Submitted:
14 July 2026
Posted:
15 July 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Development of HAp/PLGA/CS Shards
2.1.1. Freeze-Drying Method
2.1.2. 3D Printing Method
2.2. Physical and Structural Characterization of Both Types of Shackles
2.2.1. Total Porosity
2.2.2. Pore Distribution and Interconnectivity
2.2.3. Mechanical and Chemical Characterization
2.2.4. Energy-Dispersive X-Ray Spectroscopy (EDX) Analysis
2.3. Biocompatibility Evaluation of HAp/PLGA/CS Supports
2.3.1. hDPSC Cell Culture
2.3.2. Biocompatibility Assessment of hDPSC-Seeded Sheets
2.3.3. Cell Viability Analysis by Fluorescence Microscopy
2.3.4. Osteogenic Gene Expression Analysis
2.3.5. In Vitro Mineralization Assay
2.4. Finite Element Analysis (FEA) of Implant-Loaded HAp/PLGA/CS Scaffolds
2.4.1. Mechanical Property Evaluation of HAp/PLGA/CS Scaffolds
2.4.2. Finite Element Modeling and Simulation
- Applied load (N)
- Elastic modulus (Pa) and Poisson’s ratio
- Material density (kg/m3)
3. Results
3.1. Fabrication and Characterization of HAp/PLGA/CS Scaffolds


3.2. Physical and Structural Characterization of the Two Scaffold Types
3.2.1. Morphology-Derived Porosity

3.2.2. Pore Distribution and Interconnectivity
Freeze-Dried Scaffolds
3.3. Chemical Analysis of Scaffolds by Energy-Dispersive X-Ray Spectroscopy (EDX)
3.3.1. Freeze-Dried Scaffolds
3.3.2. 3D-Printed Scaffolds
3.4. Biocompatibility Evaluation of HAp/PLGA/Cs Freeze-Dried and 3D-Printed HAp/PLGA/CS Scaffolds
3.4.1. Morphological and Immunophenotypic Characterization of hDPSCs
3.4.2. Evaluation of Cell Viability and Adhesion in HAp/PLGA/CS Scaffolds by Fluorescence Optical Microscopy

3.4.3. Analysis of Bone-Related Gene Expression: RUNX2, Osterix (OSX), ALP, COL1 and Osteopontin (OPN)

3.4.4. Evaluation of Mineralized Nodule Formation by Alizarin Red S Staining

3.5. Finite Element Analysis of the Mechanical Properties of HAp/PLGA/CS Scaffolds with and Without Implant Loading

4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| HAp | Hydroxyapatite |
| PLGA | Poly(lactic-co-glycolic acid) |
| CS | Chitosan |
| hDPSCs | Human dental pulp stem cells |
| SEM | Scanning electron microscopy |
| EDX | Energy-dispersive X-ray spectroscopy |
| XRF | X-ray fluorescence |
| RT-qPCR | Reverse transcription quantitative polymerase chain reaction |
| ALP | Alkaline phosphatase |
| RUNX2 | Runt-related transcription factor 2 |
| OSX | Osterix |
| COL1 | Type I collagen |
| OP | Osteopontin |
| FEA | Finite element analysis |
| FEM | Finite element method |
References
- WHO. Global oral Health Status Report: Towards Universal Health Coverage for Oral Health by 2030; World Health Organization: Geneva, Switzerland, 18 November 2022; p. 100. [Google Scholar]
- Jain, N.; Dutt, U.; Radenkov, I.; Jain, S. WHO's global oral health status report 2022: Actions, discussion and implementation. Oral Dis. 2024, 30, 73–79. [Google Scholar] [CrossRef] [PubMed]
- Rosing, C.K.; Randall, C.; Giacaman, R.A. Editorial: Dental caries and periodontal diseases as non-communicable chronic diseases. Front Oral Health 2022, 3, 1113029. [Google Scholar] [CrossRef] [PubMed]
