Submitted:
14 July 2026
Posted:
15 July 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Vaccine Preparation
2.2. Fish and Experimental Conditions
2.3. Anaesthesia and Handling
2.4. Vaccination
2.4.1. Immersion Vaccination
2.4.2. Intraperitoneal (i.p.) Vaccination
2.5. Sampling for Evaluation of Immune Response
2.5.1. Sampling for Gene Expression Analyses
2.5.2. Sampling for Detection of IgM in Sera
2.6. Challenge
2.7. Relative Percent of Survival
2.8. Evaluation of Immune Response
2.8.1. Gene Expression Analysis
2.8.1.1. RNA Extraction and cDNA Synthesis
2.8.1.2. Quantitative Real-Time PCR (qRT-PCR)
2.8.2. Titration of Serum IgM Against T. maritimum
2.9. Statistical Analysis
3. Results
3.1. Survival of Vaccinated Fish After T. maritimum Challenge
3.2. IL-1β Expression Following Vaccination Against T. maritimum
3.3. IL-10 Expression Following Vaccination Against T. maritimum
3.4. IgT Expression Following Vaccination Against T. maritimum


3.5. Result of Gene Expression
3.6. IgM Response in Vaccinated Seabass
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CFU | Colony-Forming Unit |
| I.P. | Intraperitoneal |
| MB | Marine Broth |
| PBS | Phosphate-buffered saline |
| PCA | Principal component analysis |
| RPS | Relative percentage of survival |
| RT | Room temperature |
| TSA | Tryptic Soy Agar |
References
- Avendaño-Herrera, R.; Toranzo, A.E.; Magariños, B. Tenacibaculosis infection in marine fish caused by Tenacibaculum maritimum: A review. Dis. Aquat. Organ. 2006, 71, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Elanco. Technical report: An overview of emerging diseases in the salmonid farming industry; Elanco Canada Ltd.: Canada, 2018. [Google Scholar]
- Masumura, K.; Wakabayashi, H. An outbreak of gliding bacterial disease in hatchery-born red seabream and gilthead fry. Fish. Pathol. 1977, 12, 171–177. [Google Scholar] [CrossRef]
- Pepin, J.F.; Emery, E. Marine cytophaga-like bacteria isolated from diseased reared sea bass (Dicentrarchus labrax L.) from the French Mediterranean coast. Bull. Eur. Assoc. Fish. Pathol. 1993, 13, 165–167. [Google Scholar]
- Salati, F.; Cubadda, C.; Viale, I.; Kusuda, R. Immune response of sea bass (Dicentrarchus labrax) to Tenacibaculum maritimum antigens. Fish. Sci. 2005, 71, 563–567. [Google Scholar] [CrossRef]
- Kolygas, M.N.; Gourzioti, E.; Vatsos, I.N.; Athanassopoulou, F. Identification of Tenacibaculum maritimum strains from marine farmed fish in Greece. Vet. Rec. 2012, 170, 623. [Google Scholar] [CrossRef] [PubMed]
- Yardımcı, E.R.; Timur, G. Isolation and identification of Tenacibaculum maritimum in farmed European sea bass in Turkey. Isr. J. Aquac. Bamidgeh 2015, 67. [Google Scholar] [CrossRef]
- Zrnčić, S.; Oraić; Račić, I.; Beck, R. Tenacibaculum maritimum isolated from sea bass (Dicentrarchus labrax) in Croatia. 16th International Conference on Diseases of Fish and Shellfish, Tampere, Sept. 2-6, 2013; p. 387. [Google Scholar]
- Kingsbury, M.V.; Hamoutene, D.; Kraska, P.; Lacoursière-Roussel, A.; Page, F.; Coyle, T.; Sutherland, T.; Gibb, O.; McKindsey, C.W.; Hartog, F.; Neil, S.; Chernoff, K.; Wong, D.; Law, B.A.; Brager, L.; Baillie, S.M.; Black, M.; Bungay, T.; Gaspard, D.; Hua, K.; Parsons, G.J. Relationship between in-feed drugs, antibiotics and organic enrichment in marine sediments at Canadian Atlantic salmon aquaculture sites. Mar. Pollut. Bull. 2023, 188, 114654. [Google Scholar] [CrossRef] [PubMed]
- Yun, S.; Giri, S.S.; Kim, H.J.; et al. Enhanced bath immersion vaccination through microbubble treatment in cyprinid loach. Fish. Shellfish Immunol. 2019, 91, 12–18. [Google Scholar]
