Fitzgerald, K.A. et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat. Rev. Mol. Cell Biol. 2023. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Sun, L.; Wang, R.R.; Hu, J.F.; Cui, J. The effects of mitochondria-associated long noncoding RNAs in cancer mitochondria: New players in an old arena. Crit Rev Oncol Hemat 2018, 131, 76–82. [Google Scholar] [CrossRef]
- Gao, S.; Tian, X.; Chang, H.; Sun, Y.; Wu, Z.; Cheng, Z.; Dong, P.; Zhao, Q.; Ruan, J.; Bu, W. Two novel lncRNAs discovered in human mitochondrial DNA using PacBio full-length transcriptome data. Mitochondrion 2018, 38, 41–47. [Google Scholar] [CrossRef]
- Gray, M.W. Evolution of organellar genomes. Curr Opin Genet Dev 1999, 9, 678–687. [Google Scholar] [CrossRef]
- Rosa, M.T.; Oliveira, D.S.; Loreto, E.L.S. Characterization of the first mitochondrial genome of a catenulid flatworm: Stenostomum leucops (Platyhelminthes). J Zool Syst Evol Res 2017, 55, 98–105. [Google Scholar] [CrossRef]
- Lubośny, M.; Przyłucka, A.; Śmietanka, B.; Breton, S.; Burzyński, A. Actively transcribed and expressed atp8 gene in Mytilus edulis mussels. PeerJ 2018, 6, e4897. [Google Scholar] [CrossRef]
- He, J.; Ford, H.C.; Carroll, J.; Douglas, C.; Gonzales, E.; Ding, S.; Fearnley, I.M.; Walker, J.E. Assembly of the membrane domain of ATP synthase in human mitochondria. Pnas 2018, 115, 2988–2993. [Google Scholar] [CrossRef]
- Fearnley, I.M.; Walker, J.E. Two overlapping genes in bovine mitochondrial DNA encode membrane components of ATP synthase. Embo J 1986, 5, 2003–2008. [Google Scholar] [CrossRef]
- Zardoya, R.; Pérez-Martos, A.; Bautista, J.M.; Montoya, J. Analysis of the transcription products of the rainbow trout (Oncorynchus mykiss) liver mitochondrial genome: detection of novel mitochondrial transcripts. Curr. Genet. 1995, 28, 67–70. [Google Scholar] [CrossRef] [PubMed]
- Cruz-Zaragoza, L.D.; Dennerlein, S.; Linden, A.; Yousefi, R.; Lavdovskaia, E.; Aich, A.; Falk, R.R.; Gomkale, R.; Schöndorf, T.; Bohnsack, M.T.; Richter-Dennerlein, R.; Urlaub, H.; Rehling, P. An in vitro system to silence mitochondrial gene expression. Cell 2021, 184, 5824–5837. [Google Scholar] [CrossRef] [PubMed]
- Ghiselli, F.; Gomes-dos-Santos, A.; Adema, C.M.; Lopes-Lima, M.; Sharbrough, J.; Boore, J.L. Molluscan mitochondrial genomes break the rules. Philos. Trans. R. Soc. B 2021, 376, 20200159. [Google Scholar] [CrossRef] [PubMed]
- Gan, H.M.; Grandjean, F.; Jenkins, T.L.; Austin, C.M. Absence of evidence is not evidence of absence: Nanopore sequencing and complete assembly of the European lobster (Homarus gammarus) mitogenome uncovers the missing nad2 and a new major gene cluster duplication. BMC Genomics 2019, 20, 335. [Google Scholar] [CrossRef]
- Niu, Y.; Cao, W.; Storey, K.B.; He, J.; Wang, J.; Zhang, T.; Tang, X.; Chen, Q. Metabolic characteristics of overwintering by the high-altitude dwelling Xizang plateau frog, Nanorana parkeri. J Comp Physiol B 2020, 190, 433–444. [Google Scholar] [CrossRef]
- Kadenbach, B.; Hüttemann, M. The subunit composition and function of mammalian cytochrome c oxidase. Mitochondrion 2015, 24, 64–76. [Google Scholar] [CrossRef] [PubMed]
- McMullen, D.C.; Storey, K.B. Suppression of Na+K+-ATPase activity by reversible phosphorylation over the winter in a freeze-tolerant insect. J Insect Physiol 2008, 54, 1023–1027. [Google Scholar] [CrossRef] [PubMed]
- Bourens, M.; Boulet, A.; Leary, S.C.; Barrientos, A. Human COX20 cooperates with SCO1 and SCO2 to mature COX2 and promote the assembly of cytochrome c oxidase. Hum Mol Genet 2014, 23, 2901–2913. [Google Scholar] [CrossRef] [PubMed]
