The Demographic and Geographic Variations Mediate Fecal and Oral Microbial Dynamics Alteration in Human Population of District Faisalabad

1. Introduction

The microorganisms in human body exist as mutualistic and symbiotic relationships; known as microbiota. These microbes trillions in number together with bacteria, protozoa, viruses, and fungi are present on and in our bodies (Anwar et al., 2021). These microorganisms are found on the skin, in the mouth, reproductive organs, and gut. The supposed role of microbes has been linked to the analysis, medication, and administration of numerous ailments (Abbasi et al., 2021). It has been reported that microbes associated by prevention and progression of numerous CNS diseases such as multiple sclerosis (Atabati et al., 2021). They are also associated with detection and care of cardiac problems such as hypertension (Oniszczuk et al., 2021). Many microorganisms living in the gut, assisting to digest the indigestible foods (Mukhtar et al., 2019). The gut microflora offers numerous advantages to the hosts, through a variety of physiological roles like firming up gut integrity or shaping the epithelium of intestine (Natividad et al., 2013), protecting against pathogens (Bäumler et al., 2016), harvesting energy (Den Besten et al., 2013), and regulating host immunity (Gensollen et al., 2016). However, altered microbial composition, known as dysbiosis disrupt these mechanisms (Schroeder et al., 2016).

Numerous groups of bacteria have a crucial role in the breakdown of bile salts and suppress the pathogenicity of pathogenic microbes in gut, convert pro forms of drugs into active state and lessen the harms of xenobiotic compounds by chemical alterations (Bäumler et al., 2016). Moreover, the gut microorganisms play a vital role in the production of neurotransmitters, vitamins and metabolites, the essential constituent of human health, regulate host immune system, cytokine generation, growth of lymphoid organs in the gut, growth and development of gut-associated immune system (Anwar et al., 2019). It has been reported that intestinal microbiome also plays significant part in the improvement of whole body ‘s immune status. These specific combinations of bacteria, viruses and fungi are not only essential for the distinctive care of health, but also in dispensation of exogenous compounds (medicine) intended to rectify homeostatic inequities (Anwar et al., 2015). Numerous factors involving the use of antibiotics, prebiotics and probiotics, along with geographical distribution, and environmental factors, such as air pollution, or disrupting chemicals, and hygienic conditions act as modulators, influencing the gastrointestinal microbiome functionality, makeup and diversity (Anwar et al., 2021).

According to studies, moderate amounts of species have been found and isolated from humans, divided into twelve phyla, with Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria accounting for 93.5 percent of the total. Out of the 12, three identified phyla have only one species separated from humans, like intestinal species, Akkermansia muciniphila. In human being, 386 of the known species are anaerobic and henceforth will in general be found in mucosal areas like the GI tract and the oral cavity (Hugon et al., 2015).

Dysbiosis of the intestinal microbiome is by far the most major cause of infection. Furthermore, bacterial infection and its treatment have a significant impact on the human intestinal microbiome, that determines the manifestation of infection in host body. Invading pathogens invade the intestinal mucosa, triggering a severe inflammatory reaction and the subsequent translocation of gastrointestinal microorganisms (Brenchley et al., 2012). Number of studies have reported the close link between microbial dysregulation and infection, as well as the fact that disease is linked not just to the microbes but also to viruses (Cohen et al., 2016).

