Prerpints.org logo
Preprint
Article

This version is not peer-reviewed.

Melanocortin Receptor Signaling Modulates Anti-Obesity and Hypoglycemic Effects of Hafnia alvei 4597 Probiotic Strain in Mice

A peer-reviewed version of this preprint was published in:
International Journal of Molecular Sciences 2026, 27(15), 6963. https://doi.org/10.3390/ijms27156963

Submitted:

15 June 2026

Posted:

17 June 2026

You are already at the latest version

Abstract
Objective. The present study aimed to elucidate if the metabolic effects of probiotic bacterium Hafnia alvei 4597 depend on the melanocortin receptors (MCRs) signaling. Methods. The response to a 3-week intragastric treatment with the H. alvei bacterial suspension or total protein extract was compared between genetically similar mouse sub-strains but with different sensitivity of MCRs, KK and KK.Cg-Ay/a (KK-Ay), the latter overproducing agouti protein. Results. Treatment of KK mice with H. alvei protein extract stimulated energy expenditure and carbohydrate oxidation but reduced lipid oxidation, leptin level, pancreatic weight, and hypothalamic insulin and leptin receptor mRNA expression. Live bacteria in KK mice reduced food intake and stimulated hypothalamic mRNA expression of proopiomelanocortin, agouti-related peptide, and insulin receptors. In the sub-strain KK-Ay, probiotics had no effect on the aforementioned metabolic parameters. H. alvei-based probiotics improved glucose tolerance and deceased body fat and liver glycogen in both mouse sub-strains. Activation of MC4R by H. alvei protein extract was revealed by in vitro study showing of β-arrestin recruitment. Conclusion. These findings confirm beneficial effects of the H. alvei bacteria and show that, for several parameters, the bacterial protein extract may be a more efficacious than bacterial suspension. Differential responses to the treatment between the mouse sub-strains, particularly in energy metabolism, as well as in vitro data, indicate that the effects of H. alvei are mediated by MCRs signaling.
Keywords: 
Hafnia alvei
;  
agouti yellow
;  
energy metabolism
;  
caseinolytic protease B
;  
melanocortin receptor
Subject: 
Medicine and Pharmacology  -   Endocrinology and Metabolism

Introduction

Hafnia alvei is a commensal bacterium belonging to the Hafniaceae family (formerly the Enterobacteriaceae family). It is widely distributed in the digestive tracts of animals, where it produces a number of bioactive compounds [1]. This bacterium attracted attention as a representative of the next-generation probiotics with at least partly defined molecular mechanism of beneficial action [2]. The bacterial strain H. alvei 4597 has been shown to influence host metabolism by reducing food intake and body weight in both obese mice and overweight humans [3,4,5]. These beneficial anti-obesity effects were attributed to the production by H. alvei of the 96 kDa heat shock protein caseinolytic protease B (ClpB), which was earlier identified in Escherichia coli (E. coli) as an antigen mimetic of α-melanocyte stimulating hormone (α-MSH), an anorexigenic neuropeptide [6] that plays a key role in the regulating energy balance [7]. It decreases food intake and increases energy expenditure through the activation of the melanocortin type 4 receptor (MC4R) [8]. Importantly, a recent study revealed that E. coli ClpB is also able to directly activate MC4R almost as potently as α-MSH [9].
The MC4R is expressed in numerous brain regions, with particularly high density in the paraventricular nucleus of the hypothalamus as well as in the dorsal motor nucleus of the vagus [10]. At the periphery, α-MSH exerts a direct effect on the enteroendocrine system, thereby enhancing the incretin response, inhibiting ion transport and motility, and stimulating the release of satiety factors acting on vagal afferents. MC4R mRNA has been detected in a mouse enteroendocrine cell preparation, thus confirming its status as one of the most highly expressed GPCRs in the glucagon-like peptide-1 (GLP-1) / peptide tyrosine-tyrosine (PYY)-producing L cells [11].
The anorexigenic effects of H. alvei resemble those activating the α-MSH/MC4R signaling. Supplementation with H. alvei in overweight humans undergoing a mild hypocaloric diet led to a greater loss of body weight and body fat content as well as an increase in fulness perception as compared to a placebo. Furthermore, the study revealed that administration of H. alvei to overweight but otherwise healthy non-diabetic subjects led to a slight, yet significant decrease in basal glycemia [3].
The ClpB or its fragments, as well as ClpB containing protein extract from E. coli, have been observed to reduce food intake and increase the level of PYY in mice [12,13]. Treatment with H. alvei of ob/ob obese prediabetic mice fed a standard diet was accompanied by decreased body weight and fat-mass gain along with reduced food intake [4]. Moreover, diet-induced obese mice treated with H. alvei showed a decrease of glycemia, plasma total cholesterol, and alanine aminotransferase [5]. Recently we have shown that H. alvei protein extract and the recombinant E. coli ClpB protein were able to increase glucose tolerance in lean non-diabetic mice [14].
Although, it is evident that the probiotic strain H. alvei 4597 is capable of improving energy metabolism in obese and diabetic rodents and overweight humans, the extent to which the favorable in vivo metabolic effects are mediated by the melanocortin receptors (MCRs) is unknown. Moreover, the ability of H. alvei protein extract to activate MC4R was not investigated. The present study aimed to elucidate these questions. To this end, a comparison of the response to 3-week intragastric treatment with a suspension of live H. alvei bacteria or H. alvei total protein extract was made between closely related mouse sub-strains differing in the sensitivity of MCRs. The use of H. alvei protein extract should provide further evidence for the key role of bacterial proteins, e.g., ClpB, in the beneficial effects of this probiotic strain.
Body weight, glycemia and associated morpho-functional characteristics were assessed in two sub-strains of mice: Kuo Kondo, KK.Cg-a/a (KK) and closely related KK.Cg-Ay/a sub-strain (KK-Ay). The inbred mouse strain KK has been employed as a polygenic model of mild obesity and T2D, exhibiting features such as glucose intolerance, hyperinsulinemia, hyperleptinemia, and polyuria [15]. This is particularly notable due to mutations of hepatic and renal esterases when compared to strains that do not manifest signs of diabetes [16]. The KK-Ay is a sub-strain derived from the KK, which was the result of the transfer of the lethal Agouti yellow obese allele (Ay). Heterozygous KK.Cg-Ay/a mice are severely obese and characterized by evident adiposity, hyperphagia, hyperglycemia, hyperinsulinemia, and glucose intolerance by the age of eight weeks [17,18]. This model is considered appropriate to study obesity and the effects of anti-diabetic drugs for T2D [18,19,20].
Agouti signaling protein (ASIP or the agouti protein), sharing a striking similarity in structure and function with agouti-related peptide (AgRP), is normally expressed in the skin; however, mice with the Agouti yellow lethal mutation express ASIP ubiquitously [21]. The agouti protein is a potent competitive antagonist of the MC1R and MC4R with somewhat weaker affinity at MC3R. An earlier study reported that in mice the agouti protein did not interact with MC3R at all [22]. Additionally, agouti protein antagonizes adrenocorticotropic hormone (ACTH) receptor MC2R expressed in adipocytes [23]. It also inhibits the generation of cAMP stimulated by α-MSH at human MC1R and MC3-5R or by ACTH at human MC2R [24].
AgRP is a neuropeptide produced in the arcuate nucleus of the hypothalamus, inducing orexigenic effect by blocking the action of melanocortin peptides. AgRP does not antagonize the MC1R but does interact with the centrally expressed MC3R and MC4R [25,26] functioning as an inverse agonist at the constitutively active MCRs [27], expressed in hypothalamic neurons regulating feeding behavior [10,28].
Our working hypothesis was that if the effects of the H. alvei-based probiotic are manifested in the KK strain with intact MCR signaling but not in the KK-Ay strain having the same genotype except the Ay lethal allele, it can be assumed that the probiotic acts mainly by modulating the activity of the host MCR receptors. This hypothesis turned out to be partly confirmed, because on the one hand, H. alvei protein extract activated MC4R, but on the other hand, some beneficial effects of H. alvei on energy metabolism were also present in mice with Ay mutation. Possible mechanisms underlying such results are discussed.