- Pan, S.; Dang, N.; Wang, J.; Zheng, Y.; Rao, D.; Li, J. Molecular Phylogeny Supports the Validity of Polypedates impresus Yang 2008. Asian Herpetol Res 2013, 4, 124–133. [Google Scholar] [CrossRef]
- Kuraishi, N.; Matsui, M.; Hamidy, A.; Belabut, D.M.; Ahmad, N.; Panha, S.; Sudin, A.; Yong, H.S.; Jiang, J.P.; Ota, H.; Thong, H.T.; Nishikawa, K. Phylogenetic and taxonomic relationships of the Polypedates leucomystax complex (Amphibia). Zool. Scr. 2013, 42, 54–70. [Google Scholar] [CrossRef]
- Buddhachat, K.; Suwannapoom, C. Phylogenetic relationships and genetic diversity of the Polypedates leucomystax complex in Thailand. PeerJ 2018, 6, e4263. [Google Scholar] [CrossRef]
- Brown, R.M.; Linkem, C.W.; Siler, C.D.; Sukumaran, J.; Esselstyn, J.A.; Diesmos, A.C.; Iskandar, D.T.; Bickford, D.; Evans, B.J.; McGuire, J.A.; Grismer, L.; Supriatna, J.; Andayani, N. Phylogeography and historical demography of Polypedates leucomystax in the islands of Indonesia and the Philippines: Evidence for recent human-mediated range expansion? Mol. Phylogenet. Evol. 2010, 57, 598–619. [Google Scholar] [CrossRef] [PubMed]








| PCR Fragments | Primer Names | Primer Sequence(5’ - 3’) | Length of Fragments | Annealing Temperature |
| F1 | Cytb501-J | GGCTTCTCAGTYGAYAATGC | ~3,400 bp | 51 ℃ |
| ND51040-N | TTYCGAATGTCYTGTTCATC | |||
| F2 | ND51308-J | MTCAACYATATCCGCTGTRR | ~3,300 bp | 50 ℃ |
| ND51038-N | YCGAATGTCYTGTTCATCAT | |||
| F3 | ND5520-J | TAGTAATCTTTTGCTGRGC | ~3,300 bp | 50 ℃ |
| ND5219-N | ATAGGAGGGAGTAGGTGTC | |||
| F4 | ND5800-J | TATGCTTAGGTGCTCTATCC | ~4,100 bp | 50 ℃ |
| Pro184-N | GAGTCAGTGGAAGAGGTTAA |
| Gene name | Forward primers (5’-3’) | Reverse primers (5’-3’) |
|---|---|---|
| ND1 | GDBT-ND1-J1 TGCCCTTATTGGTTCTTTAC |
GDBT-ND1-N1 AAGATGGACAGTGTGAAGCC |
| ND2 | GDBT-ND2-J1 ACTGACCTCAACACACGC |
GDBT-ND2-N1 GGTAAGAGGTGGGAGGC |
| ND3 | GDBT-ND3-J1 TTCTGGCTGGCAACTCTG |
GDBT-ND3-N1 TACAAGGAAGAAGCGTATGGA |
| ND4 | GDBT-ND4-J1 GGGCTACGGCATCTTACG |
GDBT-ND4-N1 GGCAGAGCAGGGCTGTTAT |
| ND4L | GDBT-ND4L-J1 GGCTCACCGAATACACTTACTT |
GDBT-ND4L-N1 TGGGCAAAGGCTTAGGG |
| ND5 | GDBT-ND5-J1 ACCGAATTGGAGACATTGGATT |
GDBT-ND5-N1 GCAAGGATGAAGGCTATGAGAA |
| ND6 | GDBT-ND6-J1 CGTCCAATCCGTCTCCGTT |
GDBT-ND6-N1 GCAACCAGAGCTGAACAGTAAG |
| ND6AS | GDBT-ND6AS-J1 GCTGAACAGTAAGCAAACACA |
GDBT-ND6AS-N1 TGGGTTTAGTGTGAGGTGC |
| COI | GDBT-COI-J1 CTACAAACTCCACGCTG |
GDBT-COI-N1 GCGTCTGGGTAGTCTGAGTA |
| COII | GDBT-COII-J1 CAGGGCGGCTCACTCAA |
GDBT-COII-N1 ATCGGTAGGGCTTCAAC |
| COIII | GDBT-COIII-J1 GGTCCTATTAGCCTCTGGG |
GDBT-COIII-N1 TCGTAATACTCCATCGCTTG |
| ATP6 | GDBT-ATP6-J1 ACAACCCAACTGCCACTAA |
GDBT-ATP6-N1 GGGTGTGCCTTCTGGTAG |
| Cytb | GDBT-CYTB-J1 GACTGCTCCGTAATCTCCA |
GDBT-CYTB-N1 AAATAGGAGAATAACACCGATG |
| ATP8 | GDBT-ATP8-J1 CATTCACGTAGCCCTATGAGC |
GDBT-ATP8-N1 GTGATATTGTGCGGTACAGTGT |
| ATP86 | GDBT-ATP86-J1 ACACTGTACCGCACAATATCA |
GDBT-ATP86-N1 GGGTTGGTGATGTAAATTGACT |
| LC-I | LC-I-J1 TTGCTTACTAAACTGCTGAG |
LC-I-N1 GCGTATTATGATTCACAGGT |
| LC-II | LC-II-J1 CATAATACGCCCGTGGAC |
LC-II-N1 AGAGCCGCACTCATTGGT |
| LC-III | LC-III-J1 AAGTGGCAAGTGCAACAATCA |
LC-III-N1 GGCTCCGAGTGGATAAGAGG |
| LC-IV | LC-IV-J1 CCCACTTAATACCCTCTTATCC |
LC-IV-N1 CGCTTGGTGAATAATCAGTTG |
| LC-V | LC-V-J1 GCAACTGATTATTCACCAAG |
LC-V-N1 GGTGATTAGAGTTGTGGGAT |
| ACTIN | GDBT-ACTIN-J1 CATCAGGCAACTCGTAGC |
GDBT-ACTIN-N1 GCGTGACATCAAGGAGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).