Submitted:
26 June 2026
Posted:
29 June 2026
You are already at the latest version
Abstract
Libraries for next generation sequencing were prepared using primers directed to the framework 2, framework 3 and D and J regions of the rearranged immunoglobulin gene from 50 diagnosis myeloma bone marrow samples. After sequencing and bioinformatic analysis a marker sequence suitable for minimal residual disease analysis by HAT-PCR was obtained for 90% of the 50 samples studied. In 88% of samples a complete VDJ sequence was obtained. Failure to detect a marker sequence was principally due to a low percentage of plasma cells in the marrow sample. The high frequency of detection of a suitable marker sequence indicates that minimal residual disease can be monitored by HAT-PCR in the great majority of instances.
Keywords:
myeloma
; residual disease
; MRD
; HAT-PCR
; PCR
; NGS
; immunoglobulin gene
; hypermutation
Introduction
Quantification of minimal residual disease (MRD) is now routinely used in clinical trials of treatment for myeloma as it is a powerful predictor of response and survival (reviewed in reference 1). Although quantification of MRD is not routinely used for individual patient management, the emerging data from clinical trials strongly suggest that it will soon be used for this purpose [2,3,4]. If so, when deciding which method to use for measuring MRD, practical issues such as availability and cost will become important.
Until the present time the 2 methods most used for quantification of MRD in myeloma have been multiparameter flow cytometry (MFC) and next-generation sequencing (NGS). These methods have sensitivities of 10-5 and 10-6 respectively [5,6,7]. Recently we have described a modification of PCR, HAT-PCR (High A/T or High Annealing Temperature-PCR), which has shown a sensitivity of 10-6 in studies of acute lymphoblastic leukaemia, chronic lymphocytic leukaemia and myeloma and, in direct comparisons with MFC and NGS has been shown to be more sensitive than MFC and to have the same sensitivity as NGS [8,9,10].
HAT-PCR requires that the marker sequence of the rearranged immunoglobulin gene is known and this is conveniently determined using NGS. In this manuscript we describe our methodology for preparing the libraries for sequencing, the problems encountered and the results obtained after sequencing and bioinformatic analysis.
Methods
Samples
Fifty anonymized diagnosis samples of bone marrow from patients with myeloma were obtained from the South Australian Research Cancer Biobank (SACRB). They had been donated with informed consent and the only information received with the samples was the percentage of plasma cells
Preparation of Libraries
Primers
The forward primers directed to framework 3 (Fr3), framework 2 (Fr2), framework 1 (Fr1) and the D region are shown in Table 1 and the reverse primers directed toward the J regions are shown in Table 2. As the primers comprised germline sequences and as the IGH rearrangements in myeloma may be heavily mutated, hybridisation of the primers to their target sequences may be suboptimal. To facilitate hybridisation, the Tm of the forward primers was quite high, they were used at high concentration and the PCR protocol involved annealing at a low temperature for a prolonged time. The conserved sequence in J, termed the probe sequence as it is used for binding of the probe in the PCR, was not available to be used as a reverse primer, Multiple downstream J primers were therefore used for each of the 6 J regions.
Although these features facilitated hybridisation of primers to their legitimate targets, they also facilitated non-target hybridisation of the primers and amplification of non-specific sequences. This could occur to such an extent that the PCR was inhibited. To minimise this problem, we used either semi-nested PCR, in which the second PCR round used internal forward primers, or the addition of blocking oligonucleotides to inhibit amplification of the nontarget sequences. The latter approach used a BLAST search (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to determine the sequence of an observed nontarget amplicon and synthesis of oligonucleotides which could interfere with amplification of that amplicon. The sequences of these blocking oligonucleotides and the J primers are shown in Table 2. For Fr3 amplification the blocker was designed to hybridise strongly to the non-target amplicon and prevent polymerase extension; for Fr2 amplification the blocker was designed similarly but was sited such that the 5’ six bases of the blocker hybridised to the same sequence as the 3’ six bases of the primer so that hybridisation of the primer was also inhibited; and for amplification of the D rearrangement the blockers were designed to prevent amplification of the full germline sequence between D7 and J1 by amplifying a small segment within it.