- Plant, K.P.; LaPatra, S.E. Advances in fish vaccine delivery. Dev. Comp. Immunol. 2011, 35, 1256–1262. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.H.; Khansari, A.R.; Teles, M.; Martinez-Rodriguez, G.; Zhang, Y.G.; Mancera, J.M.; Reyes-Lopez, F.E.; Tort, L. Brain and pituitary response to vaccination in gilthead seabream (Sparus aurata L.). Front. Physiol. 2019, 10, 717. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Atienza, E.; Díaz-Rosales, P.; Tafalla, C. Systemic and mucosal B and T cell responses upon mucosal vaccination of teleost fish. Front. Immunol. 2021, 11, 622377. [Google Scholar] [CrossRef] [PubMed]
- Adams, A. Progress, challenges and opportunities in fish vaccine development. Fish. Shellfish Immunol. 2019, 90, 210–214. [Google Scholar] [CrossRef] [PubMed]
- Valdenegro-Vega, V.A.; Crosbie, P.; Vincent, B.; Cain, K.D.; Nowak, B.F. Effect of immunization route on mucosal and systemic immune responses in Atlantic salmon. Vet. Immunol. Immunopathol. 2013, 151, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Afonso, A.; Gomes, S.; da Silva, J.; Marques, F.; Henrique, M. Side effects in sea bass (Dicentrarchus labrax L.) due to intraperitoneal vaccination against vibriosis and pasteurellosis. Fish. Shellfish Immunol. 2005, 19, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Azizi, S.; Balasch, J.C.; Cartan, S.; Jerez-Cepa, I.; Mancera, J.M.; Tort, L.; Khansari, A.R. Enhancing farmed fish welfare: Evaluating the effectiveness of plant-based stress mitigating agents as sedatives in sea bass (Dicentrarchus labrax) following intraperitoneal vaccination. Fish. Shellfish Immunol. 2025, 156, 110058. [Google Scholar] [CrossRef] [PubMed]
- Forthal, D.N. Functions of antibodies. Microbiol. Spectr. 2014, 2. [Google Scholar] [CrossRef] [PubMed]
- Dickerson, H.W.; Findly, R.C. Vertebrate adaptive immunity—Comparative insights from a teleost model. Front. Immunol. 2017, 8, 1379. [Google Scholar] [CrossRef] [PubMed]
- Semple, S.L.; Dixon, B. Salmonid antibacterial immunity: An aquaculture perspective. Biology 2020, 9, 331. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, M.; Machado, M.; Mota, C.S.C.; Abreu, H.; Silva, J.; Maia, M.R.G.; Kiron, V.; Costas, B.; Valente, L.M.P. Micro- and macroalgae blend modulates the mucosal and systemic immune responses of European seabass (Dicentrarchus labrax) upon infection with Tenacibaculum maritimum. Aquaculture 2023, 566, 739222. [Google Scholar] [CrossRef]
- Buonocore, F.; Stocchi, V.; Nunez-Ortiz, N.; Randelli, E.; Gerdol, M.; Pallavicini, A.; Facchiano, A.; Bernini, C.; Guerra, L.; Scapigliati, G.; Picchietti, S. Immunoglobulin T from sea bass (Dicentrarchus labrax L.): Molecular characterization, tissue localization and expression after nodavirus infection. BMC Mol. Biol. 2017, 18, 8. [Google Scholar] [CrossRef] [PubMed]
- Mitter, K.; Kotoulas, G.; Magoulas, A.; Mulero, V.; Sepulcre, P.; Figueras, A.; Novoa, B.; Sarropoulou, E. Evaluation of candidate reference genes for qPCR during ontogenesis and in immune-relevant tissues of European seabass (Dicentrarchus labrax). Comp. Biochem. Physiol. 2009, 153, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Amend, D.F. Potency testing of fish vaccines. Dev. Biol. Stand. 1981, 49, 447–454. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2⁻ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Galeotti, M.; Romano, N.; Volpatti, D.; Bulfon, C.; Brunetti, A.; Tiscar, P.G.; Mosca, F.; Bertoni, F.; Marchetti, M.G.; Abelli, L. Innovative vaccination protocol against vibriosis in Dicentrarchus labrax (L.) juveniles: Improvement of immune parameters and protection to challenge. Vaccine 2013, 31, 1224–1230. [Google Scholar] [CrossRef] [PubMed]
- Engvall, E.; Perlmann, P. Enzyme-linked immunosorbent assay (ELISA): Quantitative assay of immunoglobulin G. Immunochemistry 1971, 8, 871–874. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2024. Available online: https://www.R-project.org.