Clostridium difficile overpopulation is commonly linked to antibiotic-related diarrhoea, which is one of the most common side effects of antibiotic therapy, and now it has become a public health concern (Gu et al., 2016). Clostridium difficile is spore-forming, gram-positive, anaerobic, bacillus an important element, of the human gut microflora. The decrease in the resistance contrary to toxin-producing Clostridium difficile is due to altered intestinal mucosal homeostasis and stimulation of CDI development. Studies found that either CDI is existent or not, faecal microbial diversity is reduced and intestinal bacterial diversity pompously changes in patients with antibiotics administration (Gu et al., 2016). Another research investigated that whether CDI exist or not, antibiotic medication has been associated with reduction of butyrate-forming bacteria, an upsurge of endotoxin-producing pathogens and lactate producing phylotypes in individuals (Chen et al. 2011). Helicobacter pylori bacterium are known to causes digestive problems. It has lately been related to the development of periodontitis. He looked at the link between H. pylori infection and inflammation, periodontal parameters, and periodontal pathogens. According to their findings, the frequencies of Prevotella, Treponema denticola, Fusobacterium nucleatum, Aggregatibacter actinomycete and Fusobacterium nucleatum, are much higher in H. pylori-infected patients than non-infected ones. The findings suggest that H. pylori patients had significantly increased probing depths or attachments failure, as the H. pylori may encourage the evolution of various periodontal infections and aggravate the progression of chronic periodontitis (Hu et al., 2016).

Current studies have revealed that the gut microorganisms have impact on circadian oscillations and also affect the circadian clock (Leone et al., 2015). Dysbiosis induces by of the Interruption circadian clock, which is related to the host metabolic diseases (Thaiss et al., 2014). Obesity, which is accompanied with altered metabolic pathways and gut microbiome dysbiosis, reduces intestinal epithelial barrier functioning and seems to have a significant impact on physiological functions (Tremaroli et al., 2012), like immune homeostasis and gut (De Vos et al., 2013).

The microbiota of a human stomach is shaped by a numerous factor. These are (1) The way of delivery; (2) diet during infancy and adulthood; and (3) use of antibiotics and the gut commensal community (Jandhyala et al., 2015).

Our study determined the variations in selected ora-faecal bacterial species in rural and urban regions of district Faisalabad. Also determined the variations in oro-foecal bacterial species across rural and urban individual suggested potential impact of demographic and geographic distinction on microbiome dysbiosis.

2. Materials and methods

2.1. Experimental design

2.2. Ethics approval and consent to participate

The study was approved by ethical Committee on Human Research (CHR) of Koç University Institutional Review Board (IRB) (2022. 216. IRB3.122) and all methods were performed in accordance with relevant guidelines and regulations. The informed consent was obtained from all subjects and their legal guardians.

2.3. Population

Ten thousand healthy male of aged 25–35 years were recruited from the two different rural and urban localities of the district Faisalabad.

2.4. Inclusion criteria

Individuals recruited have regular excrement habits. Devoid history of gastrointestinal disease such as gastritis, colorectal cancer, gastric cancer, inflammatory bowel disease and peptic ulcer. No diarrhea for the previous month. The informed consent was obtained from all subjects and their legal guardians.

2.5. Study area

The city of Faisalabad one of the major cities in Punjab province of Pakistan was identified as the urban location of the study and nearby areas was identified for rural location. Sample were collected from healthy subjects (N=10,000) who lived in urban area of Faisalabad Wapda city (n=5000) located in the Faisalabad. For rural area samples were collected from subjects lived in Naimatabad (n=5000).

2.6. Dietary assessment

A self-administered evaluative food routine questionnaire was used to assess dietary patterns. All recruited individual had routine meals comprised of protein-based diets (beef, pork, poultry, eggs, fish, and cow milk) and carbohydrate-based foods (rice and rice noodle, breakfast cereal, bread, sweet potato), as well as dietary fibres (fruit and vegetables). Pakistanis eat 3 times per day the breakfast, lunch, and dinner.

2.7. Oral swab sample collection and processing

Before collecting oral rinses, people were instructed to fast for nine hours. Oral swab sample was collected in a sterile cup by healthy participants. Oral swab specimens were kept cool until they arrived at the Lab, where they have been freeze and stored at -80˚c in 50 mL collection tube. The oral rinsed samples were subsequently transported to laboratory on dry ice and stored at -80˚c until processing. We extracted DNA and amplified it in the V4 region of the 16S rRNA using primers.

