Submitted:
22 July 2026
Posted:
22 July 2026
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Material and Methods
2.1. Ethical Approval
2.2. Study Design
2.3. Inclusion Criteria and Exclusion Criteria
2.4. Blood Drawn and Isolation of PBMCs
2.5. RNA Extraction, cDNA Synthesis and Q-PCR
2.6. Statistical Analysis
3. Results
3.1. Participants Demographics
3.2. Equivalence Test Revealed the Two Groups Are not Equivalent
3.3. Effects of Two Dosing Regimens on the Senescent Gene Expression at the Primary Endpoint Day 45
3.4. Effects of Two Fisetin Dosing Regimen on the Senescent Gene Expression at Other Time Points
3.5. The Senescent Gene Expression Did not Correlate with Participant’s Age in this Aged Population
4. Discussion
5. Conclusion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Use of Artificial Intelligence
Acknowledgments
Conflicts of Interest
References
- Xu, M.; Pirtskhalava, T.; Farr, J.N.; Weigand, B.M.; Palmer, A.K.; Weivoda, M.M.; Inman, C.L.; Ogrodnik, M.B.; Hachfeld, C.M.; Fraser, D.G.; et al. Senolytics improve physical function and increase lifespan in old age. Nat. Med. 2018, 24, 1246–1256. [Google Scholar] [CrossRef] [PubMed]
- Farr, J.N.; Xu, M.; Weivoda, M.M.; Monroe, D.G.; Fraser, D.G.; Onken, J.L.; Negley, B.A.; Sfeir, J.G.; Ogrodnik, M.B.; Hachfeld, C.M.; et al. Targeting cellular senescence prevents age-related bone loss in mice. Nat. Med. 2017, 23, 1072–1079. [Google Scholar] [CrossRef] [PubMed]
- Chaib, S.; Tchkonia, T.; Kirkland, J.L. Cellular senescence and senolytics: the path to the clinic. Nat. Med. 2022, 28, 1556–1568. [Google Scholar] [CrossRef] [PubMed]
- Justice, J.N.; Nambiar, A.M.; Tchkonia, T.; LeBrasseur, N.K.; Pascual, R.; Hashmi, S.K.; Prata, L.; Masternak, M.M.; Kritchevsky, S.B.; Musi, N.; et al. Senolytics in idiopathic pulmonary fibrosis: Results from a first-in-human, open-label, pilot study. EBioMedicine 2019, 40, 554–563. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Prata, L.; Gerdes, E.O.W.; Netto, J.M.E.; Pirtskhalava, T.; Giorgadze, N.; Tripathi, U.; Inman, C.L.; Johnson, K.O.; Xue, A.; et al. Orally-active, clinically-translatable senolytics restore alpha-Klotho in mice and humans. EBioMedicine 2022, 77, 103912. [Google Scholar] [CrossRef] [PubMed]
- Gonzales, M.M.; Garbarino, V.R.; Kautz, T.F.; Palavicini, J.P.; Lopez-Cruzan, M.; Dehkordi, S.K.; Mathews, J.J.; Zare, H.; Xu, P.; Zhang, B.; et al. Senolytic therapy in mild Alzheimer’s disease: a phase 1 feasibility trial. Nat. Med. 2023, 29, 2481–2488. [Google Scholar] [CrossRef] [PubMed]
- Millar, C.L.; Iloputaife, I.; Baldyga, K.; Norling, A.M.; Boulougoura, A.; Vichos, T.; Tchkonia, T.; Deisinger, A.; Pirtskhalava, T.; Kirkland, J.L.; et al. A pilot study of senolytics to improve cognition and mobility in older adults at risk for Alzheimer’s disease. EBioMedicine 2025, 113, 105612. [Google Scholar] [CrossRef] [PubMed]