- Yen, A.-H.; Yelick, P.C. Dental Tissue Regeneration – A Mini-Review. Gerontology 2010, 57, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Walls, A.W.; Steele, J.G. The relationship between oral health and nutrition in older people. Mech. Ageing Dev. 2004, 125, 853–857. [Google Scholar] [CrossRef] [PubMed]
- Walls, A.W.; Steele, J.G.; Sheiham, A.; Marcenes, W.; Frsa, P. Oral Health and Nutrition in Older People. J. Public Health Dent. 2000, 60, 304–307. [Google Scholar] [CrossRef] [PubMed]
- Elgali, I.; Omar, O.; Dahlin, C.; Thomsen, P. Guided bone regeneration: Materials and biological mechanisms revisited. Eur. J. Oral Sci. 2017, 125, 315–337. [Google Scholar] [CrossRef] [PubMed]
- García-Gareta, E.; Coathup, M.J.; Blunn, G.W. Osteoinduction of bone grafting materials for bone repair and regeneration. Bone 2015, 81, 112–121. [Google Scholar] [CrossRef] [PubMed]
- Abdulghani, S.; Mitchell, G.R. Biomaterials for In Situ Tissue Regeneration: A Review. Biomolecules 2019, 9, 750. [Google Scholar] [CrossRef] [PubMed]
- O'Brien, F.J. Biomaterials & scaffolds for tissue engineering. Mater. Today 2011, 14, 88–95. [Google Scholar] [CrossRef]
- Chu, T.M.; Orton, D.G.; Hollister, S.J.; Feinberg, S.E.; Halloran, J.W. Mechanical and in vivo performance of hydroxyapatite implants with controlled architectures. Biomaterials 2002, 23, 1283–1293. [Google Scholar] [CrossRef] [PubMed]
- Boga, J.C.; Miguel, S.P.; de Melo-Diogo, D.; Mendonça, A.G.; Louro, R.O.; Correia, I.J. In vitro characterization of 3D printed scaffolds aimed at bone tissue regeneration. Colloids Surf. B Biointerfaces 2018, 165, 207–218. [Google Scholar] [CrossRef] [PubMed]
- Bouet, G.; Marchat, D.; Cruel, M.; Malaval, L.; Vico, L. In vitro three-dimensional bone tissue models: From cells to controlled and dynamic environment. Tissue Eng. Part B Rev. 2015, 21, 133–156. [Google Scholar] [CrossRef] [PubMed]
- Annabi, N.; Tamayol, A.; Uquillas, J.A.; Akbari, M.; Bertassoni, L.E.; Cha, C.; Camci-Unal, G.; Dokmeci, M.R.; Peppas, N.A.; Khademhosseini, A. 25th anniversary article: Rational design and applications of hydrogels in regenerative medicine. Adv. Mater. 2014, 26, 85–123. [Google Scholar] [CrossRef] [PubMed]
- Rao, S.H.; Harini, B.; Shadamarshan, R.P.K.; Balagangadharan, K.; Selvamurugan, N. Natural and synthetic polymers/bioceramics/bioactive compounds-mediated cell signalling in bone tissue engineering. Int. J. Biol. Macromol. 2018, 110, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.S.; Park, M.S.; Gwak, S.J.; Choi, C.Y.; Kim, B.S. Accelerated bonelike apatite growth on porous polymer/ceramic composite scaffolds in vitro. Tissue Eng. 2006, 12, 2997–3006. [Google Scholar] [CrossRef] [PubMed]
- Wei, G.; Ma, P.X. Structure and properties of nano-hydroxyapatite/polymer composite scaffolds for bone tissue engineering. Biomaterials 2004, 25, 4749–4757. [Google Scholar] [CrossRef] [PubMed]