2.8. Fecal sample collection

Each subject received a stool sampling kit, which included a sample box and sterilized tissue papers, as well as a question paper regarding their eating habits and a consent paper. The questionnaires were filled in volunteers according to need of research. Participants were recruited randomly through direct approach. Participants had not taken any antibiotic for at least six months prior to sampling. The consent documents were signed by and obtained from the all participants prior to fecal sample collection. Volunteers were briefed on how to use and collect the sample with minimal contamination following the detailed instructions included in the sampling kit. After samples collection, sample were collected from participants within two hours and transported on dry ice in the cooler box in the laboratory. Samples were stored immediately at −80 ℃ in the laboratory till the analysis occurs. A total of 10,000 samples were collected according to the grouping described in Table 1.

2.9. DNA extraction and quantification

The fecal samples were kept at -80°C till genomic DNA extraction. About 30 mg of samples were used for DNA extraction. In brief, each fecal sample was diluted to 1:10 (weight/ volume) in distilled water and homogenized boiling for 2 min. The sample was then transferred into a 1.5-mL screw-capped tube. One milliliter of sample obtained was centrifuged at 14,000×g for 10 min at 4 ℃, after centrifugation, pallet was taken and dissolved in DNAzol 300 microliters. The solution was homogenized by using vortex machine. 300 microliter chloroform added to this solution incubated on ice for 30 minutes until three layers are formed. When three layers are formed upper layer containing bacterial DNA was collected and transferred it in Eppendorf of 1.5 mililiter, equal amount of isopropanole was added and freeze it overnight. Next day 70 percent ethanol was added then centrifuged at room temperature for 40 minutes at 14,000×g for washing. This washing step was repeated for three times. Every washing sample was shifted into new Eppendorf. Afterwards the lid of Eppendorf was kept open for ethanol evaporation. A 30 µl nuclease free water was added. The quality and quantity of DNA were analyzed by using Thermo Scientific™ Nano Drop 2000.

2.10. Primer sequences

2.11. PCR and agarose gel electrophoresis

The variable segment of the microbial 16S rRNA markers were amplified by using forward and reverse primers fallowing the sample thawed on ice. The following conditions were used for primary 16S rRNA gene PCR amplification: 95 °C for 3 minutes preceded by 35 cycles of 95 °C for 15 seconds each, 60 °C for 30 seconds, and 72 °C for 30 seconds, and a final extension step of 72 °C for 5 minutes. Agarose gel electrophoresis was used to determine success of amplification. Variable regions of the 16S rRNA genes were amplified in 50μl reaction volume using 0.1 ng of template DNA with different bacterial primers given in Table 2.10 using the PCR thermocycler BioRad T100. The PCR amplification products were purified on 2% agarose gels. And the positive number of samples for various bacteria were counted and compared in each groups to calculate the microbial diversity in different population. Final concentration in gel / running buffer was as 40 mM Tris, 20 mM acetic acid, 1 mM EDTA and 3.6 Gel preparation.

Table 2. List of forward and reverse primers for amplification of 16S rRNA collected from Macrogen, South Korea.

Primer Name	Sequence
Total Bifido-F	TCGCGTC[Y]GGTGTGAAAG
Total Bifido-R	CCACATCCAGCRTCCAC
Blautia spp-F	TTGATGTGAAAGGCTGGGGCTTAC
Blautia spp-R	GGCTTAGCCACCCGACACCTA
Compylobacter coli- F	TGACGGTAGAACTTTCAAATCC
Compylobacter coli- R	GCAAGTGCTTCACCTTCGATA
E Coli-F	GTTAATACCTTTGCTCATTGA
E Coli-R	ACCAGGGTATCTAATCCTGTT
Faecalibacterium-F	GAAGGCGGCCTACTGGGCAC
Faecalibacterium-R	GTGCAGGCGAGTTGCAGCCT
Firmicutes-run-F	GGCAGCAGTRGGGAATCTTC
Firmicutes-run-R	ACAC[Y]TAG[Y]ACTCATCGTTT
Fusobacterium-F	KGGGCTCAACMCMGTATTGCGT
Fusobacterium-R	TCGCGTTAGCTTGGGCGCTG
Gamma-Protebacteria-F	TGCCGCGTGTGTGAA
Gamma-Protebacteria-R	ACTCCCCAGGCGGTCDACTTA
Total Lactobacillus-F	AGCAGTAGGGAATCTTCCA
Total Lactobacillus-R	CACCGCTACACATGGAG
Ruminococcaceae-F	ACTGAGAGGTTGAACGGCCA
Ruminococcaceae-R	CCTTTACACCCAGTAAWTCCGGA