Materials and Methods

The study was conducted in accordance with the Declaration of Helsinki and approved by the Animal Care and Use Committee at the Pavlov Institute of Physiology (Animal Welfare Assurance #A5952-01), approval No. 03/15 dated March 15, 2022.

Animals

Experiments were performed on 90 - 120-day old male mice bred by cross-mating black female KK.Cg-a/a and yellow male KK.Cg-Ay/a mice from the Pavlov Institute breeding colony. The founders of the sub-strains were obtained from The Jackson Laboratory (Bar Harbor, ME, USA). Animals were housed in accordance with the “Mouse room conditions” Jackson Laboratory guidelines (www.jax.org/jax-mice-and-services), four per cage, unless otherwise specified, in standard polycarbonate cages on wood shavings bedding in a temperature and humidity-controlled room (22–24 °C, 40–50% humidity) under a 12/12-h light/dark cycle. During the acclimation period and throughout the experiment, mice were fed a maintenance diet (Lbk 120 C-19, JSC “BioPro”, Novosibirsk region, Russia), including 58% carbohydrates, 6% fat, 19% protein as well as vitamins and minerals with energy value 2.50 kcal/g. Feed and tap water were freely available.
A total of 23 mice from KK strain and 33 mice from KK-Ay/a sub-strain were used in the study. Before the starting gavage with probiotics, body weight of the KK-Ay controls was significantly higher than that of the corresponding KK-controls (p<0.002, t-test). Within each mouse strain, body weight was similar between groups: KK controls – 31.46±0.81 g; KK with H. alvei protein – 30.30±1.00 g; KK with H. alvei suspension – 31.73±1.15 g; KK-Ay controls – 35.41±0.81 g; KK-Ay with H. alvei protein – 36.31±1.06 g; and KK-Ay with H. alvei suspension – 34.96±0.72 g.

Bacterial Culture

Live Hafnia alvei HA4597 bacteria were obtained from EnteroSatys® caps (TargEDys, Longjumeau, France) and isolated on Luria Bertani (LB) agar. A single colony was incubated in 10 mL of LB broth overnight at 37 °C with orbital shaking (140 rpm). A fraction of resulting culture (0.2 ml) was diluted at 107 CFU/mL in 200 mL (Erlenmeyer flask) of LB broth and incubated at 37 °C with orbital shaking (140 rpm) for 24h. After a 6h incubation which corresponded to the beginning of the stationary growth phase which was checked by optical density, the culture was stopped for sample collection. Bacterial abundance was determined by sowing on LB agar; 5 ml of sample contained 3.5×108 CFU. Samples were diluted in 0.9% NaCl to a concentration of 4.5×107 CFU in 200 µL, a single dose per mouse, similar to that used previously [4,14]. Aliquots were stored at -20 °C for further use.

Bacterial Protein Extraction

Bacterial protein was extracted according to a previously published protocol [13]. Briefly, samples of H. alvei cultures were centrifuged at 3.000×g for 20 min at 4 °C in Falcon tubes (50 ml) and supernatant was discarded. To wash out secreted compounds, bacterial pellets were resuspended with 0.1 M phosphate buffered saline (PBS) and centrifuged at 3.000 x g for 20 min at 4 °C, the supernatant was discarded. Washes were repeated 3 times. To promote lysis, the pellets were frozen overnight at -20 °C. Bacterial cells were lysed in 2 ml R2D2 buffer (7 M urea, 2 M thiourea, 2% CHAPS, 0.05% triphosphobutyl, 20 mM dithiothreitol, 0.5% C7BzO) with sonication for 6 min at 23% amplitude (3 sec ON/1 sec OFF). The addition of thiourea to the lysis buffer promoted better solubilization of the protein [29]. Solubilized proteins were recovered by taking supernatant after centrifugation at ×10.000 g for 30 min at 4 °C and quantified using Bradford assay. Protein extracts were diluted in saline (5 µg in 200 µl), a single dose per mouse similar to that used previously [14]. Aliquots were stored at -20 °C for further use.

