Submitted:
19 June 2023
Posted:
19 June 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Preparation of soybean enzymatic hydrolysate
2.2. Animals
2.3. Experimental groups
2.4. Induction of colonic inflammation
2.5. Evaluation of biomarkers in serum and colon tissue
2.6. Histology
2.7. Cell culture and viability
2.8. Evaluation of biomarkers in RAW264.7 cells
2.9. Gut microbiome analysis using next-generation sequencing
2.10. Statistical analysis
3. Results
3.1. Effect of EHG on DSS-induced colitis
3.2. Effects of EHG on colonic histological damage and mucin in mice with DSS-induced colitis
3.3. Effect of EHG on DSS-induced pro-inflammatory cytokine production
3.4. Effects of EHG on iNOS and COX-2 expression and the NF-κB signaling pathway in mice with DSS-induced colitis
3.5. Effects of EHG on intestinal barrier function in mice with DSS-induced colitis
3.6. Effect of EHG on microbiome diversity in mice with DSS-induced colitis
| Taxon name | Taxon rank | LDA effect size | N | NC | EHG |
|---|---|---|---|---|---|
| Proteobacteria | Phylum | 5.05 | 1.27 | 24.36 | 6.22 |
| Clostridia | Class | 5.18 | 40.06 | 8.07 | 16.20 |
| Bacilli | Class | 5.11 | 6.11 | 33.34 | 23.43 |
| Gammaproteobacteria | Class | 5.07 | 0.03 | 24.10 | 5.41 |
| Clostridiales | Order | 5.18 | 40.06 | 8.07 | 16.20 |
| Lactobacillales | Order | 5.08 | 6.06 | 31.63 | 21.69 |
| Enterobacterales | Order | 5.07 | 0.03 | 24.08 | 5.35 |
| Muribaculaceae | Family | 5.13 | 33.74 | 6.68 | 17.51 |
| Enterobacteriaceae | Family | 5.07 | 0.03 | 24.02 | 5.34 |
| Lactobacillaceae | Family | 4.99 | 6.05 | 26.58 | 21.12 |
| Bacteroidaceae | Family | 4.98 | 11.41 | 24.69 | 31.33 |
| Escherichia | Genus | 5.07 | 0.03 | 22.78 | 5.16 |
| Lactobacillus | Genus | 0.03 | 22.78 | 22.78 | 21.12 |
| Escherichia coli group | Species | 5.07 | 0.03 | 22.78 | 5.15 |
| Lactobacillus murinus group | Species | 4.98 | 5.55 | 24.23 | 20.27 |
3.7. Anti-inflammatory effect of EHG on LPS-induced RAW264.7 cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cruz-Casas, D.E.; Aguilar, C.N.; Ascacio-Valdés, J.A.; Rodríguez-Herrera, R.; Chávez-González, M.L.; Flores-Gallegos, A.C. Enzymatic hydrolysis and microbial fermentation: The most favorable biotechnological methods for the release of bioactive peptides. Food Chem (Oxf). 2021, 3, 100047. [Google Scholar] [CrossRef]
- Chakrabarti, S.; Guha, S.; Majumder, K. Food-derived bioactive peptides in human health: Challenges and opportunities. Nutrients. 2018, 10. [Google Scholar] [CrossRef]
- Ramdath, D.D.; Padhi, E.M.; Sarfaraz, S.; Renwick, S.; Duncan, A.M. Beyond the cholesterol-lowering effect of soy protein: A review of the effects of dietary soy and its constituents on risk factors for cardiovascular disease. Nutrients. 2017, 9. [Google Scholar] [CrossRef] [PubMed]
- Hirano, T. IL-6 in inflammation, autoimmunity and cancer. Int Immunol. 2021, 33, 127–148. [Google Scholar] [CrossRef] [PubMed]
- Chassaing, B.; Aitken, J.D.; Malleshappa, M.; Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr Protoc Immunol. 2014, 104, 15 25 11-15 25. [Google Scholar] [CrossRef] [PubMed]
- Kim, I.S.; Yang, W.S.; Kim, C.H. Beneficial effects of soybean-derived bioactive peptides. Int J Mol Sci. 2021, 22. [Google Scholar] [CrossRef]