Table 2. List of forward and reverse primers for amplification of 16S rRNA collected from Macrogen, South Korea.

Primer Name	Sequence
Total Bifido-F	TCGCGTC[Y]GGTGTGAAAG
Total Bifido-R	CCACATCCAGCRTCCAC
Blautia spp-F	TTGATGTGAAAGGCTGGGGCTTAC
Blautia spp-R	GGCTTAGCCACCCGACACCTA
Compylobacter coli- F	TGACGGTAGAACTTTCAAATCC
Compylobacter coli- R	GCAAGTGCTTCACCTTCGATA
E Coli-F	GTTAATACCTTTGCTCATTGA
E Coli-R	ACCAGGGTATCTAATCCTGTT
Faecalibacterium-F	GAAGGCGGCCTACTGGGCAC
Faecalibacterium-R	GTGCAGGCGAGTTGCAGCCT
Firmicutes-run-F	GGCAGCAGTRGGGAATCTTC
Firmicutes-run-R	ACAC[Y]TAG[Y]ACTCATCGTTT
Fusobacterium-F	KGGGCTCAACMCMGTATTGCGT
Fusobacterium-R	TCGCGTTAGCTTGGGCGCTG
Gamma-Protebacteria-F	TGCCGCGTGTGTGAA
Gamma-Protebacteria-R	ACTCCCCAGGCGGTCDACTTA
Total Lactobacillus-F	AGCAGTAGGGAATCTTCCA
Total Lactobacillus-R	CACCGCTACACATGGAG
Ruminococcaceae-F	ACTGAGAGGTTGAACGGCCA
Ruminococcaceae-R	CCTTTACACCCAGTAAWTCCGGA

Separation, purification, and identification 0.5- to 25-kb DNA fragments with agarose gel electrophoresis was carried out in three main phases: (1) a gel was prepared with an agarose concentration appropriate for the size of DNA fragments to be kept separate; (2) DNA samples were loaded into sample wells and the gel is run at a voltage and for a period of time which will achieve optimal separation; and (3) Ethidium bromide is incorporated into the gel and electrophoresis was performed. An electrical field was used to drive negatively charged DNA throughout an agarose gel matrix forward towards a positive terminal in electrophoresis. Relatively short DNA fragments go faster through the gel than longer ones. By running a DNA fragment on a gel matrix alongside a DNA ladder, we were able to establish its approximate length.

2.12. Statistical analysis

The Mann–Whitney U-test was used to compare the abundance of 16S rRNA Graph Pad Prism Software, version 5 software. P value *p<0.05, **p<0.01.

3. Results

In total, 10,000 volunteers were recruited from two different geographic and demographic areas. In current study 10 bacterial species were identified using PCR in different geographic and demographic regions specifically rural and urban areas of district Faisalabad, Pakistan. A total of 10 bacterias were aimed to detect in fecal and 5 in oral sample. The list of bacterias detected in study are showed in Table 3.

Table 3. The results showed positive expression of following bacterial species i.e: Total Bifido, ,E.coli, Blautia spp, Faecali bacteria, Firmicutes ,Total Lactobacillus and Rminococcaceae in both rural and urban regions in Gut and oral cavity of individuals. While another set of bacterial species i.e: Compylobacter coli Fusobacterium and Gamma protebacteria were not found in PCR results, finding beneficial for host as these bacterial species are considered as pathogenic.