PCR
Two rounds of PCR were used, the first round involving primers directed to conserved sequences in the rearranged immunoglobulin gene and the second round involving addition of the adapters and at times, the use of primers internal to those used in the first round. First round reactions were 10µl and contained Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific ),(SF)(0.2µl), dNTPs at 300nM, SF buffer and 50ng of DNA. Second round reactions were 25µl and contained Platinum Taq DNA Polymerase (Thermo Fisher Scientific), (PT)(.4µl), MgCl2 at 5mM, dNTPs at 300nM and PT buffer. A differently indexed reverse adaptor (RAD) primer was used for each sample.
Each sample was amplified twic, one sample with an IghJ probe at160nM and Syto 82 at 500nM to assess specific and nonspecific amplification respectively and the other sample as the library sample for NGS.
The individual constituents in all primer mixes and pools were equimolar. The concentrations refer to each individual constituent.
There were 5 samples in which the plasma cell percentage was <= 3%. For these, 3 duplicate PCRs were performed each containing at least 250 ng of DNA. The 3 sets of NGS data were pooled for analysis to determine the mean frequency of each rearrangement.
Fr3-Fr3 protocol
Ist round: Fr3ghi mix at 1000nM, Jpool at 25nM, 1A1bl3 at 50nM, 1A2bl3 at 50nM
PCR protocol: 95°C 1min, 98°C 1min then 18 cycles of 95°C 30s, 50°C 4min, 70°C 1 min
2nd round: Fr3jkl mix at 50nM, Individual RAD at 30nM, 5µl 1/20 diluted PCR product.
PCR protocol: 95°C 3min then 25 cycles of 95°C 30s, 70°C 30s
Fr2-Fr3 protocol
Ist round: Fr2kmn mix at 1000nM, Jpool at 25nM,
PCR protocol: 95c 1min, 98° C 1min then 18 cycles of 95° C 30s, 50° C 4min, 70° C 1 min
2nd round: Fr3jkl mix at 1000nM, Individual RAD at 30nM, 5µl 1/200 diluted PCR product.
PCR protocol: 95°C 3min then 25 cycles of 95°C 30s,50°C 2 mins, 70°C 90s.
Fr2-Fr2 protocol
Ist round: Fr2kmn mix at 1000nM, Jpool at 25nM, Fr2Bmix at 1000nM,
PCR protocol: 95°C 1min, 98°C 1min then 18 cycles of 95°C 30s, 50°C 4min, 70°C 1 min
2nd round: Fr2opq mix at 50nM, Individual RAD at 30nM, Fr2Bmix at 1000nM, 5µl 1/200 diluted PCR product.
PCR protocol: 95°C 3min then 25 cycles of 95°C 30s, 50°C 2 mins, 70°C 90s.
Fr1-Fr2 protocol
Ist round: Fr1 mix at 500nM, Jpool at 25nM,
PCR protocol: 95°C 1min, 98°C 1min then 20 cycles of 95°C 30s, 50°C 3mins 30s, 70°C 90s
2nd round: Fr2opq mix at 1000nM, Individual RAD at 30nM, 5µl 1/200 diluted PCR product.
PCR protocol: 95°C 3min then 25 cycles of 95 C 30s, 50°C 2 mins, 70°C 90s.
D protocol
The D primers used were those described by Szczepanski et al [11].
Ist round: Dpool at 50nM, Jpool at25nM, GladF at50nM, GladRev at 50nM
PCR protocol: 95°C 1min, 98°C 1min then 20 cycles of 95°C 30s, 60°C 2mins 30s, 70°C 1min
2nd round: FAD5 at 50nM, Individual RAD at 30nM, 5µl 1/200 diluted PCR product.
PCR protocol: 95°C 3min then 25 cycles of 95°C 30s, 70°C 1 min.
Sequencing and bioinformatics analysis were performed by AGRF (Melbourne, Australia). Sequencing was performed on an Illumina MiSeq instrument and produced 2 x 250 paired-end reads. After demultiplexing bioinformatic analysis combined the paired ends and sorted the sequences by sample of origin. The criterion that a sequence was an immunoglobulin sequence was that it contained the 37 base conserved probe sequence with less than 10 mutations. The criterion that immunoglobulin sequences represented the same sequence was that, excluding the probe sequence, they differed by less than 5 mutations. Based upon these criteria the sequences were merged and were finally ranked by frequency.
The criteria used to decide that an immunoglobulin sequence marked the myeloma clone were that the sequence comprised 5% or more of the IGH sequence reads, that it exceeded the frequency of the next common sequence by a factor of 5 or more, and that the total number of IGH reads was greater than 3000.