- Gutiérrez-Prieto, S.J.; Fonseca, L.F.; Sequeda-Castañeda, L.G.; Díaz, K.J.; Castañeda, L.Y.; Leyva-Rojas, J.A.; Salcedo-Reyes, J.C.; Acosta, A.P. Elaboration and Biocompatibility of an Eggshell-Derived Hydroxyapatite Material Modified with Si/PLGA for Bone Regeneration in Dentistry. Int. J. Dent. 2019, 2019, 5949232. [Google Scholar] [CrossRef] [PubMed]
- Gutiérrez-Prieto, S.J.; Perdomo-Lara, S.J.; Diaz-Peraza, J.M.; Sequeda-Castañeda, L.G. Analysis of In Vitro Osteoblast Culture on Scaffolds for Future Bone Regeneration Purposes in Dentistry. Adv. Pharmacol. Pharm. Sci. 2019, 2019, 5420752. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.W.; Kim, H.E.; Salih, V. Stimulation of osteoblast responses to biomimetic nanocomposites of gelatin-hydroxyapatite for tissue engineering scaffolds. Biomaterials 2005, 26, 5221–5230. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ni, M.; Zhang, M.; Ratner, B. Calcium phosphate-chitosan composite scaffolds for bone tissue engineering. Tissue Eng. 2003, 9, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Chesnutt, B.M.; Yuan, Y.; Buddington, K.; Haggard, W.O.; Bumgardner, J.D. Composite chitosan/nano-hydroxyapatite scaffolds induce osteocalcin production by osteoblasts in vitro and support bone formation in vivo. Tissue Eng. Part A 2009, 15, 2571–2579. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, C.V.; Serricella, P.; Linhares, A.B.; Guerdes, R.M.; Borojevic, R.; Rossi, M.A.; Duarte, M.E.; Farina, M. Characterization of a bovine collagen-hydroxyapatite composite scaffold for bone tissue engineering. Biomaterials 2003, 24, 4987–4997. [Google Scholar] [CrossRef] [PubMed]
- Raman, H. An Organic Bovine Hydroxyapatite-PLGA Composites for Bone Tissue Engineering Master Thesis. University of Kentucky Lexington, Kentucky, 2005. [Google Scholar]
- Cinici, B.; Yaba, S.; Kurt, M.; Yalcin, H.C.; Duta, L.; Gunduz, O. Fabrication Strategies for Bioceramic Scaffolds in Bone Tissue Engineering with Generative Design Applications. Biomimetics 2024, 9, 409. [Google Scholar] [CrossRef] [PubMed]
- Potdar, P.D.; Jethmalani, Y.D. Human dental pulp stem cells: Applications in future regenerative medicine. World J. Stem Cells 2015, 7, 839–851. [Google Scholar] [CrossRef] [PubMed]
- Soto-Navarrete, E.; Vargas-Ulloa, L.E.; Oropeza-Murilo, M.P. Pluripotent Cells from Human Dental Pulp The Future of Regenerative Dentistry. Odontol. Act. 2015, 11, 4–14. [Google Scholar]
- Egusa, H.; Sonoyama, W.; Nishimura, M.; Atsuta, I.; Akiyama, K. Stem cells in dentistry – Part I: Stem cell sources. J. Prosthodont. Res. 2012, 56, 151–165. [Google Scholar] [CrossRef] [PubMed]
- Friberg, B.; Dahlin, C.; Widmark, G.; Ostman, P.O.; Billström, C. One-year results of a prospective multicenter study on Brånemark System implants with a TiUnite surface. Clin. Implant Dent. Relat. Res. 2005, 7 Suppl 1, S70–S75. [Google Scholar] [CrossRef] [PubMed]
- Zienkiewicz, O.C.; Taylor, R.L.; Govindjee, S. The Finite Element Method: Its Basis and Fundamentals; Butterworth-Heinemann, 2024. [Google Scholar]