- Messina, M. Soy and health update: Evaluation of the clinical and epidemiologic literature. Nutrients. 2016, 8. [Google Scholar] [CrossRef]
- Yeom, J.E.; Kim, S.K.; Park, S.Y. Regulation of the gut microbiota and inflammation by beta-caryophyllene extracted from cloves in a dextran sulfate sodium-induced colitis mouse model. Molecules. 2022, 27. [Google Scholar] [CrossRef] [PubMed]
- Heo, S.; Kim, J.H.; Kwak, M.S.; Sung, M.H.; Jeong, D.W. Functional annotation genome unravels potential probiotic Bacillus velezensis Strain KMU01 from traditional Korean fermented kimchi. Foods. 2021, 10. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.J.; Cho, H.E.; Park, H.J. Germinated black soybean fermented with Lactobacillus pentosus SC65 alleviates DNFB-induced delayed-type hypersensitivity in C57BL/6N mice. J Ethnopharmacol. 2021, 265, 113236. [Google Scholar] [CrossRef]
- Fan, H.; Bhullar, K.S.; Wang, Z.; Wu, J. Soybean-derived tripeptide Leu–Ser–Trp (LSW) protects human vascular endothelial cells from TNFalpha-induced oxidative stress and inflammation via modulating TNFalpha receptors and SIRT1. Foods. 2022, 11. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.J.; Jeong, S.J.; Ryu, M.S.; Ha, G.; Jeong, D.Y.; Park, Y.M.; Lee, H.Y.; Bae, J.S. Protective effect of traditional Korean fermented soybean foods (doenjang) on a dextran sulfate sodium-induced colitis mouse model. Food Funct. 2022, 13, 8616–8626. [Google Scholar] [CrossRef] [PubMed]
- Lim, H.J.; Park, I.S.; Jeong, S.J.; Ha, G.S.; Yang, H.J.; Jeong, D.Y.; Kim, S.Y.; Jung, C.H. Effects of cheonggukjang (fermented soybean) on the development of colitis-associated colorectal cancer in mice. Foods. 2023, 12. [Google Scholar] [CrossRef]
- Perler, B.K.; Ungaro, R.; Baird, G.; Mallette, M.; Bright, R.; Shah, S.; Shapiro, J.; Sands, B.E. Presenting symptoms in inflammatory bowel disease: Descriptive analysis of a community-based inception cohort. BMC Gastroenterol. 2019, 19, 47. [Google Scholar] [CrossRef] [PubMed]
- Hunter, T.; Naegeli, A.N.; Nguyen, C.; Shan, M.; Smith, J.L.; Tan, H.; Gottlieb, K.; Isenberg, K. Medication use among patients with Crohn’s disease or ulcerative colitis before and after the initiation of advanced therapy. BMC Gastroenterol. 2022, 22, 474. [Google Scholar] [CrossRef]
- Guo, B.J.; Bian, Z.X.; Qiu, H.C.; Wang, Y.T.; Wang, Y. Biological and clinical implications of herbal medicine and natural products for the treatment of inflammatory bowel disease. Ann N Y Acad Sci. 2017, 1401, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Bilsborough, J.; Fiorino, M.F.; Henkle, B.W. Select animal models of colitis and their value in predicting clinical efficacy of biological therapies in ulcerative colitis. Expert Opin Drug Discov. 2021, 16, 567–577. [Google Scholar] [CrossRef]
- Eichele, D.D.; Kharbanda, K.K. Dextran sodium sulfate colitis murine model: An indispensable tool for advancing our understanding of inflammatory bowel diseases pathogenesis. World J Gastroenterol. 2017, 23, 6016–6029. [Google Scholar] [CrossRef]
- Baskaran, R.; Balasubramanian, B.; Ho, J.H.; Wang, M.F.; Abomughaid, M.M.; Yang, H.S.; Lin, W.T. VH-4-A bioactive peptide from soybean and exercise training constrict hypertension in rats through activating cell survival and AMPKalpha1, Sirt1, PGC1alpha, and FoX3alpha. Molecules. 2022, 27. [Google Scholar] [CrossRef]