Experimental Design

Prior to the administration of probiotics, mice were kept for seven days within individual cages for acclimation. The probiotic material was administered on a daily basis at 5 p.m. for a duration of 21 days (0–20) by means of intragastric gavage. Mice of both sub-strains were randomly assigned to three experimental groups. One experimental group received a suspension of H. alvei live bacteria (4.5×107 CFU in 200 µL of saline/mouse), while the other was provided with a total protein extract of H. alvei (5 µg/mouse in 200 µL of saline). Control group received 200 µL of saline solution. As shown previously, treatment with live bacteria and bacterial total protein extract was not accompanied by any adverse effects [4,14]. All of the animals completed the study without attrition or adverse events.
Intraperitoneal and intragastric (by oral gavage) glucose tolerance tests (IP-GTT and O-GTT, respectively) were done on days 13 and 15 starting at 1–2 p.m. The insulin tolerance test (ITT) was performed at 12 a.m. – 1 p.m. on day 17. After completion of the insulin tolerance test and daily administration of probiotics, animals from each group were placed in separate chambers of the Promethion Core indirect calorimetry system (see below) where they were maintained for 5 days. On day 22 mouse tissues were collected under terminal sedation as described below in detail. All measurements were performed by experimenters blinded to treatment and group allocation. The experimental protocol is schematically illustrated in the Figure 1.

Energy Balance Assessment

The open-circuit Promethion Core 2 High Definition Multiplexed Respirometry System Model CAB-16R (Sable Systems, GmbH, Berlin, Germany) was utilized to synchronously measure oxygen consumption, CO2 production, locomotor activity, food and water intake. The system, calibrated according to the manufacturer’s instructions, was operated under artificial light cycles (12 h light/12 h dark) and standard laboratory conditions providing a temperature of 24 °C and humidity of 40–60%. On day 17 of the experiment, mice were placed in individual sealed Promethion chambers with ad libitum access to food and water. A series of measurements were obtained at 10-min intervals. The initial 48-hour period was designated as the acclimatization phase, and data from the following three full days (19th-21st) were used for calculations. To estimate energy expenditure and substrate utilization, oxygen consumption (VO2) and carbon dioxide production (VCO2) were measured as difference at the inlets and outlets of the sealed chambers. The respiratory exchange ratio (RER) indicating substrate utilization was calculated on-line as VCO2/VO2. Other metabolic parameters were calculated after the test by conversion of raw data averaged to 1-h slices. Indirect calorimetry data were analyzed separately for the light (8 a.m. to 8 p.m.) and dark (8 p.m. to 8 a.m.) phases of the day.
Energy expenditure was calculated using the Weir formula (3.9×VO2 + 1.1×VCO2) [30] and normalized to body weight. Glucose and lipid oxidation rates were calculated using modified Ferrannini equations [31], assuming that urinary nitrogen excretion is the same between genotypes. Thus, carbohydrate (G) and lipid (L) oxidation rates were estimated using the following equations: G =4.585×VCO2 - 3.226 ×VO2 and L=1.695×VO2 - 1.701×VCO2; both were normalized to body weight [32].
Calorie expenditure per day was calculated by multiplying the amount of food consumed in grams by the caloric content of the diet (2.50 kcal/g) and normalized to gram of the body weight. Locomotor activity was measured by infrared beam breaks on the X and Y axes and converted to distance traveled by the Promethion software.

Body Composition

The body mass of each individual was measured daily for 21 days of treatment with an electronic balance. On day 22, non-fasted mice were terminally sedated with a gas mixture of CO2 and O2 (50/50 volume %) administered in a gradual fill method [33] and decapitated. Blood was withdrawn into tubes containing EDTA and centrifuged for plasma separation, frozen and kept at -80 ˚C. Liver, pancreas and fat were removed and weighed to the nearest 0.001 g. The anterior subcutaneous (interscapular), posterior subcutaneous (dorsolumbar, inguinal, and gluteal), visceral perirenal, visceral mesenteric and retroperitoneal visceral epididymal (gonadal) bilateral fat depots were excised. Brain was taken and the hypothalamus was dissected and kept in IntactRNA formalin-based stabilizing reagent (Evrogen, Moscow, Russia) at -80 ˚C until further RNA extraction.

Biochemical and ELISA Assays

Glycogen concentration in the liver was measured spectrophotometrically, as described by Danchenko and Chirkin [34]. Non-fasting insulin and leptin assays were performed using ELISA kits CEA448Mu and SEA084Mu (Cloud-Clone Corp., Katy, TX, USA).

Blood Glucose Measurements and Insulin Tolerance Test

Prior to undergoing a glucose tolerance test (GTT), the mice were subjected to a 6-h fast (8:00–14:00) on a clean bedding. A dose of 1.0 g/kg glucose (Sigma Aldrich, Burlington, MA, USA) was administered in aqueous solution via intraperitoneal (IP) or oral (O) injection. In the insulin tolerance test (ITT), nonfasted animals were injected IP with 2.0 U/kg insulin (Actrapid® HM, Novo Nordisk A/S, Bagsvaerd, Denmark). Blood was sampled through a tail incision, and glucose concentrations were measured at 0, 10, 15, 30, 60, 90, and 120 min after glucose administration or at 0, 15, 60, and 120 min after insulin administration. For each time point, two or three repeated glucose concentration measurements were performed using a handheld glucose meter, the Contour Plus One (Ascensia Diabetes Care Holdings AG, Basel, Switzerland). Glucose concentration in non-fasted mice was measured in the middle of light period via a tail incision just before euthanasia.

Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)

Total RNA was isolated from the hypothalamic tissue using a TRIzol analogue (ExtractRNA Reagent, Evrogen, Moscow, Russia) following the manufacturer’s protocol. Then the cDNA was synthesized from 2 μg of RNA using the MMLV reverse transcription kit (Evrogen, Moscow, Russia) and the oligo (dT) oligodeoxynucleotide primers. PCR amplification was performed using a mixture containing 10 ng of the RT product, 400 pM of forward and reverse primers, and the qPCRmix-HS SYBR master mix (Evrogen, Moscow, Russia), reaction volume 10 μL. The amplified signals were continuously detected by the QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific Inc.). The following PCR amplification protocol was used: (i) initial denaturation at 95 °C for 5 min; (ii) 40 cycles of a 3-step amplification and quantification loop (95 °C for 15 s, 57–61 °C for 15 s, and 72 °C for 15s; data were collected during this step); and (iii) the Melt Curve stage to check for one peak and no primer dimer formation in each reaction containing the template. The primer list can be found in Table 1.
The collected data were analyzed using the delta-delta-Ct method (https://toptipbio.com/delta-delta-ct-pcr accessed on 16 January 2023). Beta-actin (ActB) and beta-2-microglobulin (B2M) gene were used as reference house-keeping genes. The data are presented as fold levels relative to the geometric mean of expression in the control group of mice.

Melanocortin Receptor Type 4 (MC4R) Activation In Vitro

Free-cell cultures of E. coli K12 (from Rouen University laboratory collection), E. coli K12 ΔClpB kindly provided by Axel Mogk [35] and H. alvei H4597 (EnteroSatys® caps, TargEDys, France) were performed in 250 mL Erlenmeyer flasks containing 50 mL of Luria-Bertani broth (LB, Difco). Flasks were inoculated with fresh overnight preculture and incubated for 24 h at 37 °C under shaking 140 rpm. For the ΔClpB strain, kanamycin and spectinomycin were added at a final concentration of 30 µg/mL and 50 µg/mL, respectively. Bacteria were recovered by centrifugation (5,000 x g, 30 min, 4 °C, 5430/5430 R centrifuge, Eppendorf). The pellet was washed three times with 10 ml of Dulbeco’s phosphate buffer saline (DPBS, Sigma-Aldrich). The pellet was freeze/thawed (-80 °C/37 °C) and resuspended in a denaturing buffer named R2D2 (7 M urea, 2 M thiourea, 2 mM tri-N-butylphosphine (TBP), 20 mM dithiothreitol (DTT), 0.5% (w/v) 3-(4-heptyl)phenyl-3-hydroxypropyl) dimethylammoniopropanesulfonate (C7BzO), 2% (w/v) 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate hydrate (CHAPS)). The bacterial suspension was sonicated twice on ice (3 sec ON/1 sec OFF, amplitude 24%, 6 min) then the lysate was centrifuged (12,000 x g, 30 min, 4 °C) and the supernatant was ultra-centrifugated (40,000 x g, 45 min, 4 °C). Protein concentration was evaluated on the final supernatant using the Bradford assay (Bio-Rad).
HTLA cells were maintained in DMEM supplemented with 10% FBS, 2 μg/mL puromycin, and 100 μg/mL hygromycin B in a humidified atmosphere at 37 ◦C in 5% CO2. Cells were stably transfected with 2 μg Tango- human mc4r construct using lipofectamine 2000 reagent and selected with 500 μg/mL of geneticin. On day 1, cells were plated on a white 96-well plate at the rate of 2x104 cells per well in 90 μL of supplemented DMEM. 6 h later, different concentrations of protein extract from E. coli K12, E. coli K12 ΔClpB and H. alvei were added at the rate of 10 μL/well, in duplicate. To measure constitutive basal activity, no protein extract was added. On day 2, the medium and drugs were slowly removed from the wells (aspiration), and 50 μL of 1/20X Bright-Glo luciferase substrate solution (Promega Corporation, Madison, WI, USA) was added to each well. After 2 min, luminescence was counted with an Infinite F200Pro plate reader (Tecan, Mannedorf, Switzerland). Relative luminescence units (RLU) values were exported into Excel sheets.

Statistical Analyses

The data from all experiments are presented as mean ± SEM with p-values < 0.05 considered as significant. Statistical analysis was performed using Statistica 7.0 software (RRID:SCR_014213; StatSoft, Tulsa, OK, USA) and graphs were plotted with Excel (Microsoft Corp.). Baseline glucose, plasma hormones, body composition parameters and data of indirect calorimetry were compared using an unpaired, two-tailed Student’s t-test. Data of GTT and ITT were compared with one- or two-way ANOVA with repeated measurements. For two-way ANOVA, time was considered as within-subject factor, and effect of gavage as a between-subject factor. Post-hoc paired comparisons were made using the Fisher’s least significant difference (LSD) test. The total area under the curve (AUC) was calculated according the trapezoidal rule. RT-PCR data are presented as a relative quantity (RQ=2-ddCt) to control group and were compared using two-tailed Student’s t-test. MC4R activation data were analyzed using GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA). Other comparisons were made with unpaired two-tailed Student’s t-test.

Results

H. alvei- Based Probiotics Affect Body Composition

By the end of experiment, mice from the control KK-Ay sub-strain still exhibited greater body mass and the relative mass of the liver normalized to body weight in comparison to the controls from the KK group. Treatment of KK-Ay with both probiotic preparations had no effect on these parameters (Figure 2 a, c). Тhe administration of bacterial protein extract led to a significant reduction in relative fat mass in both sub-strains (Figure 2b) and a decrease in relative pancreatic mass in the KK group (Figure 2d). The hepatic glycogen concentration was greater in the KK-Ay group, it was reduced after treatment with bacterial protein extract (Figure 3b).