- Sequeda, L.G.; Díaz, J.M.; Gutiérrez, S.J.; Perdomo, S.J.; Gómez, O.L. Synthetic hydroxyapatite obtaining using three different methods and characterization to use it as bone substitute. Rev. Colomb. De Cienc. Quím.-Farm. 2012, 41, 50–66. [Google Scholar]
- Wang, F.; Zhang, Y.C.; Zhou, H.; Guo, Y.C.; Su, X.X. Evaluation of in vitro and in vivo osteogenic differentiation of nano-hydroxyapatite/chitosan/poly(lactide-co-glycolide) scaffolds with human umbilical cord mesenchymal stem cells. J. BioMed Mater. Res. A 2014, 102, 760–768. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, Z.; Zhang, Z. Porous Chitosan/Nano-Hydroxyapatite Composite Scaffolds Incorporating Simvastatin-Loaded PLGA Microspheres for Bone Repair. Cells Tissues Organs 2018, 205, 20–31. [Google Scholar] [CrossRef] [PubMed]
- Inc., T.M. MATLAB version: R2023a; The MathWorks Inc.: Natick, Massachusetts, United States, 2023. [Google Scholar]
- Wang, F.; Su, X.X.; Guo, Y.C.; Li, A.; Zhang, Y.C.; Zhou, H.; Qiao, H.; Guan, L.M.; Zou, M.; Si, X.Q. Bone regeneration by nanohydroxyapatite/chitosan/poly(lactide-co-glycolide) scaffolds seeded with human umbilical cord mesenchymal stem cells in the calvarial defects of the nude mice. BioMed Res. Int. 2015, 2015, 261938. [Google Scholar] [CrossRef] [PubMed]
- Rho, J.Y.; Ashman, R.B.; Turner, C.H. Young's modulus of trabecular and cortical bone material: Ultrasonic and microtensile measurements. J. Biomech. 1993, 26, 111–119. [Google Scholar] [CrossRef] [PubMed]
- Timchenko, P.E.; Timchenko, E.V.; Pisareva, E.V.; Vlasov, M.Y.; Red’kin, N.A.; Frolov, O.O. Spectral analysis of allogeneic hydroxyapatite powders. J. Phys. Conf. Ser. 2017, 784, 012060. [Google Scholar] [CrossRef]
- Pérez Pozo, L.; Briones Picheira, F.; Lascano Farak, S.; Aguilar Ramírez, C. Stress Analysis of Porous Titanium Dental Implants Using the Finite Element Method. Ing. Y Desarro. 2015, 33, 80–97. [Google Scholar] [CrossRef]
- Park, J.; Park, S.; Kang, I.; Noh, G. Biomechanical effects of bone quality and design features in dental implants in long-term bone stability. J. Comput. Des. Eng. 2022, 9, 1538–1548. [Google Scholar] [CrossRef]
- Tang, X.; Xu, H.; Liu, X.; Yang, Y.; Li, Z. Advances in 3D-Printed scaffolds for bone defect repair: Material strategies and synergistic functional performance. Front. Bioeng. Biotechnol. 2025, 13–2025. [Google Scholar] [CrossRef] [PubMed]
- Abdelaziz, A.G.; Nageh, H.; Abdo, S.M.; Abdalla, M.S.; Amer, A.A.; Abdal-hay, A.; Barhoum, A. A Review of 3D Polymeric Scaffolds for Bone Tissue Engineering: Principles, Fabrication Techniques, Immunomodulatory Roles, and Challenges. Bioengineering 2023, 10, 204. [Google Scholar] [CrossRef] [PubMed]
- Mohammed, A.; Jiménez, A.; Bidare, P.; Elshaer, A.; Memic, A.; Hassanin, H.; Essa, K. Review on Engineering of Bone Scaffolds Using Conventional and Additive Manufacturing Technologies. 3D Print. Addit. Manuf. 2024, 11, 1418–1440. [Google Scholar] [CrossRef] [PubMed]
- Alex, Y.; Vincent, S.; Divakaran, N.; Uthappa, U.T.; Srinivasan, P.; Mubarak, S.; Al-Harthi, M.A.; Dhamodharan, D. Pioneering bone regeneration: A review of cutting-edge scaffolds in tissue engineering. Bioprinting 2024, 43, e00364. [Google Scholar] [CrossRef]