- Wickham, H.; François, R.; Henry, L.; Müller, K.; Vaughan, D. dplyr: A Grammar of Data Manipulation; R package version 1.1.4. 2023. Available online: https://CRAN.R-project.org/package=dplyr.
- Paolini, A.; Ridolfi, V.; Zezza, D.; Cocchietto, M.; Musa, M.; Pavone, A.; Conte, A.; Giorgetti, G. Vaccination trials of sea bass (Dicentrarchus labrax) against pasteurellosis using oral, intraperitoneal and immersion methods. Vet. Ital. 2005, 41, 137–144. [Google Scholar] [PubMed]
- Mabrok, M.; Algammal, A.M.; Sivaramasamy, E.; Hetta, H.F.; Atwah, B.; Alghamdi, S.; Fawzy, A.; Avendaño-Herrera, R.; Rodkhum, C. Tenacibaculosis caused by Tenacibaculum maritimum: Updated knowledge of this marine bacterial fish pathogen. Front. Cell. Infect. Microbiol. 2023, 13, 1068000. [Google Scholar] [CrossRef] [PubMed]
- Miccoli, A.; Saraceni, P.R.; Scapigliati, G. Vaccines and immune protection of principal Mediterranean marine fish species. Fish. Shellfish Immunol. 2019, 94, 800–809. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, H. Choosing a furunculosis vaccine: Points to consider. Bull. Aquac. Assoc. Can. 1995, 95, 30–37. [Google Scholar]
- Bøgwald, J.; Dalmo, R.A. Review on immersion vaccines for fish: An update 2019. Microorganisms 2019, 7, 627. [Google Scholar] [CrossRef] [PubMed]
- Kong, W.G.; Qin, D.C.; Mu, Q.J.; Dong, Z.R.; Luo, Y.Z.; Ai, T.S.; Xu, Z. Mucosal immune responses and protective efficacy in yellow catfish after immersion vaccination with bivalent inactivated Aeromonas veronii and Edwardsiella ictaluri vaccine. Water Biol. Secur. 2022, 1, 100032. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, R.; Liu, L.; Ma, G.; Zhu, H. An IL-1β homologue induced inflammation and antibacterial immune defense in Siberian sturgeon (Acipenser baeri). Fish. Shellfish Immunol. 2021, 118, 283–293. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Duan, S.; Kong, L.; Tu, X.; Wang, L.; Guo, Z.; Ye, J. Interleukin-10 (IL-10) participates in host defense against bacterial pathogens and promotes IgM antibody production in Nile tilapia (Oreochromis niloticus). Aquaculture 2021, 531, 735829. [Google Scholar] [CrossRef]
- Rubtsov, Y.P.; Rasmussen, J.P.; Chi, E.Y.; Fontenot, J.; Castelli, L.; Ye, X.; Treuting, P.; Siewe, L.; Roers, A.; Henderson, W.R. Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity 2008, 28, 546–558. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Parra, D.; Gómez, D.; Salinas, I.; Zhang, Y.; von Gersdorff Jørgensen, L.; Heinecke, R.D.; Buchmann, K.; LaPatra, S.; Sunyer, J.O. Teleost skin, an ancient mucosal surface that elicits gut-like immune responses. Proc. Natl. Acad. Sci. USA 2013, 110, 13097–13102. [Google Scholar] [CrossRef] [PubMed]
- Salinas, I.; Fernández-Montero, Á.; Ding, Y.; Sunyer, J.O. Mucosal immunoglobulins of teleost fish: A decade of advances. Dev. Comp. Immunol. 2021, 121, 104079. [Google Scholar] [CrossRef] [PubMed]
