Submitted:
23 July 2026
Posted:
24 July 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Cells and virus
2.2. Quantitative molecular analysis
2.3. mRNAseq analysis
2.4. Data Analysis
3. Results
3.1. Course of infection of B19V in UT7/EpoS1 cells

3.2. mRNAseq analysis
3.3. Viral transcriptome
3.4. Cellular transcriptome

3.5. Cellular Transcriptome, Comparison of UT7/EpoS1 to EPCs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| B19V | Parvovirus B19 |
| PBMC | Peripheral Blood Mononuclear Cells |
| EPCs | Erythroid Progenitor Cells |
| HTS | High Throughput Sequencing |
Appendix A
| Primer | Sense | Primer | Antisense | DNA Target |
|---|---|---|---|---|
| 18Sfor | CGGACAGGATTGACAGATTG | 18Srev | TGCCAGAGTCTCGTTCGTTA | Genomic 18S rDNA |
| R2210 | CGCCTGGAACACTGAAACCC | R2355 | GAAACTGGTCTGCCAAAGGT | Virus DNA |
| Primer | Sense | Primer | Antisense | RNA Target |
| R1882 | GCGGGAACACTACAACAACT | R2033 | GTCCCAGCTTTGTGCATTAC | mRNA1 |
| R2210 | CGCCTGGAACACTGAAACCC | R2355 | GAAACTGGTCTGCCAAAGGT | mRNA1-5, central exon |
| R4899 | ACACCACAGGCATGGATACG | R5014 | TGGGCGTTTAGTTACGCATC | mRNA3-5, distal exon |
| Region | nt Start* | nt End* | Sequence |
|---|---|---|---|
| Splicing | |||
| D1-no splicing | 585 | 586 | GTGAGCTAACTAACAGGTATTTATACTACTTG |
| D1-A1.1 | 586 | 2088 | GTGAGCTAACTAACAGATGCCCTCCACCCAGA |
| D1-A1.2 | 586 | 2208 | GTGAGCTAACTAACAGGCGCCTGGAACACTGA |
| D2-no splicing | 2362 | 2363 | ACCAGTTTCGTGAACTGTTAGTTGGGGTTGAT |
| D2-A2.1 | 2362 | 3141 | ACCAGTTTCGTGAACTGTGCAGCTGCCCCTGT |
| D2-A2.2 | 2362 | 4882 | ACCAGTTTCGTGAACTCTACAGATGCAAAACA |
| Cleavage | |||
| pAp1 | 2841 | 2842 | TTGCTCGTATTAAAAATAACCTTAAAAACTCT TAACCTTAAAAACTCTCCAGACTTATATAGTC CCAGACTTATATAGTCATCATTTTCAAAGTCA |
| pAp2 | 3141 | 3142 | TGGGAATAAATCCATATACTCATTGGACTGTA TACTCATTGGACTGTAGCAGATGAAGAGCTTT GCAGATGAAGAGCTTTTAAAAAATATAAAAAA |
| pAd | 5190 | 5191 | AAAATTTAGAAAAATAAACATTTGTTGTGGTT AACATTTGTTGTGGTTAAAAAATTATGTTGTT AAAAAATTATGTTGTTGCGCTTTAAAAATTTA |
| Cluster Numb. | Gene Count | Cluster Coeff. | Protein Names | Reactome Pathways | Sum LogFC | Avg Log FC | |
|---|---|---|---|---|---|---|---|
| 2 hpi | 1 | 18 | 0.78 | PTGS2, CCL2, SLAMF7, IL1B, CMKLR1, NFKBIZ, CISH, CD47, CD69, FCGR2B, F2R, LIF, ARG1, CCL4, CSF1, CCR4, CCRL2, IL10RB | Immune System Signaling by Interleukins |
-23,96 | -1,33 |
| 2 | 12 | 0.82 | PPP1R15A, HERPUD1, TSC1, DNAJB9, CHAC1, ASNS, XBP1, HSPA5, ATF4, HYOU1, ID2, GABARAPL1 | Cellular responses to stress | 18,02 | 1,50 | |
| 3 | 6 | 0.84 | CEBPB, KLF6, FOS, CCND1, H2BC3, DUSP2 | Generic Transcription Pathway | -3,42 | -0,57 | |