Glucose, Insulin and Leptin Levels

Non-fasted plasma glucose levels were assayed at the last day of experiment before the euthanasia. The control group of KK-Ay mice exhibited significant hyperglycemia with plasma glucose almost twofold higher than in the corresponding KK group (Figure 3a). No influence of probiotic treatment on glucose levels was observed in either mouse sub-strain (Figure 3a). There were no significant differences in insulin levels between control and treated groups (Figure 3c). Plasma leptin was not different between control groups of two mouse sub-strains, but it was reduced in KK mice treated with H. alvei protein extract, while only such a trend was observed in KK mice receiving suspension of the live bacteria H. alvei (Figure 3d). No effect of probiotic treatment on plasma leptin levels was observed in KK-Ay mice (Figure 3d).

Probiotics Treatment Shifts Energy Balance

An assessment of energy balance was conducted on days 19–21 of the treatment period using indirect calorimetry, along with continuous measurements of food and water intake, and locomotory activity. No difference in food consumption normalized to body weight was found between the control groups, however, treatment of KK mice with the suspension of live bacteria resulted in a reduction in food consumption at the dark period (Figure 4a). Water intake was higher in the KK-Ay than in KK sub-strain throughout the day. Probiotic treatment did not affect differences in water consumption either within or between sub-strains (Figure 4b).
Although physical activity levels did not differ between the control groups, KK-Ay mice receiving the bacterial protein extract showed increased daytime motor activity compared to the control group of the same substrain. No effect of probiotic treatment on physical activity was found in KK mice (Figure 4c).
The graphs on the left show the reaction rates in the light (unshaded background) and dark (shaded area) phases. The right panels show the averaged measurements in the light and dark phases. Comparisons using Student’s t-test: & p<0.05 – between control groups of KK and KK-Ay; * p<0.05 – KK control vs. protein or bacteria. Number of animals KK/KK-Ay per group: controls – 7/10, H. alvei protein extract – 6/6, H. alvei suspension – 4/8.
Gas exchange measurements in control groups showed higher O2 consumption and CO2 production in KK-Ay mice compared to KK mice during both light and dark periods (Figure 5. a,b). These differences in KK-Ay were associated with an increased energy expenditure throughout the day (Figure 5d). Respiratory exchange ratio was lower in KK-Ay controls during the night time (Figure 4c) that indicated shift of metabolism to lipid oxidation. Indeed, the calculated lipid oxidation during the dark period was greater in the KK-Ay control group than in the KK control mice (Figure 5f). No significant differences in the carbohydrate oxidation between the control groups were observed (Figure 5 c,e).
Supplementation with H. alvei bacterial protein extract resulted in a marked increase in O2 consumption during the dark phase and CO2 production during the light and dark phases in KK mice (Figure 5. a,b), which was reflected in an increase in both RER and energy expenditure during the dark phase (Figure 5 c,d). Moreover, KK mice receiving bacterial protein extract displayed a marked increase in carbohydrate oxidation during both phases and lower lipid oxidation during the dark period (Figure 5 e,f). Treatment of KK mice with H. alvei bacterial suspension did not produce significant shift of any of these metabolic parameters.
In contrast to the KK sub-strain, in KK-Ay mice, after treatment with the suspension of live bacteria, the RER was significantly reduced throughout the day and lipid oxidation increased during the light period. (Figure 5 c,f).

Effect of Probiotics on Glucose Tolerance and Insulin Resistance

In glucose tolerance test following a six-hour period of fasting, the control group of KK-Ay mice demonstrated higher baseline plasma glucose concentrations than the matching KK group (16.83 ± 0.60 vs. 13.41 ± 0.51, p < 0.001, Student’s test).
In the KK mice, O-GTT did not reveal effect of probiotics: probiotic effect F(2, 20)=1.51, p>0.24; time effect F(7, 140)=114.79, p<0.00001; probiotic × time F(14, 140) =0.64, p>0.82. The comparison of AUCs corroborates the absence of an effect in the O-GTT (F(2, 27) =1.79, p>0.18; Figure 6a). However, O-GTT in KK-Ay mice showed that the group treated with H. alvei bacterial protein exhibited lower plasma glucose levels than the control group both before and 15, 90 and 120 min after glucose loading (Figure 6b). This effect was confirmed by comparisons between AUCs (F(1, 20)=5.37, p<0.05, Figure 6b).
The graphs on the left show changes in metabolic rates during light (unshaded background) and dark (shaded area) periods of the day. The graphs on the right show average measurements normalized against body weight during light and darkness. Comparisons using Student’s t-test: & p<0.05, && p<0.01 –between control groups of KK and KK-Ay; * p<0.05, ** p<0.01 – KK control vs. protein; # p<0.05 – KK-Ay control vs. bacteria. Number of animals KK/KK-Ay per group: controls – 7/11, H. alvei protein extract – 6/6, H. alvei suspension – 4/8.
Panels e and f illustrate the alteration in plasma glucose concentration subsequent to the intraperitoneal administration of insulin (2.0 U/kg) to non-fasted mice. Comparisons using two-way ANOVA with repeated measurements or one-way ANOVA (for AUC’s data) with Fisher LSD Post-hoc test: * p<0.05, ** p<0.01 – control vs. protein; # p<0.05, ## p<0.01 – control vs. bacteria. The number of animals per group: KK controls – 11~12; KK with H. alvei protein extract – 5; KK and H. alvei suspension – 6; KK-Ay controls – 13~14; KK-Ay with H. alvei protein extract – 8~9; KK-Ay with H. alvei suspension – 7~8.
The provision of KK mice with probiotics resulted in visible improvement in plasma glucose disposal after IP glucose load; although this was not confirmed by two-way ANOVA: probiotic effect F(2, 17)=1.01, p>0.38; time effect F(7, 119)=93.42, p<0.00001; probiotic × time F(14, 119)=2.86, p<0.001 (Figure 6c). However, the statistical significance of the effect of bacterial protein extract was shown by one-way ANOVA (p < 0.05). Comparisons between AUC values did not demonstrate significant differences in IP-GTT (F(1, 12)=2.63, p>0.13; Figure 6c)
By analyzing the percentage of changes of blood glucose from the pre-test baseline levels, it was evident that improved glucose tolerance in bacterial protein-treated KK mice in the IP-GTT was due to the reduced amplitude of the response to glucose administration (Supplemental Figure S1b). On the contrary, improved glucose tolerance in probiotic-treated KK-Ay mice, in both O-GTT and IP-GTT, was due to the reduced pre-test baseline level of glucose in these groups (Figure S1d,e).
In both mouse strains, the administration of insulin (2.0 U/kg, IP) caused a rapid decrease in plasma glucose level, which magnitude reflected the tissue insulin resistance (Figure 6. e,f). Treatment with probiotics did not influence insulin resistance in KK mice as confirmed by the two-way ANOVA: effect of probiotic F(2, 19)=0.14, p>0.86; effect of time F(3, 57)=152.95, p<0.00001; probiotic × time F(6, 57)=0.66, p>0.68. (Figure 6e). Probiotics had an effect in the KK-Ay strain, showing that the group treated with live bacterial suspension had improved insulin resistance as compared to the control group throughout the test, while the mice treated with bacterial protein exhibited a significant improvement by 120 min of the experiment (Figure 6f). Comparison of percentage changes in glucose levels in the ITT confirmed an improved tolerance to insulin administration in both H. alvei-treated groups of KK-Ay mice (Figure S1f): effect of probiotic F(2, 27)=4.14, p<0.027; effect of time F(3, 81)=166.66, p<0.00001; probiotic × time F(6, 81)=2.094, p<0.063. Post hoc analysis revealed significant differences between both experimental groups and control at 60 and 120 min after injection (Figure S1f).