Mutations in the marker sequence were identified and enumerated between the end of the Fr2 site
and the beginning of the J primer site or, when Fr2 information was not available, between the end of the Fr3 site and the beginning of the J primer site.
Results
Based upon these criteria, the results are shown in Figure 3a and Figure 3b. A marker usable as a target for PCR quantification of MRD was detected in 90% of the samples studied. In 1 sample a marker was detected only by the D primers but in 88% of samples a complete VDJ marker was obtained by the framework primers. A marker was detected in 40/50 samples by the Fr3-Fr3 protocol, in 37/50 by the Fr2-Fr3 protocol, in 35/50 by the Fr2-Fr2 protocol, in 35/50 by the Fr1-Fr2 protocol and in 22/50 by the D protocol. The marker sequence comprised >90% of the IGH rearrangements in 34 samples, 60%-89% in 7 samples and 40%-59% in 4 samples.
The results in Figure 3a and Figure 3b are ranked to show the effect of plasma cell number. There was a significant association between a low number of plasma cells in the marrow aspirate and failure to detect a marker sequence by the framework protocols (Mann-Whitney U = 49, z = 2.49, p < 0.01). In the 5 samples in which plasma cells comprised < = 3%, a marker was not detected in 3, a marker was only detected by D in 1 (38-26), and in 1 (20-26) the marker was not detected by the standard protocol but was detected when 3 replicates using a large amount of DNA were performed.
To examine the possibility that hypermutation may have interfered with marker detection, we examined the relation between the mutation frequency of the marker sequence and failure of detection of that sequence by the framework primers. Inspection of Table 3 shows that all 4 framework protocols successfully detected the marker sequence in 29 samples, but 1 protocol failed in 6, 2 failed in 5 and 3 failed in 4. Mutation frequency was slightly higher in the 15 samples showing failure of marker detection (median = 11.60%) than in the 29 samples not showing failure (median = 9.90%), but the difference was not significant (p = 0.457, Mann-Whitney U test).
The magnitude of non-specific amplification was assessed by calculating the Ct value for syto 82 minus the Ct value for the IGH probe. For the 4 different framework protocols the mean value for Fr3-Fr3 was 1.78 (SE = 0.17, n = 99), for Fr2-Fr3 was 0.03 (SE = 0.23, n =52), for Fr2-Fr2 was 0.07 (SE = 0.17, n = 75) and for Fr1-Fr2 was 0.04 (SE = 0.13, n = 54). The mean value for the Fr3-Fr3 protocol was significantly greater (t test, p < 0.001) than for the 3 other framework protocols, each of which contained Fr2 primers.
Discussion
Our results showed that a marker sequence can be detected by NGS in approximately 90% of cases of myeloma. In 88% of samples the marker sequence was a complete VDJ sequence and, as such sequences tend to be highly mutated in myeloma they enable the synthesis of semi-specific reverse J primers. This improves the overall specificity of the PCR when quantifying MRD as was seen in our previous study of myeloma in which no false positive PCR results were seen when 20 mcg from each of 32 patient samples was studied [9].
For myeloma the identification of a marker IGH rearrangement by NGS faces two problems. Firstly, the focal nature of myeloma may result in a very low number of plasma cells being present within the marrow sample and, secondly, the presence of random mutations within the IGH gene interferes with hybridisation of the primers. A low number of plasma cells was found to significantly impair detection of a marker rearrangement but, in a minority of cases, this could be countered by performing the PCR in triplicate, using an increased amount of DNA, and pooling the results for analysis. Immuno-enrichment may provide a way of dealing with this problem in the future.
To deal with the problem of hypermutation we improved primer hybridisation by using primers at high concentration and performing hybridisation at a low temperature and for a prolonged time. The Jpool primers also contained multiple primers for each J region to allow for failure of binding due to hypermutation.The hybridisation of the primers to non-specific genomic sequences and the resultant amplification of non-specific material was countered either by performing two-stage semi-nested PCR or using “blockers” to interfere with non-specific amplification by the PCR. Non-specific amplification is monitored by syto 82 and. as judged by the Ct difference between the IGH probe and syto 82, non-specific amplification was increased in the protocols employing an Fr2 primer. This may have been a factor in the lower detection of markers by protocols containing an Fr2 primer.