- Perier-Metz, C.; Duda, G.N.; Checa, S. Mechano-Biological Computer Model of Scaffold-Supported Bone Regeneration: Effect of Bone Graft and Scaffold Structure on Large Bone Defect Tissue Patterning. Front. Bioeng. Biotechnol. 2020, 8–2020. [Google Scholar] [CrossRef] [PubMed]
- Chaudhuri, B.; Mondal, B.; Modak, D.K.; Pramanik, K.; Chaudhuri, B.K. Preparation and characterization of nanocrystalline hydroxyapatite from egg shell and K2HPO4 solution. Mater. Lett. 2013, 97, 148–150. [Google Scholar] [CrossRef]
- Ramesh, S.; Natasha, A.N.; Tan, C.Y.; Bang, L.T.; Ramesh, S.; Ching, C.Y.; Chandran, H. Direct conversion of eggshell to hydroxyapatite ceramic by a sintering method. Ceram. Int. 2016, 42, 7824–7829. [Google Scholar] [CrossRef]
- Deepthi, S.; Venkatesan, J.; Kim, S.K.; Bumgardner, J.D.; Jayakumar, R. An overview of chitin or chitosan/nano ceramic composite scaffolds for bone tissue engineering. Int. J. Biol. Macromol. 2016, 93, 1338–1353. [Google Scholar] [CrossRef] [PubMed]
- Qasim, S.B.; Husain, S.; Huang, Y.; Pogorielov, M.; Deineka, V.; Lyndin, M.; Rawlinson, A.; Rehman, I.U. In-vitro and in-vivo degradation studies of freeze gelated porous chitosan composite scaffolds for tissue engineering applications. Polym. Degrad. Stab. 2017, 136, 31–38. [Google Scholar] [CrossRef]
- Morawska-Chochol, A.; Jaworska, J.; Chlopek, J.; Kasperczyk, J.; Dobrzyński, P.; Paluszkiewicz, C.; Bajor, G. Degradation of poly(lactide-co-glycolide) and its composites with carbon fibres and hydroxyapatite in rabbit femoral bone. Polym. Degrad. Stab. 2011, 96, 719–726. [Google Scholar] [CrossRef]
- Jayabal, R. Nanomaterials in Regenerative Medicine: Advancing the Future of Tissue Engineering. Regen. Eng. Transl. Med. 2026, 12, 511–529. [Google Scholar] [CrossRef]
- Murphy, S.V.; Atala, A. 3D bioprinting of tissues and organs. Nat. Biotechnol. 2014, 32, 773–785. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wang, X.; Lee, Y.-w.; Feng, L.; Wang, B.; Pan, Q.; Meng, X.; Cao, H.; Li, L.; Wang, H.; et al. Bioactive Scaffold Fabricated by 3D Printing for Enhancing Osteoporotic Bone Regeneration. Bioengineering 2022, 9, 525. [Google Scholar] [CrossRef] [PubMed]
- Hatt, L.P.; van der Heide, D.; Armiento, A.R.; Stoddart, M.J. β-TCP from 3D-printed composite scaffolds acts as an effective phosphate source during osteogenic differentiation of human mesenchymal stromal cells. Front. Cell Dev. Biol. 2023, 11–2023. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Zhou, C.; Yang, X.; Ke, D. 3D printed bioactive coated scaffolds boost osteogenesis and angiogenesis via the regulation of scaffold microstructure. Biofabrication 2025, 17. [Google Scholar] [CrossRef] [PubMed]
- Riosalido, P.M.; Arango-Ospina, M.; Velasquez, P.; Murciano, A.; Boccaccini, A.R.; De Aza, P.N. Bioactive scaffolds harnessing ionic modifications to promote osteogenesis and angiogenesis in bone regeneration. Boletín De La Soc. Española De Cerámica Y Vidr. 2025, 64, 100447. [Google Scholar] [CrossRef]