Effect of Probiotics on mRNA Expression of Metabolism-Regulating Genes in the Hypothalamus

Treatment with H. alvei-based preparations had significant effect on the mRNA expression levels of a number of hypothalamic genes involved in metabolic regulation. As shown in Figure 7a, administration of bacterial protein extract to KK mice resulted in increased mRNA expression of both insulin and leptin receptors (InsR and LepR, respectively), whereas supplementation with bacterial protein extract inhibited the expression of LepR mRNA in the KK-Ay strain (Figure 7b). The live bacteria suspension also potentiated the expression of InsR in KK mice and both InsR and LepR in KK-Ay mice. In KK mice, the expression of POMC and AgRP mRNA was stimulated after treatment with the live bacteria suspension, while in KK-Ay group, POMC mRNA synthesis was suppressed by both H. alvei formulations. Expression of oxytocin (Oxt), glucose transporter 2 (GLUT2) and sweet taste receptor subunit Tas1r3 mRNA was not affected by probiotics in either strain of mice (Figure 7a,b).

Melanocortin Receptor Type 4 (MC4R) Activation In Vitro

A dose-dependent increase in luminescence reads from the background level was observed for all three bacterial protein extracts which showed different capacities of the MC4R activation (Figure 8a). As such, the E. coli K12 extract induced the strongest MC4R activation close to 60-fold at the maximal protein concentration (10 µg/mL). In contrast, the protein extract of E. coli K12 ΔClpB induced the lowest response, reaching about 15-fold at its maximum. The H. alvei extract also stimulated MC4R by inducing its about 40-fold activation at 10 µg/mL.
The potencies of MC4R activation between 3 bacterial extracts was statistically compared at their maximal concentrations and also as a total impact of different concentrations using the area under the curve (AUC). Higher activation of MC4R by E. coli K12 rather than by ClpB deficient strain E. coli K12 ΔClpB was found using both analyzes (Figure 8b and c, respectively), validating ClpB as the main protein in E. coli K12 underlying the MC4R activation. H. alvei protein extract displayed an intermediate profile showing a tendency of stronger MC4R activation than E. coli K12 ΔClpB but which was weaker than E. coli K12 at the maximum concentration (M.W.-tests, p<0.05 for both).