- Li, M.; Ge, Q.; Du, H.; Jiang, P.; Bao, Z.; Chen, D.; Lin, S. Potential mechanisms mediating the protective effects of Tricholoma matsutake-derived peptides in mitigating DSS-induced colitis. J Agric Food Chem. 2021, 69, 5536–5546. [Google Scholar] [CrossRef]
- Park, S.; Zhang, T.; Yue, Y.; Jeong, S.J.; Ryu, M.S.; Wu, X.; Yang, H.J.; Jeong, D.Y. Alleviation of metabolic disturbance by substituting Kanjang high in Bacillus for salt through modulation of gut microbiota in estrogen-deficient rats. Foods. 2022, 11. [Google Scholar] [CrossRef]
- Qiao, Y.; Zhang, K.; Zhang, Z.; Zhang, C.; Sun, Y.; Feng, Z. Fermented soybean foods: A review of their functional components, mechanism of action and factors influencing their health benefits. Food Res Int. 2022, 158, 111575. [Google Scholar] [CrossRef] [PubMed]
- Karami, Z.; Akbari-adergani, B. Bioactive food derived peptides: A review on correlation between structure of bioactive peptides and their functional properties. J Food Sci Technol. 2019, 56, 535–547. [Google Scholar] [CrossRef] [PubMed]
- Cai, Z.; Wang, S.; Li, J. Treatment of inflammatory bowel disease: A comprehensive review. Front Med (Lausanne). 2021, 8, 765474. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Wang, D.; Yan, W. Treatment effects of natural products on inflammatory bowel disease in vivo and their mechanisms: Based on animal experiments. Nutrients. 2023, 15. [Google Scholar] [CrossRef]
- Ninnemann, J.; Winsauer, C.; Bondareva, M.; Kühl, A.A.; Lozza, L.; Durek, P.; Lissner, D.; Siegmund, B.; Kaufmann, S.H.E.; Mashreghi, M.F.; et al. TNF hampers intestinal tissue repair in colitis by restricting IL-22 bioavailability. Mucosal Immunol. 2022, 15, 698–716. [Google Scholar] [CrossRef]
- Kessler, B.; Rinchai, D.; Kewcharoenwong, C.; Nithichanon, A.; Biggart, R.; Hawrylowicz, C.M.; Bancroft, G.J.; Lertmemongkolchai, G. Interleukin 10 inhibits pro-inflammatory cytokine responses and killing of Burkholderia pseudomallei. Sci Rep. 2017, 7, 42791. [Google Scholar] [CrossRef]
- Levine, A.E.; Mark, D.; Smith, L.; Zheng, H.B.; Suskind, D.L. Pharmacologic management of monogenic and very early onset inflammatory bowel diseases. Pharmaceutics. 2023, 15. [Google Scholar] [CrossRef] [PubMed]
- Daskaya-Dikmen, C.; Yucetepe, A.; Karbancioglu-Guler, F.; Daskaya, H.; Ozcelik, B. Angiotensin-I-converting enzyme (ACE)-inhibitory peptides from plants. Nutrients. 2017, 9. [Google Scholar] [CrossRef]
- Jin, Y.H.; Jeon, A.R.; Mah, J.H. Tyrosinase inhibitory activity of soybeans fermented with Bacillus subtilis capable of producing a phenolic glycoside, arbutin. Antioxidants (Basel). 2020, 9. [Google Scholar] [CrossRef]






| Weight Loss (%) | Shape of stool | Occult Blood/Bloody Stool | Score |
| 0 | Normal | Negative | 0 |
| 1-5 | Soft stool | Negative | 1 |
| 6-10 | Soft stool | Occult blood | 2 |
| 11-15 | Diarrhea | Occult blood | 3 |
| >15 | Diarrhea | Bloody stool | 4 |
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| TNF-α | AACTAGTGGTGCCAGCCGAT | CTTCACAGAGCAATGACTCC |
| IL-6 | TGTCTATACCACTTCACAAGTCGGAG | GCACAACTCTTTTCTCATTTCCAC |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| IL-10 | GCACTACCAAAGCCACAAAGC | GTCAGTAAGAGCAGGCA |
| Β-actin | CGGTTCCGATGCCCTGAGGCTCTT | CGTCACACTTCATGATGGAATTGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).