Conclusion
The present study adds to our previous studies on the role of HAT-PCR in quantification of MRD in myeloma8-10. These studies have shown that HAT-PCR provides a sensitivity of 10-6, which is the same as that provided by NGS. However, in contrast to NGS, HAT-PCR is simple, cheap and readily available. The high frequency of detection of a marker rearrangement by the present study therefore indicates that HAT-PCR can be used for measurement of MRD in the great majority of cases of myeloma.
Author Contributions
EH performed the laboratory work, provided intellectual input, and reviewed the manuscript. AM initiated and supervised the study and drafted the manuscript.
Funding
This research was funded by Monoquant P/L.
Institutional Review Board Statement
The study was approved by the Ethics Committee of Flinders University. The samples obtained by the South Australian Tissue bank were provided by patients who gave informed consent to their samples being used for research. All samples were anonymised.
Informed consent
Informed consent was obtained from all subjects who provided the marrow samples.
Data Availability
The original contributions presented in this study are included in the article material. Further inquiries can be directed to the corresponding author.
Acknowledgments
We thank Naga Kasinadhuni, Nathan Bachman and Martha Zakrzewski for help with bioinformatics and David Ross for help in obtaining samples.
Conflicts of interest
EH and AM hold equity in Monoquant Pty Ltd which has patents covering HAT-PCR. Monoquant played no role in design of the study, in the collection, analysis or interpretation of the data, and in the writing of the manuscript.
References
- Landgren, O.; Prior, T.J.; Masterson, T.; Heuck, C.; Bueno, O.F.; Dash, A.B.; et al. EVIDENCE meta-analysis: evaluating minimal residual disease as an intermediate clinical end point for multiple myeloma. Blood 2024, 144(4), 359–67. [Google Scholar] [CrossRef] [PubMed]
- Perrot, A.; Touzeau, C.; Lambert, J.; Hulin, C.; Caillot, D.; Karlin, L.; et al. Isatuximab, carfilzomib, lenalidomide, and dexamethasone induction in newly diagnosed myeloma: analysis of the MIDAS trial. Blood 2025, 146(1), 52–61. [Google Scholar] [CrossRef] [PubMed]
- Sonneveld, P.; Dimopoulos, M.A.; Boccadoro, M.; Quach, H.; Ho, P.J.; Beksac, M.; et al. Daratumumab, Bortezomib, Lenalidomide, and Dexamethasone for Multiple Myeloma. N Engl. J. Med. 2024, 390(4), 301–13. [Google Scholar] [CrossRef] [PubMed]
- Landgren, O.; Ye, C.; Hillengass, J.; Sborov, D.; Hoffman, J.; Diamond, B.; et al. Randomized, multi-center study of carfilzomib, lenalidomide, and dexamethasone (KRd) with or without daratumumab (D) in patients with newly diagnosed multiple myeloma (NDMM): The ADVANCE clinical trial. J. Clin. Oncol. 2025, 43, 7503. [Google Scholar] [CrossRef]
- Oliva, S.; Genuardi, E.; Paris, L.; D'Agostino, M.; Rogers, J.; Rota-Scalabrini, D.; et al. Prospective evaluation of minimal residual disease in the phase II FORTE trial: a head-to-head comparison between multiparameter flow cytometry and next-generation sequencing. EClinicalMedicine 2023, 60, 102016. [Google Scholar] [PubMed]
- Yoroidaka, T.; Takamatsu, H.; Urushihara, R.; Itagaki, M.; Yoshihara, S.; Sato, K.; et al. Prognostic value of minimal residual disease detected by EuroFlow next-generation flow cytometry and next-generation sequencing in patients with multiple myeloma achieving complete response and receiving lenalidomide maintenance after autotransplant: a prospective comparison study. Haematologica 2025. [Google Scholar] [PubMed]
- Ching, T.; Duncan, M.E.; Newman-Eerkes, T.; McWhorter, M.M.E.; Tracy, J.M.; Steen, M.S.; et al. Analytical evaluation of the clonoSEQ Assay for establishing measurable (minimal) residual disease in acute lymphoblastic leukemia, chronic lymphocytic leukemia, and multiple myeloma. BMC Cancer 2020, 20(1), 612. [Google Scholar] [CrossRef] [PubMed]
- Latham, S.; Hughes, E.; Budgen, B.; Ross, D.; Greenwood, M.; Bradstock, K.; et al. Sensitive Measurement of Minimal Residual Disease in Blood by HAT-PCR. J. Mol. Diagn. 2022, 24(6), 632–41. [Google Scholar] [CrossRef] [PubMed]
- Hughes, E.; Latham, S.; Kuss, B.; Grist, S.; Hall, R.; Khong, T.; et al. HAT-PCR Enables Sensitive Quantification of Minimal Residual Disease in Chronic Lymphocytic Leukemia and Myeloma. Int. J. Mol. Sci. 2025, 26(16). [Google Scholar] [CrossRef] [PubMed]
- Hughes, E.; Blombery, P.; Kannan, S.; Khong, T.; Spencer, A.; Morley, A. HAT-PCR is non-inferior to NGS when quantifying measurable residual disease for myeloma. Br. J. Haematol. 2026. [Google Scholar] [PubMed]
- Szczepanski, T.; Pongers-Willemse, M.J.; Langerak, A.W.; Harts, W.A.; Wijkhuijs, A.J.; van Wering, E.R.; et al. Ig heavy chain gene rearrangements in T-cell acute lymphoblastic leukemia exhibit predominant DH6-19 and DH7-27 gene usage, can result in complete V-D-J rearrangements, and are rare in T-cell receptor alpha beta lineage. Blood 1999, 93(12), 4079–85. [Google Scholar] [PubMed]
Table 1.