- Farr, J.N.; Atkinson, E.J.; Achenbach, S.J.; Volkman, T.L.; Tweed, A.J.; Vos, S.J.; Ruan, M.; Sfeir, J.; Drake, M.T.; Saul, D.; et al. Effects of intermittent senolytic therapy on bone metabolism in postmenopausal women: a phase 2 randomized controlled trial. Nat. Med. 2024, 30, 2605–2612. [Google Scholar] [CrossRef] [PubMed]
- Yousefzadeh, M.J.; Zhu, Y.; McGowan, S.J.; Angelini, L.; Fuhrmann-Stroissnigg, H.; Xu, M.; Ling, Y.Y.; Melos, K.I.; Pirtskhalava, T.; Inman, C.L.; et al. Fisetin is a senotherapeutic that extends health and lifespan. EBioMedicine 2018, 36, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Huard, C.A.; Gao, X.; Dey Hazra, M.E.; Dey Hazra, R.O.; Lebsock, K.; Easley, J.T.; Millett, P.J.; Huard, J. Effects of Fisetin Treatment on Cellular Senescence of Various Tissues and Organs of Old Sheep. Antioxidants 2023, 12. [Google Scholar] [CrossRef] [PubMed]
- Tavenier, J.; Nehlin, J.O.; Houlind, M.B.; Rasmussen, L.J.; Tchkonia, T.; Kirkland, J.L.; Andersen, O.; Rasmussen, L.J.H. Fisetin as a senotherapeutic agent: Evidence and perspectives for age-related diseases. Mech. Ageing Dev. 2024, 222, 111995. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3--new capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [PubMed]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed]
- Koressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef] [PubMed]
- Reiner, A.; Yekutieli, D.; Benjamini, Y. Identifying differentially expressed genes using false discovery rate controlling procedures. Bioinformatics 2003, 19, 368–375. [Google Scholar] [CrossRef] [PubMed]
- Murray, K.O.; Mahoney, S.A.; Ludwig, K.R.; Miyamoto-Ditmon, J.H.; VanDongen, N.S.; Banskota, N.; Herman, A.B.; Seals, D.R.; Mankowski, R.T.; Rossman, M.J.; et al. Intermittent Supplementation With Fisetin Improves Physical Function and Decreases Cellular Senescence in Skeletal Muscle With Aging: A Comparison to Genetic Clearance of Senescent Cells and Synthetic Senolytic Approaches. Aging Cell 2025, 24, e70114. [Google Scholar] [CrossRef] [PubMed]
- Fang, Y.; Peck, M.R.; Quinn, K.; Chapman, J.E.; Medina, D.; McFadden, S.A.; Bartke, A.; Hascup, E.R.; Hascup, K.N. Senolytic intervention improves cognition, metabolism, and adiposity in female APP(NL)(-F/NL-F) mice. Geroscience 2025, 47, 1123–1138. [Google Scholar] [CrossRef] [PubMed]
- Hickson, L.J.; Langhi Prata, L.G.P.; Bobart, S.A.; Evans, T.K.; Giorgadze, N.; Hashmi, S.K.; Herrmann, S.M.; Jensen, M.D.; Jia, Q.; Jordan, K.L.; et al. Senolytics decrease senescent cells in humans: Preliminary report from a clinical trial of Dasatinib plus Quercetin in individuals with diabetic kidney disease. EBioMedicine 2019, 47, 446–456. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Wang, L.; Gasek, N.S.; Kuo, C.L.; Nie, J.; Kim, T.; Yan, P.; Zhu, J.; Torrance, B.L.; Zhou, Y.; et al. Intermittent clearance of p21-highly-expressing cells extends lifespan and confers sustained benefits to health and physical function. Cell Metab. 2024, 36, 1795–1805 e1796. [Google Scholar] [CrossRef] [PubMed]