| 16 hpi | 1 | 33 | 0.67 | GADD45B, KLF10, IFRD1, IER3, BTG2, NR4A1, TNFAIP3, FOSB, FOS, DDIT3, NFKBIA, JUNB, JUN, CDKN1A, ATF3, GADD45A, SERPINE1, PELI1, THBS1, MAP3K8, BIRC3, PTGS2, INHBA, AREG, PRDM1, PTHLH, H2BC3, MAFF, TRIB1, DDB2, PPM1D, DUSP6, TRIB3 | Signal Transduction Generic Transcription Pathway Cytokine Signaling |
-67,15 | -2,03 |
| 2 | 18 | 0.75 | CCL2, CXCL8, TNFSF10, CD69, FAS, CCL4, CSF1, IRF1, CXCL2, IFIH1, IL4R, CD274, LIF, CXCR3, GBP2, GBP4, IL6ST, RNF213 | Immune System Signal Transduction |
-29,15 | -1,62 | |
| 3 | 14 | 0.92 | KIF20A, AKAP12, ESPL1, PIF1, RRM2, CDCA3, CCNF, KIF18B, NEK2, CENPE, INCENP, BUB1, PLK1, CEP250 | Cell Cycle | 10,66 | 0,76 | |
| 4 | 6 | 0.84 | HIF1A, EGLN3, PDK1, P4HA1, SLC16A3, PPFIA4 | -- | 5,60 | 0,93 | |
| 5 | 4 | 0.83 | GFPT2, SAT1, HK2, MPI | -- | -0,88 | -0,22 | |
| 48 hpi | 1 | 30 | 0.77 | PRF1, IL7R, CD276, CD69, GZMB, CD63, SERPINE1, SCARB1, CD36, CCRL2, CD274, CSF1, TNFRSF9, CCL4, CCL2, CXCL2, CXCL8, IL4R, IKZF2, TNFSF9, CXCR3, CCR7, SRGN, AGER, P2RX7, CMKLR1, IL1RL1, CCR4, MARCHF8, GBP4 | Immune System Signal Transduction |
-46,39 | -1,55 |
| 2 | 20 | 0.82 | CDC25A, CDC6, CDC20, TRIP13, GINS4, NCAPD2, DEPDC1, CCNF, TACC3, CENPN, ESPL1, BUB1, PLK1, TOP2A, TIPIN, GINS3, NUP107, STAG1, EZH1, TCF19 | Cell Cycle | -1,00 | -0,05 | |
| 3 | 14 | 0.77 | PIGQ, GPI, ENO2, PFKL, ALDOA, ENO3, GALK1, PHGDH, UAP1, BCKDHA, PCK1, PKLR, IDH3A, ALDOC | Metabolism of carbohydrates | 14,89 | 1,06 | |
| 4 | 10 | 0.85 | BAG1, TOMM40, DNAJA1, HSPA9, HSPE1, TIMM8B, TIMM17A, DNAJA4, TIMM10, UBE2J1 | Mitochondrial protein import | -7,94 | -0,79 | |
| 5 | 9 | 0.92 | PSMC4, PSME3, PSMA3, PSMD14, PSMD12, ADRM1, PSMC2, UBE2N, AQP3 | FCERI mediated NF-kB activation | -10,15 | -1,13 | |
| 6 | 8 | 0.89 | POP4, NOP2, NOP56, RRP9, SDAD1, DDX21, NOLC1, PNO1 | Metabolism of RNA | -9,66 | -1,21 | |
| 7 | 7 | 0.85 | SLC2A3, BNIP3, HIF1A, P4HA1, NDRG1, STC1, PPFIA4 | -- | 2,47 | 0,35 | |
| 8 | 7 | 0.88 | ABCE1, EIF2S1, ETF1, EIF5, EIF3J, ABCF2, ANKZF1 | Translation | -6,01 | -0,86 | |
| 9 | 7 | 0.86 | ATF3, NFKBIZ, KLF6, JUNB, NR4A1, MAFF, ERRFI1 | -- | -13,12 | -1,87 | |
| 10 | 6 | 0.84 | TGM2, COL2A1, SPP1, THBS3, ITGA9, ITGA5 | Integrin cell surface interactions | 2,57 | 0,43 | |
| 11 | 6 | 0.81 | PCNA, RAD51C, FEN1, PAN2, UNG, ZMIZ1 | DNA Repair | -0,99 | -0,16 | |
| 12 | 6 | 0.78 | SELENBP1, TNS1, EPB42, ADD2, ADD3, AKAP12 | -- | 4,68 | 0,78 | |
| 2-48 hpi | 1 | 16 | 0.92 | CDC25A, CDC6, PIF1, DEPDC1, CCNG1, KIF20A, NEK2, KIF23, ZWINT, TOP2A, PLK1, BUB1, FEN1, ESPL1, RPS6KA3, MAST4 | Cell Cycle | 5,38 | 0,34 |
| 2 | 13 | 0.76 | PPP1R15A, MAFF, TNFAIP3, FOS, DUSP1, CEBPG, ID1, EGR3, BTG2, NR4A1, PDCD4, MAP3K1, HOMER1 | -- | -8,60 | -0,66 | |