3.1. Fecal microbial profile

3.1.1. Total Bifido

Figure 1 and (Supplementary file1) illustrated % abundance and corresponding bands of Total Bifido in the fecal samples of both rural and urban populations respectively. Results demonstrated the environmental and life style variation of people living in rural and urban areas of district Faisalabad have no effect on % abundance of Total Bifido in the gut in these two populations.

3.1.2. Blautia spp

The presence of Blautia spp in both rural and urban populations have been shown in Figure 1 and (Supplementary file1) clearly depicted the variable abundance of bacteria in two demographically distinct areas. It implies the influence of environmental changes on the bacterial population of gut microbiota. the % abundance have been increased in rural populations.

3.1.3. E. coli

E. coli bacterial species found in fecal sample of human population of both rural and urban regions demonstrated no influence of life style variation in % abundance of E. coli bacterial population in gut flora. As % abundance and representative bands are depicted in Figure 1 and (Supplementary file1).

3.1.4. Faecali

PCR results depicted changes in the environment and people's lifestyles in rural and urban parts of Faisalabad district have no influence on the prevalence of Faecali bacteria in the gut. However relative quantity of this bacterial specie may be decrease or increase, but found in both rural and urban areas of District Faisalabad. As % abundance and representative bands are depicted in Figure 1 and (Supplementary file1).

3.1.5. Firmicutes

It has been found that Firmicutes bacteria are present in both rural and urban areas of human population of District Faisalabad. The results have been depicted in Figure 1 and (Supplementary file1) illustrated the people living in rural areas of district Faisalabad revealed elevated % abundance of Firmicutes load in fecal samples of rural individuals.

3.1.6. Total Lactobacillus

Total Lactobacillus bacterial specie is a part of normal gut microbiota. Figure 1 and (Supplementary file1) indicated variations in the environmental and people's lifestyles in rural and urban areas of Faisalabad district have no influence on the % abundance of Total Lactobacillus in gut.

3.1.7. Ruminococcaceae

The bacterial species of Ruminococcaceae has been showed variable abundance in both rural and urban populations. Geographical and socioeconomical difference alter the gut microbial diversity. PCR results demonstrated the % abundance of Ruminococcaceae in rural populations was elevated. As % abundance and representative bands are depicted in Figure 1 and (Supplementary file1).

3.1.8. Gamma Protebacteria

Gamma Protebacteria in fecal sample of both rural and urban populations was devoid. As this bacterium is pathogenic and absent in both rural and urban areas of district Faisalabad it showed change in lifestyle and environment did not cause any Gamma Protebacteria associated disease. As depicted in Figure 1 and (Supplementary file1).

3.1.9. Fusobacterium

Fusobacterium is the pathogenic bacterial specie found in human gut microbiota in disease condition. This bacterium was included in the current study to observe change in lifestyle may influence Fusobacterium load of gut. Results showed absence of Fusobacterium in both rural and urban areas of District Faisalabad. As % abundance and representative bands are depicted in Figure 1 and (Supplementary file1).

3.1.10. Compylobacter coli

The absence of Compylobactor coli in both rural and urban population has been observed in Figure 1 and (Supplementary file1). This bacterial specie is pathogenic and typically not found in both rural and urban regions of the district Faisalabad, it indicated lifestyle and environment variation did not contribute illness caused by this bacterium.

Figure 1. % abundance of fecal bacterial profile in samples collected in 5000 individuals at urban and rural areas of Faisalabad. The Abundance analysis of microbiome in urban and rural individuals 16s rRNA quantification by PCR revealed a significant elevated abundance of Blautia spp, Firmicutes Ruminococcaceae, in rural population however non-significant difference in abundance of Total Bifido , E.coli , Faecali bacteria , Total Lactobacillus were found in both urban and rural population. The Compylobacter coli Fusobacterium and Gamma protebacteria bacteria were not detect in any population of study. The abundance of 16S rRNA genes comparison was carried out by Mann–Whitney U-test in Graph Pad Prism Software, version 5 software. P value *p<0.05, **p<0.01.