- Mahoney, S.A.; Mazan-Mamczarz, K.; Tsitsipatis, D.; VanDongen, N.S.; Henry-Smith, C.; Okereke, A.N.; Munk, R.; Darvish, S.; Murray, K.O.; De, S.; et al. Senolytic Treatment With Fisetin Reverses Age-Related Endothelial Dysfunction Partially Mediated by SASP Factor CXCL12. Aging Cell 2026, 25, e70500. [Google Scholar] [CrossRef] [PubMed]
- Henschke, A.; Grzeskowiak, B.; Ivashchenko, O.; Sanchez-Cervino, M.C.; Coy, E.; Moya, S. Targeting Cellular Senescence with Liposome-Encapsulated Fisetin: Evidence of Senomorphic Effect. Int. J. Mol. Sci. 2025, 26. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Pitcher, L.E.; Yousefzadeh, M.J.; Niedernhofer, L.J.; Robbins, P.D.; Zhu, Y. Cellular senescence: a key therapeutic target in aging and diseases. J. Clin. Invest 2022, 132. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Chen, K.X.; He, C.; Li, X.X.; Huang, M.; Jiang, Y.Z.; Jiao, Y.R.; Xiao, Q.N.; He, W.Z.; Liu, L.; et al. Aged bone marrow macrophages drive systemic aging and age-related dysfunction via extracellular vesicle-mediated induction of paracrine senescence. Nat. Aging 2024, 4, 1562–1581. [Google Scholar] [CrossRef] [PubMed]
- Koo, S.; Won, M.; Li, H.; Kim, W.Y.; Li, M.; Yan, C.; Sharma, A.; Guo, Z.; Zhu, W.H.; Sessler, J.L.; et al. Harnessing alpha-l-fucosidase for in vivo cellular senescence imaging. Chem. Sci. 2021, 12, 10054–10062. [Google Scholar] [CrossRef] [PubMed]
- Saul, D.; Kosinsky, R.L.; Atkinson, E.J.; Doolittle, M.L.; Zhang, X.; LeBrasseur, N.K.; Pignolo, R.J.; Robbins, P.D.; Niedernhofer, L.J.; Ikeno, Y.; et al. A new gene set identifies senescent cells and predicts senescence-associated pathways across tissues. Nat. Commun. 2022, 13, 4827. [Google Scholar] [CrossRef] [PubMed]



| Gene IDs | Accession number | Forward Primers (5’-3’) | Reverse Primers (5’-3’) | Product size (bp) |
| GAPDH | BC023632 | gccttccgtgtccccactgc | caatgccagccccagcgtca | 211 |
| GLB1 | M34423.1 | ctatagccgggactccttcc | agttccagggcacatacgtc | 158 |
| P16 | L27211 | cttcctggacacgctggt | gaccttccgcggcatctatg | 185 |
| P21 | BC000312.2 | caagctctaccttcccacgg | atctgtcatgctggtctgcc | 226 |
| MIF | EF611126.1 | agaaccgctcctacagcaag | gagttgttccaccccacatt | 121 |
| FUCA1 | BC017338.2 | cttcatgcgcgacaactac | gccagtttgtgaagccttcg | 166 |
| Characteristics | Total (N=81) | Daily dose (N=41) | Bolus dose (N=40) |
| Sex | |||
| Female | 48 / 81 (59%) | 25 / 41 (61%) | 23 / 40 (58%) |
| Male | 33 / 81 (41%) | 16 / 41 (39%) | 17 / 40 (43%) |
| Age at Enrollment | |||
| Median [Min, Max] | 69 [55,85] | 69 [57,85] | 69 [55,79] |