| 3 | 13 | 0.79 | PMAIP1, HSP90B1, CALR, XBP1, HSPA5, DNAJB1, SEC61A1, GMPPB, TGM2, DNAJC12, DNAJA1, SDF2L1, HSPH1 | Cellular responses to stress | -15,27 | -1,17 | |
| 4 | 9 | 0.81 | HSD17B10, ACADS, HMGCL, ALDH6A1, EHHADH, MLYCD, ALDH8A1, MCEE, SYNGR1 | Metabolism | 4,64 | 0,52 | |
| 5 | 8 | 0.96 | PSMC4, EGLN3, PSME3, PSMD14, PSMD12, ADRM1, PSMC3, PSMC2 | Proteasome assembly | -7,19 | -0,90 | |
| 6 | 8 | 0.87 | ENO2, PYGB, ALDOC, PCK1, GLUL, PFKM, GPI, GPD1 | Metabolism | 6,03 | 0,75 | |
| 7 | 7 | 0.81 | SNAI2, TGFB3, SERPINE1, SMAD3, TGIF2, LTBP1, ZMIZ1 | Signal Transduction | 2,39 | 0,34 | |
| 8 | 6 | 0.81 | NDRG1, LDHA, PDK1, P4HA1, SLC1A5, SLC16A3 | Pyruvate metabolism | 6,31 | 1,05 | |
| 9 | 6 | 0.86 | RRP12, RRP9, LHPP, DDX21, MYBBP1A, PNO1 | rRNA processing | -4,88 | -0,81 | |
| 10 | 5 | 0.87 | SLC25A1, D2HGDH, IDH1, IDH2, GLRX | Metabolism | 5,67 | 1,13 | |
| 11 | 5 | 0.60 | GAA, GLA, NPC1, IDS, HES1 | -- | -0,86 | -0,17 | |
| 12 | 5 | 0.60 | ATF3, DDIT3, DBP, ERRFI1, IFRD1 | -- | -6,52 | 0,34 | |
| Cluster Numb. | Gene Count | Cluster Coeff. | Protein Names | Reactome Pathways | Sum LogFC | Avg Log FC | |
|---|---|---|---|---|---|---|---|
| 2 hpi | 1 | 15 | 0.88 | MYC, FBXO5, E2F1, HBEGF, MT2A, EIF4A2, CDKN2C, CCND3, E2F3, KLF5, NOTCH1, CDR2, LBR, HDGF, NFE2 | Mitotic G1 phase and G1/S transition | 5,20 | 0,35 |
| 2 | 10 | 0.80 | ELL2, POLR2K, POLR2A, ELOA, CCNT1, GTF2A2, TAF13, H2BC12, H4C3, ARID4A | Transcription by RNA polymerase II | 1,64 | 0,16 | |
| 16 hpi | 1 | 10 | 0.87 | PTGS2, FOS, NFKBIZ, BTG2, ATF3, FOSB, NR4A1, MT2A, JUNB, EGR3 | Transcription regulator activity | -24,89 | -2,49 |
| 2 | 8 | 0.84 | CD274, CXCL2, CD69, CCL4, CSF1, CCL2, IL1R2, IL3RA | Response to cytokine | -31,83 | -3,98 | |
| 3 | 6 | 0.81 | IRF1, EPSTI1, IFI27, GBP4, GBP2, RNF213 | Interferon Signaling | -6,70 | -1,12 | |
| 4 | 6 | 0.93 | PKM, ENO3, ENO2, HK2, PFKP, CALB2 | Glycolysis | 9,64 | 1,61 | |
| 5 | 6 | 0.88 | HIF1A, EGLN3, PDK1, P4HA1, EFNA3, HIPK2 | Cellular response to hypoxia | 2,86 | 0,48 | |
| 48 hpi | 1 | 22 | 0,85 | BUB1, ESPL1, PLK1, CENPE, MKI67, PRC1, NEK2, CENPF, TUBG1, CCNF, PLK3, TPX2, GINS2, RACGAP1, KIF23, KIF2C, KIF20A, KIF15, DEPDC1, INCENP, KIF5A, RHOT1 | Cell Cycle, Mitotic | 18,68 | 0,85 |
| 2 | 14 | 0,77 | CD63, SCARB1, ITGB4, TGM2, ITGA9, LAMC1, ITGB1, ITGA4, LAMB3, TIMP3, MERTK, LTBP1, DMD, JAM3 | Extracellular matrix organization | -2,48 | -0,18 | |
| 3 | 13 | 0,77 | CD276, CD69, CST7, TNFRSF9, IL18RAP, IL1R2, CCL4, CCL5, CXCL3, CD83, CCR4, TNFSF9, MARCHF1 | Cytokine Signaling | -39,82 | -3,06 | |