Forward primers. The specific sequences designed to hybridise to the rearranged immunoglobulin gene are shown in lowercase and a portion or the complete sequence of the forward adapter are shown in uppercase. Fr3jkl, Fr2opq and FAD5 are primers for the second round of PCR. Fr3jkl, Fr2opq have at their 3’ends the specific sequences of Fr3ghi or Fr2kmn respectively.
Table 1.
Forward primers. The specific sequences designed to hybridise to the rearranged immunoglobulin gene are shown in lowercase and a portion or the complete sequence of the forward adapter are shown in uppercase. Fr3jkl, Fr2opq and FAD5 are primers for the second round of PCR. Fr3jkl, Fr2opq have at their 3’ends the specific sequences of Fr3ghi or Fr2kmn respectively.
| Fr3mix | |
| Fr3g | GACGCTCTTCCGATCTnnnctgagagctgaggacacggctgtgtattactgt |
| Fr3h | GACGCTCTTCCGATCTnnnctgagagctgaggacacagccatgtattattgt |
| Fr3i | GACGCTCTTCCGATCTnnngtgacagccgtggacacggccgtgtattactgt |
| Fr3jkl | AATGATACGGCGACCACCGAGATCTACAC[index]ACACTCTTTCCCTACACGACGCTCTTCCGATCTFr3ghi spec seqs |
| Fr2mix | |
| Fr2k | tgggtccgccaggctccagggaaggggctggagtgg |
| Fr2m | tgggtccggcagcctccagggaagggcctggagtgg |
| Fr2n | tgggtgcgacaggcccctggacaagggcttgagtgg |
| Fr2opq | AATGATACGGCGACCACCGAGATCTACAC[index]ACACTCTTTCCCTACACGACGCTCTTCCGATCTFr2kmn spec seqs |
| Fr1mix | |
| VH1aFAD | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTnnngaagcctggggcctcagtgaaggtct |
| VH2-FAD | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTnnngtctggtcctacgctggtgaaaccc |
| VH3-FAD | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTnnnctggggggtccctgagactctcctg |
| VH4-FAD | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTnnncttcggagaccctgtccctcacctg |
| VH5-FAD | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTnnncggggagtctctgaagatctcctgt |
| VH6-FAD | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTnnntcgcagaccctctcactcacctgtg |
| Dpoolsz | |
| D1tagSz1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTacccaggaggccccagagcaca |
| D1tagSz2 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTacccaggaggccccagagctca |
| D1tagSz3 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTatccaggaggccccagagcaca |
| D1tagSz4 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTatccaggaggccccagagctca |
| D2tagSz | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcagcactgggctcagagtcctctc |
| D3tagSz1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcctcctcaggtcagccccggacat |
| D3tagSz2 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcctcctcaggtcagccctggacat |
| D3tagSz3 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcctcctccggtcagccccggacat |
| D3tagSz4 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcctcctccggtcagccctggacat |
| D4tagSz1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcccaggacgcagcaccactgtcaa |
| D4tagSz2 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcccaggacgcagcaccgctgtcaa |
| D5tagSz | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTacccagcctcctgctgaccagag |
| D6tagSz1 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccaaaaccagggat |
| D6tagSz2 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccaaaaccagggtt |
| D6tagSz3 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccaaaaccagtgat |
| D6tagSz4 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccaaaaccagtgtt |
| D6tagSz5 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccagaaccagggat |
| D6tagSz6 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccagaaccagggtt |
| D6tagSz7 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccagaaccagtgat |
| D6tagSz8 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTcaggccccccagaaccagtgtt |
| D7tagSz | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgggctggggtctcccacgtgtttt |
| FAD5 | AATGATACGGCGACCACCGAGATCTACAC[index]ACACTCTTTCCCTACACGACGCTCTTCCGATCT |
Table 2.