| (Q1, Q3) | (63, 74) | (62, 72) | (63, 75) |
| Mean ± SD | 68 ± 7 | 68 ± 7 | 68 ± 7 |
| Ethnicity | |||
| Non-Hispanic | 80 / 81 (99%) | 41 / 41 (100%) | 39 / 40 (98%) |
| Unknown or Not Reported | 1 / 81 (1.2%) | 0 / 41 (0%) | 1 / 40 (2.5%) |
| Race | |||
| Asian | 1 / 81 (1.2%) | 1 / 41 (2.4%) | 0 / 40 (0%) |
| Black or African American | 1 / 81 (1.2%) | 1 / 41 (2.4%) | 0 / 40 (0%) |
| White or Caucasian | 79 / 81 (98%) | 39 / 41 (95%) | 40 / 40 (100%) |
| Smoker Status | |||
| Current | 1 / 81 (1.2%) | 0 / 41 (0%) | 1 / 40 (2.5%) |
| Former | 5 / 81 (6.2%) | 1 / 41 (2.4%) | 4 / 40 (10%) |
| Never | 75 / 81 (93%) | 40 / 41 (98%) | 35 / 40 (88%) |
| BMI | |||
| Median [Min, Max] | 23.9 [16.3, 33.5] | 23.9 [16.3, 31.5] | 24.0 [18.0, 33.5] |
| (Q1, Q3) | (20.9, 25.8) | (20.5, 25.8) | (22.1, 26.0) |
| Mean ± SD | 23.9 ± 3.6 | 23.6 ± 3.7 |
|
| Gene | Equivalence Bounds | Difference in means | 95% Confidence Interval | P value |
| GLB1 | -0.193, +0.193 | 0.039 | -0.237, +0.315 | 0.179 |
| P16 | -0.260, +0.260 | 0.120 | -0.462, +0.701 | 0.345 |
| P21 | -0.124, +0.124 | 0.071 | -0.322, +0.465 | 0.412 |
| MIF | -0.263, +0.263 | 0.461 | +0.155, +0.767 | 0.857 |
| FUCA1 | -0.126, +0.126 | 0.260 | -0.028, +0.549 | 0.780 |
| Gene | Estimate | 95% Confidence Interval | P value | FDR |
| GLB1 | -0.040 | -0.363, +0.282 | 0.804 | 1 |
| P16 | -0.129 | -0.797, +0.538 | 0.701 | 1 |
| P21 | -0.072 | -0.533, +0.390 | 0.758 | 1 |
| MIF | -0.474 | -0.828, -0.121 | 0.009 | 0.104 |
| FUCA1 | -0.254 | -0.589, +0.081 | 0.135 | 0.770 |
| Group | Gene | Fold Change | 95% CI | P (one-sided) | FDR |
| Daily | GLB1 | 0.79 | 0.70-0.89 | 0.0001 | 0.0014 |
| Daily | P16 | 0.76 | 0.58-1.00 | 0.0239 | 0.1365 |
| Daily | P21 | 0.88 | 0.74-1.06 | 0.0869 | 0.3308 |
| Daily | MIF | 0.96 | 0.78-1.18 | 0.3289 | 0.9388 |
| Daily | FUCA1 | 1.01 | 0.87-1.17 | 0.5305 | 1.0000 |
| Bolus | GLB1 | 0.77 | 0.63-0.93 | 0.0042 | 0.0240 |
| Bolus | P16 | 0.70 | 0.47-1.04 | 0.0372 | 0.1061 |
| Bolus | P21 | 0.84 | 0.64-1.11 | 0.1046 | 0.2389 |
| Bolus | MIF | 0.69 | 0.59-0.81 | <0.0001 | 0.0002 |
| Bolus | FUCA1 | 0.84 | 0.69-1.02 | 0.0351 | 0.1061 |
| Daily Dose | Bolus Dose | |||||||
| Characteristic |
Day 15 N=41 |
Day 35 N=39 |
Day 45 N=36 |
Day 60 N=36 |
Day 15 N=40 |
Day 35 N=37 |
Day 45 N=39 |
Day 60 N=39 |
| GLB1 | ||||||||
| Median (Min, Max) |
0.91 (0.19, 2.55) |
0.84 (0.19, 4.58) |
0.80 (0.29, 1.73) |
0.90 (0.17, 8.74) |
0.92 (0.21, 2.37) |
0.91 (0.13, 1.82) |
0.84 (0.06, 1.64) |
0.77 (0.08, 2.26) |
| Meana (Mean-SE, Mean+SE)b |
0.93 (0.86, 1.01) |
0.87 (0.79, 0.96) |
0.79 (0.74, 0.83) |
0.89 (0.80, 0.98) |
0.87 (0.81, 0.93) |
0.77 (0.70, 0.84) |
0.77 (0.70, 0.84) |
0.71 (0.64, 0.80) |
| P16 | ||||||||
| Median (Min, Max) |
0.89 (0.07, 3.22) |
1.01 (0.04, 4.74) |
0.77 (0.06, 3.31) |
0.80 (0.04, 19.39) |