| 4 | 13 | 0,84 | ISG15, IFIH1, IRF2, SAMD9L, IFI27, IFI44L, XAF1, IRF9, ISG20, RNASEL, RNF213, SAMHD1, APOL6 | Interferon alpha/beta signaling | 0,95 | 0,07 | |
| 5 | 10 | 0,66 | CSF3R, IL27RA, CSF2RA, IL3RA, LIF, IL13RA1, IL4R, JAK2, IL15RA, IL9R | Interleukin Signaling | -17,54 | -1,75 | |
| 6 | 10 | 0,81 | PCNA, POLE4, POLL, RAD51C, BARD1, AARS1, NUDT15, PNPT1, POLH, POLB | DNA Repair | -4,98 | -0,50 | |
| 7 | 9 | 0,83 | SLC2A3, ENO2, PFKL, ALDOA, PDK1, PMM1, ENO3, ALDOC, CALB2 | Glycolysis | 10,08 | 1,12 | |
| 8 | 9 | 0,76 | UQCRQ, NDUFS2, NDUFC2, ATP5PF, NDUFB2, TIMM17A, TIMM8B, MGST3, ATP6V1G1 | Respiratory electron transport | -5,21 | -0,58 | |
| 9 | 7 | 0,92 | SERPINE1, EGF, FURIN, DAB2, LDLR, STAM, SH3GL2 | Clathrin-mediated endocytosis | -8,65 | -1,24 | |
| 10 | 7 | 0,79 | MAFF, GCLC, ODC1, CTH, MTHFD2, SLC7A11, GFPT1 | Ferroptosis | 4,88 | 0,70 | |
| 11 | 6 | 0,82 | PPARG, CREBBP, SP1, PML, AGO4, HDAC9 | TGF-beta signaling pathway | -2,45 | -0,41 | |
| 12 | 6 | 0,84 | IDH2, IDH1, BCKDHA, IDH3A, ALDH6A1, CRAT | TCA cycle | 6,68 | 1,11 | |
References
- Qiu, J.; Soderlund-Venermo, M.; Young, N.S. Human Parvoviruses. Clin. Microbiol. Rev. 2017, 30, 43–113. [Google Scholar] [CrossRef] [PubMed]
- Gallinella, G. Parvoviridae. In Encyclopedia of Infection and Immunity; Rezaei, N., Ed.; Elsevier: Oxford, 2022; pp. 259–277. [Google Scholar]
- Filippone, C.; Franssila, R.; Kumar, A.; Saikko, L.; Kovanen, P.E.; Soderlund-Venermo, M.; Hedman, K. Erythroid progenitor cells expanded from peripheral blood without mobilization or preselection: molecular characteristics and functional competence. PLoS ONE 2010, 5, e9496. [Google Scholar] [CrossRef] [PubMed]
- Bua, G.; Manaresi, E.; Bonvicini, F.; Gallinella, G. Parvovirus B19 Replication and Expression in Differentiating Erythroid Progenitor Cells. PLoS ONE 2016, 11, e0148547. [Google Scholar] [CrossRef] [PubMed]
- Morita, E.; Tada, K.; Chisaka, H.; Asao, H.; Sato, H.; Yaegashi, N.; Sugamura, K. Human parvovirus B19 induces cell cycle arrest at G(2) phase with accumulation of mitotic cyclins. J. Virol. 2001, 75, 7555–7563. [Google Scholar] [CrossRef] [PubMed]
- Morita, E.; Nakashima, A.; Asao, H.; Sato, H.; Sugamura, K. Human parvovirus B19 nonstructural protein (NS1) induces cell cycle arrest at G(1) phase. J. Virol. 2003, 77, 2915–2921. [Google Scholar] [CrossRef] [PubMed]
- Wong, S.; Brown, K.E. Development of an improved method of detection of infectious parvovirus B19. J. Clin. Virol. 2006, 35, 407–413. [Google Scholar] [CrossRef] [PubMed]
- Ducloux, C.; You, B.; Langele, A.; Goupille, O.; Payen, E.; Chretien, S.; Kadri, Z. Enhanced Cell-Based Detection of Parvovirus B19V Infectious Units According to Cell Cycle Status. Viruses 2020, 12. [Google Scholar] [CrossRef] [PubMed]