- Saberi, A.; Kouhjani, M.; Mohammadi, M.; Hosta-Rigau, L. Novel scaffold platforms for simultaneous induction osteogenesis and angiogenesis in bone tissue engineering: A cutting-edge approach. J. Nanobiotechnology 2023, 21, 351. [Google Scholar] [CrossRef] [PubMed]
- Komori, T. Molecular Mechanism of Runx2-Dependent Bone Development. Mol. Cells 2020, 43, 168–175. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.-P.; Li, J.-Q.; Li, R.-Y.; Cao, G.-L.; Feng, Y.-B.; Zhang, W. Loss of N-acetylglucosaminyl transferase V is involved in the impaired osteogenic differentiation of bone marrow mesenchymal stem cells. Exp. Anim. 2023, 72, 413–424. [Google Scholar] [CrossRef] [PubMed]
- Tu, T.; Shi, Y.; Zhou, B.; Wang, X.; Zhang, W.; Zhou, G.; Mo, X.; Wang, W.; Wu, J.; Liu, W. Type I collagen and fibromodulin enhance the tenogenic phenotype of hASCs and their potential for tendon regeneration. npj Regen. Med. 2023, 8, 67. [Google Scholar] [CrossRef] [PubMed]
- Utomo, D.P.; Kamadjaja, D.B.; Pramono, C.; Rizqiawan, A.; Miatmoko, A.; Hendrianto, E.; Rahman, M.Z. Increased Expression of Runx2 and Osteocalcin in Freeze Dried Bovine Bone Scaffold-Secretome Mesenchymal Stem Cell (In Vitro Laboratory Experimental Research on MC3T3-E1 Pre-Osteoblast Cell Culture). J. Int. Dent. Med. Res. 2023, 16, 1523–1529. [Google Scholar]
- Zhang, J.; Chen, L.; Yu, J.; Tian, W.; Guo, S. Advances in the roles and mechanisms of mesenchymal stem cell derived microRNAs on periodontal tissue regeneration. Stem Cell Res. Ther. 2024, 15, 393. [Google Scholar] [CrossRef] [PubMed]





| Gene | Forward (5’-3’) | Reverse (3’-5’) |
| Runx2 | CATCTAATGACACCACCAGGC | GCCTACAAAGGTGGGTTTGA |
| ALP | TCAGAAGCTCAACACCAACG | GTCAGGGACCTGGGCATT |
| OP | TGAAACGAGTCAGCTGGATGACCA | TGGCTGTGAAATTCATGGCTGTGG |
| OSX | TGGGAAAAGGGAGGGTAATC | CGGGACTCAACAACTCTGG |
| COL1 | TGACCTCAAGATGTGCCACT | ACCAGACATGCCTCTTGTCC |
| GAPDH | GAAGGTGAAGGTCGGAGTC | GAAGATGGTGATGGGATTTC |
| Compound | Percentage % |
| Hydroxyapatite | 1.07 |
| PLGA | 4.34 |
| Chitosan | 8.69 |
| Chloroform | 86.8 |
| Compound | Percentage % |
| Hydroxyapatite | 1.89 |
| PLGA | 7.55 |
| Chitosan | 15.09 |
| Xanthan gum | 18.87 |
| Model | Stiffness (MPa) | Scaffold type (fabrication method) |
| 4 | 40 | Freeze-drying |
| 7 | 19 | 3D printing |
| 1 | 13 | Freeze-drying |
| 3 | 9 | Freeze-drying |
| 5 | 7 | Freeze-drying |
| 6 | 6 | 3D printing |
| 2 | 4 | Freeze-drying |
| Dimensions | Units | Mod.1 | Mod.2 | Mod.3 | Mod.4 | Mod.5 | Mod.6 | Mod.7 | Implant |
| Manufacturing | - | C. L. | C. L. | C. L. | C. L. | C. L. | 3 D | 3 D | - |
| Diameter | cm | 0.78 | 0.80 | 0.78 | 0.78 | 0.80 | 0.78 | 0.70 | 0.33 |
| Length | cm | 1.73 | 1.09 | 1.06 | 1.91 | 1.48 | 1.03 | 1.00 | 0.80 |
| Mass | g | 2.75 | 2.96 | 3.07 | 2.89 | 2.94 | 3.18 | 1.85 | 0.30 |
| Density | g/cm3 | 3.29 | 5.43 | 5.96 | 3.10 | 3.95 | 6.41 | 3.70 | 4.38 |
| Modulus of elasticity | Mpa | 13.0 | 4.0 | 9.0 | 40.0 | 7.0 | 6.0 | 19.8 | 10000.0 |
| Stress | Mpa | 5.50 | 1.80 | 2.00 | 6.00 | 2.00 | 1.90 | 8.80 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.