Discussion

The impact of gut microbiota on the regulation of host metabolism is multifaceted, involving several molecular pathways [36]. In particular, gut microbiota may be linked to host neuroendocrine regulation of energy balance through gut bacteria-derived metabolites. Among them, bacterial ClpB protein produced by the Enterobacteriaceae and Hafniaceae families appears of interest due to its structural homology with the anorexigenic α-MSH [4,6]. Indeed, activation by ClpB of both intestinal satiety hormone PYY and hypothalamic POMC neurons [12,13] justify it as a microbiota-derived anorexigenic factor, which may act on the same targets as the endogenous anorexigenic signals α-MSH and leptin [9,11,37,38]. Thus, the primary objective of the present study was to verify the contribution of MCRs to the regulation of metabolic responses to intragastric administration of a suspension of live H. alvei bacteria or H. alvei bacterial protein extract. However, it is important to acknowledge that this does not preclude the possible involvement of other non-MCRs-mediated mechanisms of action of H. alvei – based preparations, which are beyond the scope of this discussion.
To address the objectives of the study, the experiments were performed with closely related mouse sub-strains KK.Cg-a/a and KK.Cg-Ay/a, which are established models for diabetes and obesity research [39]. The ectopic expression of the Ay allele in KK-Ay mice results in the overproduction of the agouti protein, a competitive inhibitor of the melanocortin receptors MC1R, MC3R and MC4R [21,22]. Consequently, it can be assumed that in the presence of the Ay allele, the responses to α-MSH or its mimetics should be abolished or diminished. Thus, if the primary influence of H. alvei on host metabolism is achieved through MCRs, the KK-Ay sub-strain should exhibit reduced responses to the supplementation of this probiotic as compared to the parental KK strain having functional MCRs.
Two types of H. alvei probiotic preparations were used: a live bacterial suspension and a bacterial protein extract. While bacterial proteins may act in the small intestine before they are digested and absorbed, live bacteria may reach the large intestine, where they can transiently persist and release their metabolites interacting with the intestinal epithelium and enteroendocrine cells. Thus, by using a H. alvei protein extract, it is possible that higher concentration of bacterial proteins can reach the host targets.
A more pronounced obese and diabetic traits observed in the KK-Ay mice even under a low-calorie diet confirmed the contribution of deficiency of melanocortin signaling in the obese phenotype. As such, comparison of the KK and KK-Ay control groups (saline gavage) demonstrated that the expression of the Ay allele was associated with alterations in metabolic parameters that are also characteristic of impaired melanocortin regulation, namely increased body weight, relative liver weight, blood glucose and liver glycogen (Figure 2 a,c; Figure 3 a,b). On the other hand, under a low-calorie diet, no differences were found in important obesity signs such as insulin, leptin and body fat levels between the control groups of both sub-strains. Moreover, untreated KK-Ay mice showed a slight increase in systemic energy expenditure, as well as increased lipid oxidation, primarily during the dark period (Figure 5 d,f). Why such anti-obesity metabolic parameters were not altered in the more severe obesity phenotype is unclear; we may speculate on the role of MC3R, which may remain partially functional in KK-Ay mice. A recent study has identified systemic anti-obesity effects of MC3R acting in the liver [40].
The influence of melanocortin signaling on fat mass can be through the modulation of the sympathetic and parasympathetic activity of nerve fibers innervating the adipose tissue [41]. In addition, it may involve the MCRs expressed by the adipocytes, MC3-4R as well as the fifth type of melanocortin receptor (MC5R) stimulating adipocyte lipolysis [42,43,44].
The results of the present study, generally confirmed our hypothesis that the presence of fully functional MCRs is required for a number of beneficial anti-obesity effects of H. alvei. However, while such conclusion is valid for the energy metabolism and food intake, some antidiabetic effects of probiotic treatment were present also in KK-Ay mice, which we discuss below in more details.
Importantly, we demonstrated that H. alvei protein extract has the capacity to enhance energy metabolism in KK but not in KK-Ay mice. As such, increased O2 consumption, CO2 output, carbohydrate oxidation, elevated RER and energy expenditure and locomotion were observed in KK mice during the dark phase, while in the light phase a non-significant tendency of increase was observed (Figure 4c; Figure 5 a-e). Such results indicate that the metabolic effects of H. alvei protein preparation depend on the functional presence of MCRs and are influenced by the circadian rhythm, a phenomenon which was earlier shown for the microbiota-host interactions [45]. Moreover, H. alvei suspension was effective in decreasing food intake in KK but not in KK-Ay mice (Figure 4a), indicating a role of MCRs in mediating an anorexigenic effect of H. alvei. In spite of reduced food intake in H. alvei-treated mice, we did not observe a decrease in body weight, which was probably due to a relatively short time of treatment. Nevertheless, a significant reduction of total fat mass was present in KK mice receiving H. alvei protein, demonstrating its more pronounced anti-obesity effect than the live bacteria H. alvei suspension in concordance with activation of metabolism in these mice (Figure 2b).
Taken together, these results support the role of MCRs in mediating the anti-obesity effects of H. alvei. Since such effects include food intake, locomotion and systemic energy metabolism, i.e., functions regulated primarily in the brain, it is likely that KK-Ay mutation prevents the access of H. alvei-derived α-MSH-like ligands to central MCRs underlying the absence of H. alvei anti-obesity metabolic and behavioral effects in this mouse strain.
Surprisingly, exposure to both protein extract and suspension of H. alvei also reduced total fat mass in KK-Ay mice (Figure 2b). These changes probably implicate a different regulatory pathway than in KK mice, e.g., increased lipid oxidation. Since the Ay mutation does not equally result in inhibition of all types of MCRs, in particular, retaining some sensitivity of MC3R and MC5R, it is possible that H. alvei-derived signals, such as ClpB, may directly stimulate lipolysis, re-esterification and fatty acid oxidation in adipocytes [43]. Such possibility is supported by recent demonstration of MC4Rs activation by ClpB [9].
There is now substantial evidence that live H. alvei bacteria, when administered as a probiotic dietary supplement, can reduce blood glucose levels in healthy overweight mice and humans [3,5]. Moreover, improved glucose tolerance was observed in non-diabetic lean C57B6/J mice following the administration of the H. alvei protein extract or ClpB protein [14]. The hypoglycemic effect of H. alvei and ClpB may be mediated by the action of both central and peripheral melanocortin signaling, which have been identified as key regulators of glucose and insulin homeostasis [46]. The present study, conducted on diabetic strains of mice maintained on a low-calorie diet, supported the ability of the H. alvei – based preparations to improve glucose tolerance. The treatment of the KK strain with the bacterial protein extract resulted in an enhancement of glucose clearance in IP-GTT, yet no discernible effect was observed in O-GTT (Figure 6 a,c). Different IP- and O-GTT results were also found in non-diabetic mice [14], suggesting that H. alvei-derived proteins may primarily affect post-absorptive glucose-related glycemic regulatory mechanisms. These mechanisms may involve parasympathetic cholinergic fibers innervating the pancreas and expressing MC4Rs [47,48].
Indeed, our study revealed that H. alvei extract is able to stimulate MC4R. Such effect was weaker than induced by protein extract from E. coli but stronger than ClpB deficient E. coli strain, suggesting a key role of ClpB in MC4R activation (Figure 8). Although the α-MSH-like epitope of ClpB is the same in H. alvei and E. coli, the full proteins have about 80% homology [4]. Since the entire ClpB protein is needed for the MC4R activation [9], different conformational structures of E. coli and H. alvei ClpB may underlie their different potencies of MC4R activation.
Oral treatment with H. alvei protein extract (O-GTT) improved glucose tolerance in KK-Ay mice. In IP-GTT, both H. alvei protein extract and live bacteria significantly enhanced blood glucose clearance (Figure 6 b,d). These effects were distinct from those in KK mice, since the improvement was due to a lower baseline glucose level in treated groups of KK-Ay, as demonstrated by comparing the percentage of changes in blood glucose levels from the pre-test baseline levels (Figure 1S). In KK-Ay mice, H. alvei-derived ClpB in the intestinal lumen was likely able to activate the secretion of incretin hormones before glucose load. Improved insulin resistance found in the KK-Ay mice treated with live bacteria further supports the contribution of the incretin effect (Figure 6f). Moreover, reduced liver glycogen content in KK-Ay mice (Figure 3b) may reflect a long-term improvement of tissue glucose utilization. We can also speculate that the novelty of the cage environment during the preparation of these assays contributed to the decrease in glucose levels in ClpB, likely through the activation of the endogenous melanocortin system, known for its role in novelty acquisition [49].
The aforementioned results indicate that the Ay mutation has diminishing effect on the probiotics capability to reduce food intake and carbohydrate oxidation, yet it does not prevent their beneficial effect on glucose tolerance and lipolysis. These results can be interpreted as indication for the ability of the probiotic-derived proteins to compete with the agouti protein at some peripheral targets, e.g., gut, liver and adipose tissue, thereby improving the agouti-dependent obesity phenotype. Conversely, the central targets involved in appetite regulation and energy metabolism are presumably less susceptible to such competitive interactions. It is relevant to reiterate that the Ay mutation causing abundant expression of ASIP does not inhibit all types of melanocortin receptors. ASIP shows weak affinity for mouse MC3R [22]. In addition, the Ay mutation has almost no effect on the interaction of α-MSH with MC5R, which is involved in mediating glucose uptake by skeletal muscles [42]. The above described MCR-independent beneficial effects of probiotics on lipid and glucose metabolism in KK-Ay mice are of particular interest for their potential relevance for the treatment of some rare monogenic forms of human obesity due to ectopic expression of ASIP [50].
Expression of hypothalamic neuropeptides regulating appetite and energy metabolism is affected by gut microbiota composition [51]. Here we show that the administration of the bacterial protein extract or live H. alvei bacteria resulted in a discernible impact on the mRNA levels of POMC and AgRP in the hypothalamus. A substantial discrepancy was observed in the responses exhibited by the KK and KK-Ay strains. Treatment with suspension of live bacteria upregulated the expression of POMC mRNA in the KK strain (Figure 7a) which is concordant with the decrease of food intake in this group (Figure 4a), but both live bacteria and bacterial protein extract reduced POMC and AgRP expression in the KK-Ay strain (Figure 7b). Therefore, the non-selective competitive inhibition of MCR on the background of the Ay mutation resulted in the silencing of the probiotic’s effect on the expression of both orexigenic (AgRP) and anorexigenic (POMC) hypothalamic neuropeptides. It’s possible that such effect on AgRP was secondary to the H. alvei induction of gut satiety hormones, whose anorexigenic effect was nevertheless silenced by arcuate neurons by downstream MC4R inhibition.
The insulin and leptin receptors activate the POMC neurons and inhibit the AgRP neurons in the hypothalamus [52,53]. Our study shows that H. alvei-based probiotic preparations increase the expression of LepR and InsR mRNA in the hypothalamus. The H. alvei protein extract increased the expression of InsR and LepR mRNA in the KK mouse strain, but not in the KK-Ay strain, suggesting that MCRs are involved in the response (Figure 7). Treatment with a suspension of live bacteria increased the expression of LepR and InsR mRNA in the hypothalamus of both strains of mice with almost equal efficacy, suggesting that this pathway of probiotic action may be indirect.