- Fasano, E.; Guglietta, N.; Bichicchi, F.; Gasperini, I.; Manaresi, E.; Gallinella, G. Parvovirus B19 and Cellular Transcriptome Dynamics in Differentiating Erythroid Progenitor Cells. Viruses 2025, 18. [Google Scholar] [CrossRef] [PubMed]
- Manaresi, E.; Gallinella, G. Advances in the Development of Antiviral Strategies against Parvovirus B19. Viruses 2019, 11. [Google Scholar] [CrossRef] [PubMed]
- Mietzsch, M.; Penzes, J.J.; Agbandje-McKenna, M. Twenty-Five Years of Structural Parvovirology. Viruses 2019, 11. [Google Scholar] [CrossRef] [PubMed]
- Manaresi, E.; Conti, I.; Bua, G.; Bonvicini, F.; Gallinella, G. A Parvovirus B19 synthetic genome: sequence features and functional competence. Virology 2017, 508, 54–62. [Google Scholar] [CrossRef] [PubMed]
- Bonvicini, F.; Filippone, C.; Delbarba, S.; Manaresi, E.; Zerbini, M.; Musiani, M.; Gallinella, G. Parvovirus B19 genome as a single, two-state replicative and transcriptional unit. Virology 2006, 347, 447–454. [Google Scholar] [CrossRef] [PubMed]
- Bonvicini, F.; Filippone, C.; Manaresi, E.; Zerbini, M.; Musiani, M.; Gallinella, G. Functional analysis and quantitative determination of the expression profile of human parvovirus B19. Virology 2008, 381, 168–177. [Google Scholar] [CrossRef]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. Gigascience 2021, 10. [Google Scholar] [CrossRef] [PubMed]
- Shen, W.; Sipos, B.; Zhao, L. SeqKit2: A Swiss army knife for sequence and alignment processing. Imeta 2024, 3, e191. [Google Scholar] [CrossRef] [PubMed]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef] [PubMed]
- Mudge, J.M.; Carbonell-Sala, S.; Diekhans, M.; Martinez, J.G.; Hunt, T.; Jungreis, I.; Loveland, J.E.; Arnan, C.; Barnes, I.; Bennett, R.; et al. GENCODE 2025: reference gene annotation for human and mouse. Nucleic Acids Res. 2025, 53, D966–D975. [Google Scholar] [CrossRef] [PubMed]
- Soneson, C.; Love, M.I.; Robinson, M.D. Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences. F1000Res 2015, 4, 1521. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Chen, L.; Lun, A.T.L.; Baldoni, P.L.; Smyth, G.K. edgeR v4: powerful differential analysis of sequencing data with expanded functionality and improved support for small counts and larger datasets. Nucleic Acids Res. 2025, 53. [Google Scholar] [CrossRef] [PubMed]
- McCarthy, D.J.; Chen, Y.; Smyth, G.K. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids Res. 2012, 40, 4288–4297. [Google Scholar] [CrossRef] [PubMed]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Lindsay, H.; Robinson, M.D. Robustly detecting differential expression in RNA sequencing data using observation weights. Nucleic Acids Res. 2014, 42, e91. [Google Scholar] [CrossRef] [PubMed]