J primers and blockers. The specific sequences designed to hybridise to the rearranged immunoglobulin gene are shown in lowercase and portion of the adapter is shown in uppercase. The RAD primer was used in the second round with a different index for each sample. The blocker sequences incorporate “+” to indicate that the following base is locked and “/3Phos/” to indicate 3’ phosphorylation to inhibit extension.
Table 2.
J primers and blockers. The specific sequences designed to hybridise to the rearranged immunoglobulin gene are shown in lowercase and portion of the adapter is shown in uppercase. The RAD primer was used in the second round with a different index for each sample. The blocker sequences incorporate “+” to indicate that the following base is locked and “/3Phos/” to indicate 3’ phosphorylation to inhibit extension.
| Jpool | |
| AAMJ1bd | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTctttgctgagcacctgtccccaagtctgaa |
| J1dupad | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcctcctgccgacctcctttgctga |
| J1j | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgccctcctgcttctcccatacaaaaacaca |
| setA J1d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcctctgccctcctgcttctcccataca |
| setEJ2d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgccccagggctaagtgacagca |
| J2k | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgggctctggcatgcagcccat |
| J2l | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcagggctaagtgacagcagggctct |
| Jset6 J3d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTacatggcccagcgcagaccaa |
| setA J3d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcgtggtcccaaacagccggagaa |
| setC J3d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTccagttcccaaagaaaggccttctgctgaa |
| J4h | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTctccggggctctcttggcagga |
| setA J4d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgttgcctcagggcatcctcctga |
| J4m | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgagcccttgcccctcgtctgtgt |
| J4dupad | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgcccttgcccctcgtctgtgt |
| J4j | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgggctcaggaggaaggagcatctgga |
| J5g | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcctgacctccaaaatgcctccaagactctga |
| J5dupad | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTtccccagctttctttcctgacctccaa |
| setA J5d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgaggacaggctgggttcccattcgaa |
| J5i | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgtggccggacttggggaggaca |
| setCa J5d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTctgccgacatctgtggccggactt |
| setA J6d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgcccaggtcccctcggaacat |
| Jset6 J6d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgaggaccaacctgcaatgctcaggaa |
| Jset5 J6d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcggaaaatccacagaggctcccagatcc |
| setEJ6d | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTagtcccattttccaaaggcatcggaa |
| setC J6q | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTagcccccaggctcagttactccat |
| setC J6r | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTttcaggcatctcgtccaaatgtggct |
| RAD | CAAGCAGAAGACGGCATACGAGAT[index]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
| Blockers | |
| With Fr3-Fr3 protocol | |
| IA1bl3 | TAC+TGT+ATG+TGA+GT+CA+CC+AG+GT+AA+GA+AG/3Phos/ |
| IA2bl3 | TAC+TGT+GCGAAA+GAC+ACA+GTG+AGG+GGA+AGT/3Phos/ |
| With Fr2-Fr2 protocol | |
| Fr2B1 | GAG+TGG+AGTGGG+GAGAGCCAGAGA+GGAATG+GGG+ACA/3Phos/ |
| Fr2B2 | GAG+TGG+AGTGGG+GAGAGCAGTAGC+AGGTGA+GGC+CA/3Phos/ |
| Fr2B3 | GAG+TGG+AGGGGG+CAGAGGGACCCC+CAGGCA+GGG+CCG/3Phos/ |
| Fr2B4 | GTG+GGG+GGAGGG+AAGGGCCCA+GAGCCC+GAG+CTAC/3Phos/ |
| Fr2B5 | GAG+TGG+GGCCAA+GTCCTGGAAAATGAGGTT+ACTTCT+CCA+AG/3Phos/ |
| Fr2B6 | GAG+TGC+CACTCC+GTCCATCCAGACTTC+AAA TGG+ACC+CAC/3Phos/ |
| Fr2B7 | GAG+TGG+GGGCTG+GGCATCGGAGAGGC+ACGGCC+TCC+TGC/3Phos/ |
| With D protocol | |
| GladF | CAGTGATTGGCAGCTCTACAAAAACCATGCT |
| GladRev | CCTGAGCCAGGGGCTACAGAAA |
Table 3.