0.80 (0.00, 5.96) |
0.75 (0.00, 7.28) |
0.75 (0.00, 42.29) |
0.98 (0.00, 35.35) |
| Mean* (Mean-SE, Mean+SE)ǂ |
0.90 (0.82, 1.01) |
0.89 (0.78, 1.00) |
0.76 (0.66, 0.87) |
0.90 (0.74, 1.08) |
0.73 (0.62, 0.86) |
0.70 (0.57, 0.85) |
0.70 (0.57, 0.85) |
0.93 (0.74, 1.16) |
| P21 | ||||||||
| Median (Min, Max) |
1.03 (0.19, 14.49) |
1.11 (0.22, 3.91) |
0.90 (0.19, 2.34) |
0.90 (0.12, 111.71) |
0.84 (0.24, 4.16) |
0.84 (0.17, 11.11) |
0.92 (0.12, 22.75) |
0.82 (0.08, 60.33) |
| Mean* (Mean-SE, Mean+SE)ǂ |
1.18 (1.05, 1.33) |
0.97 (0.87, 1.08) |
0.88 (0.81, 0.97) |
0.98 (0.82, 1.18) |
0.90 (0.81, 1.00) |
0.94 (0.83, 1.07) |
0.84 (0.74, 0.96) |
0.97 (0.80, 1.18) |
| MIF | ||||||||
| Median (Min, Max) |
1.02 (0.03, 9.05) |
0.96 (0.40, 7.84) |
0.94 (0.34, 7.59) |
0.94 (0.33, 10.07) |
0.74 (0.28, 2.47) |
0.81 (0.20, 2.54) |
0.69 (0.21, 1.36) |
0.85 (0.13, 6.83) |
| Mean* (Mean-SE, Mean+SE)ǂ |
0.98 (0.86, 1.12) |
1.03 (0.94, 1.14) |
0.96 (0.86, 1.06) |
1.00 (0.89, 1.12) |
0.78 (0.73, 0.84) |
0.76 (0.69, 0.84) |
0.69 (0.64, 0.75) |
0.79 (0.70, 0.89) |
| Not Available, n | 0 | 0 | 0 | 0 | 1 | 1 | 1 | 1 |
| FUCA1 | ||||||||
| Median (Min, Max) |
0.94 (0.06, 3.18) |
0.93 (0.43, 2.38) |
1.03 (0.30, 2.37) |
1.12 (0.38, 3.06) |
0.93 (0.12 , 2.38) |
0.92 (0.03, 2.56) |
1.00 (0.06, 2.18) |
0.96 (0.08, 2.54) |
| Mean* (Mean-SE, Mean+SE)ǂ |
0.97 (0.87, 1.08) |
0.97 (0.90, 1.05) |
1.01 (0.94, 1.08) |
1.06 (0.99, 1.15) |
0.88 (0.81, 0.96) |
0.78 (0.68, 0.89) |
0.84 (0.76, 0.92) |
0.90 (0.80, 1.00) |
| Daily Dose | Bolus Dose | |||||||
| Target genes |
Day 15 N=41 |
Day 35 N=39 |
Day 45 N=36 |
Day 60 N=36 |
Day 15 N=40 |
Day 35 N=37 |
Day 45 N=39 |
Day 60 N=39 |
| GLB1 | ||||||||
| P value | 0.2015 | 0.0850 | 0.0001 | 0.1285 | 0.0248 | 0.0023 | 0.0042 | 0.0022 |
| FDR | 1 | 0.9448 | 0.0014 | 1 | 0.1233 | 0.0265 | 0.0240 | 0.0246 |
| P16 | ||||||||
| P value | 0.1607 | 0.1655 | 0.0239 | 0.2857 | 0.0324 | 0.0387 | 0.0372 | 0.3713 |
| FDR | 1 | 0.9448 | 0.1365 | 1 | 0.1233 | 0.1106 | 0.1061 | 1 |
| P21 | ||||||||
| P value | 0.9220 | 0.3933 | 0.0869 | 0.4647 | 0.1632 | 0.3296 | 0.1046 | 0.4427 |
| FDR | 1 | 1 | 0.3308 | 1 | 0.3725 | 0.7526 | 0.2389 | 1 |
| MIF | ||||||||
| P value | 0.4526 | 0.6255 | 0.3289 | 0.4985 | 0.0011 | 0.0048 | <0.0001 | 0.0261 |
| FDR | 1 | 1 | 0.9388 | 1 | 0.0124 | 0.0276 | 0.0002 | 0.1487 |
| FUCA1 | ||||||||
| P value | 0.4008 | 0.3680 | 0.5305 | 0.7932 | 0.0776 | 0.0352 | 0.0351 | 0.1692 |
| FDR | 1 | 1 | 1 | 1 | 0.2216 | 0.1106 | 0.1061 | 0.6439 |
| Gene | Estimate of difference in CV | Lower Limit 95% CI | P value | FDR |
| GLB1 | -1.79 | -6.41 | 0.755 | 1 |
| P16 | 7.07 | -1.16 | 0.077 | 0.291 |
| P21 | 9.30 | 0.92 | 0.030 | 0.173 |
| MIF | 2.67 | -5.90 | 0.242 | 0.690 |
| FUCA1 | 8.62 | 1.38 | 0.028 | 0.173 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).