- Gu, Z. Complex heatmap visualization. Imeta 2022, 1, e43. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Smyth, G.K. Camera: a competitive gene set test accounting for inter-gene correlation. Nucleic Acids Res. 2012, 40, e133. [Google Scholar] [CrossRef] [PubMed]
- Liberzon, A.; Birger, C.; Thorvaldsdottir, H.; Ghandi, M.; Mesirov, J.P.; Tamayo, P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015, 1, 417–425. [Google Scholar] [CrossRef] [PubMed]
- Manaresi, E.; Bua, G.; Bonvicini, F.; Gallinella, G. A flow-FISH assay for the quantitative analysis of parvovirus B19 infected cells. J. Virol. Methods 2015, 223, 50–54. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Kirsch, R.; Koutrouli, M.; Nastou, K.; Mehryary, F.; Hachilif, R.; Gable, A.L.; Fang, T.; Doncheva, N.T.; Pyysalo, S.; et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 2023, 51, D638–D646. [Google Scholar] [CrossRef] [PubMed]
- Ragueneau, E.; Gong, C.; Sinquin, P.; Sevilla, C.; Beavers, D.; Grentner, A.; Griss, J.; Hogue, G.F.J.; Li, N.T.; Matthews, L.; et al. The Reactome Knowledgebase 2026. Nucleic Acids Res. 2026, 54, D673–D681. [Google Scholar] [CrossRef] [PubMed]










| Sample | DNA | mRNA1-5 | % | mRNA1 | % | mRNA3-5 | % |
|---|---|---|---|---|---|---|---|
| 2 hpi | 8.96E+05 | 3.66E+02 | - | 2.36E+02 | - | 1.96E+02 | - |
| 16 hpi | 6.79E+05 | 1.90E+06 | 100 | 3.91E+05 | 20.59 | 1.69E+04 | 0.89 |
| 48 hpi | 1.01E+07 | 5.70E+07 | 100 | 2.30E+06 | 4.04 | 1.28E+07 | 22.38 |
| Region | nt Start* | nt End* | % 16 hpi§ | % 48 hpi§ |
|---|---|---|---|---|
| Leader | 530 | 585 | 0.23 | 0.28 |
| Intron NS | 586 | 2088 | 0.06 | 0.02 |
| Exon Long | 2089 | 2208 | 0.24 | 0.24 |
| Exon Short | 2209 | 2362 | 0.17 | 0.19 |
| pAp1 | 2363 | 2841 | 0.08 | 0.07 |
| pAp2 | 2842 | 3141 | 0.05 | 0.04 |
| Exon VP1 | 2842 | 3223 | 0.07 | 0.07 |
| Exon VP2 | 3224 | 4882 | 0.04 | 0.03 |
| pAd | 4883 | 5189 | 0.05 | 0.05 |
| Terminal | 5190 | 5213 | 0.03 | 0.01 |
| Region | nt Start* | nt End* | % 16 hpi§ | % 48 hpi§ |
|---|---|---|---|---|
| Splicing | ||||
| D1-no splicing | 585 | 586 | 0.13 | 0.05 |
| D1-A1.1 | 586 | 2088 | 0.51 | 0.53 |
| D1-A1.2 | 586 | 2208 | 0.37 | 0.42 |
| D2-no splicing | 2362 | 2363 | 0.41 | 0.41 |
| D2-A2.1 | 2362 | 3141 | 0.25 | 0.21 |
| D2-A2.2 | 2362 | 4882 | 0.34 | 0.38 |
| Cleavage | ||||
| pAp1 | 2841 | 2842 | 0.61 | 0.51 |
| pAp2 | 3141 | 3142 | N.D. | N.D. |
| pAd | 5190 | 5191 | 0.37 | 0.71 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).