Summary of Results. This table indicates detection (+) or failure of detection (-) of a marker rearrangement. The results are arranged in increasing plasm cell frequency in the marrow sample.
Table 3.
Summary of Results. This table indicates detection (+) or failure of detection (-) of a marker rearrangement. The results are arranged in increasing plasm cell frequency in the marrow sample.
| primers | |||||||
| sample | % plasma cells | D | Fr3:Fr3 | Fr2:Fr3 | Fr2:Fr2 | Fr1:Fr2 | summary |
| 4-26 | 1.0 | - | - | - | - | - | - |
| 39-26 | 1.0 | - | - | - | - | - | - |
| 38-26 | 1.8 | + | - | - | - | - | + |
| 28-26 | 2.0 | - | - | - | - | - | - |
| 20-26 | 3.0 | - | + | + | - | - | + |
| Jan-26 | 4.0 | - | + | + | + | + | + |
| 7-26 | 5.0 | + | + | + | + | + | + |
| 19-26 | 6.0 | - | + | + | - | - | + |
| 33-26 | 6.0 | - | + | - | - | - | + |
| 34-26 | 6.0 | + | + | + | + | + | + |
| 27-26 | 7.0 | - | + | - | - | - | + |
| 36-26 | 7.0 | + | + | + | - | + | + |
| 8-26 | 8.0 | - | + | + | - | + | + |
| 11-26 | 11.0 | - | + | + | + | + | + |
| 22-26 | 11.0 | - | + | + | + | + | + |
| 46-26 | 11.0 | + | + | + | + | + | + |
| 49-26 | 13.0 | + | + | + | + | + | + |
| 29-26 | 14.6 | + | + | + | + | + | + |
| 15-26 | 15.0 | - | + | + | + | + | + |
| 26-26 | 15.0 | + | + | - | - | + | + |
| 12-26 | 20.0 | - | + | + | + | + | + |
| 23-26 | 20.0 | - | + | + | + | + | + |
| 10-26 | 21.0 | + | + | + | + | + | + |
| 14-26 | 21.0 | - | + | + | + | + | + |
| 21-26 | 21.0 | + | + | + | + | + | + |
| 41-26 | 21.0 | + | + | + | + | + | + |
| 37-26 | 24.0 | - | + | + | + | + | + |
| 30-26 | 25.0 | - | - | - | - | - | - |
| 50-26 | 25.4 | - | + | + | + | + | + |
| 3-26 | 26.0 | - | - | - | - | - | - |
| 48-26 | 26.0 | + | + | + | + | + | + |
| 45-26 | 28.0 | - | - | + | - | - | + |
| 47-26 | 28.0 | + | + | + | + | - | + |
| 6-26 | 29.0 | - | + | + | + | + | + |
| 5-26 | 31.0 | + | - | + | + | + | + |
| 2-26 | 32.0 | - | + | + | + | + | + |
| 44-26 | 35.0 | - | + | - | + | + | + |
| 31-26 | 38.0 | + | + | + | + | + | + |
| 25-26 | 41.0 | - | + | - | + | + | + |
| 9-26 | 42.0 | + | + | + | + | - | + |
| 42-26 | 46.0 | - | + | + | + | + | + |
| 32-26 | 47.4 | - | - | - | + | + | + |
| 18-26 | 52.0 | - | + | + | + | + | + |
| 13-26 | 59.0 | + | + | + | + | + | + |
| 43-26 | 61.0 | + | + | + | - | - | + |
| 17-26 | 64.0 | + | + | + | + | + | + |
| 24-26 | 67.0 | + | - | - | + | - | + |
| 16-26 | 79.0 | + | + | + | + | + | + |
| 35-26 | 79.0 | + | + | + | + | + | + |
| 40-26 | 80.0 | - | + | + | + | + | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