Figure 1. % abundance of fecal bacterial profile in samples collected in 5000 individuals at urban and rural areas of Faisalabad. The Abundance analysis of microbiome in urban and rural individuals 16s rRNA quantification by PCR revealed a significant elevated abundance of Blautia spp, Firmicutes Ruminococcaceae, in rural population however non-significant difference in abundance of Total Bifido , E.coli , Faecali bacteria , Total Lactobacillus were found in both urban and rural population. The Compylobacter coli Fusobacterium and Gamma protebacteria bacteria were not detect in any population of study. The abundance of 16S rRNA genes comparison was carried out by Mann–Whitney U-test in Graph Pad Prism Software, version 5 software. P value *p<0.05, **p<0.01.

3.2. Oral microbial profile

3.2.1. Total Bifido

Total Bifido normally present in oral sample of human populations. Figure 3 and (Supplementary file1) depicted the % abundance and corresponding band of Total Bifido in both rural and urban regions. It indicated the variation in environment and life style of people in rural and urban areas of district Faisalabad have no influence on Total Bifido in the oral microflora.

3.2.2. E. coli

E. coli bacterial specie is normally present in the microbiome of human population. Figure 3 and (Supplementary file1) depicted the % abundance and corresponding band indicated that variations in the environment and people’s lifestyles in rural and urban areas of Faisalabad district have no influence on the prevalence of E. coli in the oral microbiota.

3.2.3. Firmicutes

PCR results demonstrated the variable microbial load of Firmicutes bacteria in rural and urban populations. It depicted the role distinct life style on abundance of Firmicutes bacterial population in oral microbime. The % abundance of Firmicutes elevated in rural population. As Figure 3 and (Supplementary file1) depicted the % abundance and corresponding bands.

3.2.4. Total Lactobacillus

The results revealed the absence of Total Lactobacillus bacteria in both rural and urban areas population. As this bacterial specie is pathogenic, and normally not found in both rural and urban regions of the district of Faisalabad. It indicated lifestyle and environmental changes did not affect illness caused by this bacterium. As presented in Figure 3 and (Supplementary file1) the % abundance and corresponding band.

3.2.5. Fusobacterium

The analysis showed the absence of Fusobacterium in both rural and urban populations. Results presented in Figure 3 and (Supplementary file1) the % abundance and corresponding band. Clearly implies null influence of environmental changes in the bacterial population of oral microbes.

Figure 3. % abundance of oral bacterial profile in samples collected in 5000 individuals at urban and rural areas of Faisalabad. The Abundance analysis of microbiome in urban and rural individuals 16s rRNA quantification by PCR revealed a significant (P value **p<0.01) elevated abundance of Firmicutes in rural population however non-significant difference in abundance of total Bifido and E. coli was found. Total Lactobacillus and Fusobacterium were not detected in oral sample of both urban and rural population. The abundance of 16S rRNA genes comparison was carried out by Mann–Whitney U-test in Graph Pad Prism, version 5 Software.

Figure 3. % abundance of oral bacterial profile in samples collected in 5000 individuals at urban and rural areas of Faisalabad. The Abundance analysis of microbiome in urban and rural individuals 16s rRNA quantification by PCR revealed a significant (P value **p<0.01) elevated abundance of Firmicutes in rural population however non-significant difference in abundance of total Bifido and E. coli was found. Total Lactobacillus and Fusobacterium were not detected in oral sample of both urban and rural population. The abundance of 16S rRNA genes comparison was carried out by Mann–Whitney U-test in Graph Pad Prism, version 5 Software.