- Ziklo, N.; Colorni, A.; Gao, L.Y.; Du, S.J.; Ucko, M. Humoral and cellular immune response of European seabass (Dicentrarchus labrax) vaccinated with heat-killed Mycobacterium marinum (iipA::kan mutant). J. Aquat. Anim. Health 2018, 30, 312–324. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Hu, X.; Miao, L.; Chen, J. Current status and development prospects of aquatic vaccines. Front. Immunol. 2022, 13, 1040336. [Google Scholar] [CrossRef] [PubMed]
- Parra, D.; Reyes-Lopez, F.E.; Tort, L. Mucosal immunity and B cells in teleosts: Effect of vaccination and stress. Front. Immunol. 2015, 6, 354. [Google Scholar] [CrossRef] [PubMed]
- Jaramillo, D.; Busby, B.P.; Bestbier, M.; Bennett, P.; Waddington, Z. New Zealand rickettsia-like organism and Tenacibaculum maritimum vaccine efficacy study. J. Fish. Dis. 2024, 47, e13883. [Google Scholar] [CrossRef] [PubMed]
- Angelidis, P.; Karagiannis, D.; Crump, E.M. Efficacy of a Listonella anguillarum (syn. Vibrio anguillarum) vaccine for juvenile sea bass (Dicentrarchus labrax). Dis. Aquat. Org. 2006, 71, 19–24. [Google Scholar] [CrossRef] [PubMed]
- Gravningen, K.; Thorarinsson, R.; Johansen, L.H.; Nissen, B.; Rikardsen, K.S.; Greger, E.; Vigneulle, M. Bivalent vaccines for sea bass (Dicentrarchus labrax) against vibriosis and pasteurellosis. J. Appl. Ichthyol. 1998, 14, 159–162. [Google Scholar] [CrossRef]
- Núñez-Ortiz, N.; Pascoli, F.; Picchietti, S.; Buonocore, F.; Bernini, C.; Toson, M.; Scapigliati, G.; Toffan, A. A formalin-inactivated immunogen against viral encephalopathy and retinopathy (VER) disease in European sea bass (Dicentrarchus labrax): immunological and protection effects. Vet. Res. 2016, 47, 89. [Google Scholar] [CrossRef] [PubMed]






| Experimental | Vaccination | Challenge | No. of fish per group | Mortality | Survival rate | RPS | |
|---|---|---|---|---|---|---|---|
| 2.2.1. | I.p. 0.2 mL/fish (6.0 x 107 CFU/mL) |
I.p. 0.1 mL/fish 7.2 x 107 CFU/mL |
10 | 1 | 87 | 67,5 | |
| 2.2.2. | 10 | 2 | |||||
| 2.2.3. | 10 | 1 | |||||
| 3.2. | I.p. mock vaccinated control |
30 | 12 | 60 | |||
| 2.1.1. | Immersion (3.75 x 106 CFU/mL) | Immersion 1.69 x 107 CFU/mL |
10 | 0 | 100 | 100 | |
| 2.1.2. | 10 | 0 | |||||
| 2.1.3. | 10 | 0 | |||||
| 3.1. | Immersion mock vaccinated control | 30 | 5 | 83 |
| Gene | Sequence (5′–3′) | |
|---|---|---|
| Fau | FOR | GACACCCAAGGTTGACAAGCAG |
| REV | GGCATTGAAGCACTTAGGAGTTG | |
| PROBE | CGCTTCGTGAATGTTGTGCCCACC | |
| L13a | FOR | TCTGGAGGACTGTCAGGGGCATGC |
| REV | AGACGCACAATCTTGAGAGCAG | |
| PROBE | CCGGCAACTTCTATCGCAACAAGCT | |
| IL10 | FOR | ATTACCCACCACCCACTGAC |
| REV | ATCTCTTCCACTATGCTCTCCAG | |
| PROBE | TCGTCTTATCTTTCTTCTGCACTGTCTGGT | |
| IL-1β | FOR | TCAGCACCCTGACGTCTGTC |
| REV | GGCACTCTCCTGGCACATCT | |
| PROBE | AGCAGAGGAGAACAACCGGCCG | |
| IgT | FOR | TGACTGTGCAGCCAGGTCAA |
| REV | TCCTTTCCCTGCAGGCTGTC | |
| PROBE | CCTGTCAGGTCTCTTATTCTGTTAGCAGCT | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).