Conclusions

The study in closely related mouse sub-strains that differ in MCRs signaling, KK.Cg-a/a and KK.Cg-Ay/a, known as genetic models of obesity and D2T, revealed that the body weight lowering and hypoglycemic effects of the probiotic bacterium Hafnia alvei HA4597 are mediated by MCRs. Treatment of KK mice with H. alvei protein extract stimulated total energy expenditure and carbohydrate oxidation but reduced lipid oxidation, leptin levels and pancreatic weight. The increased expression of insulin and leptin receptors in the hypothalamus of KK mice may contribute to these beneficial effects. Furthermore, in vitro analysis showed that the melanocortin receptor type 4 is a target for the H. alvei protein extract, which increases receptor activity.
Additionally, it was established that several beneficial effects of H. alvei-based probiotics on energy metabolism were sustained in the agouti-mutated strain such as reduction of body fat with certain effects being more marked than in KK mice including a reduction of liver glycogen and improved glucose tolerance. This indicates the potential significance of H. alvei protein extract in the management of some rare monogenic forms of human obesity in particular those caused by ectopic expression of ASIP. Taken together with the demonstration of the capacity of H. alvei protein extract to activate MC4R, the study suggests that both bacterial suspension and bacterial protein extract of the H. alvei 4597 strain, may represent an effective addition to the treatment of diabetes and obesity in D2T patients.

Author Contributions

Conceptualization, data curation, V.Z., S.F.; Investigation, V.M., E.S., E.L., R.K., A.S., B.T.; Formal analysis, validation, V.M., E.S., B.T.; Methodology, V.Z., S.F.;Writing, V.Z., V.M.; Writing – review and editing, V.Z., S.F.;Project administration, S.F.

Funding

Supported by the “Pavlov Center - Integrative Physiology to Medicine, High-tech Healthcare and Technologies of Stress Resistance”, grant № 075-15-2020-921 from 13.11.2020, Russia.

Institutional Review Board Statement

approved by the Animal Care and Use Committee at the Pavlov Institute of Physiology (Animal Welfare Assurance #A5952-01), approval No. 03/15 dated March 15, 2022.

Data Availability Statement

The raw and processed data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

Authors thank Dr. N.S. Pestereva from Institute of Experimental Medicine, Saint-Petersburg, Russia for preparing probiotic formulation and Mrs. I.E. Bogatyrova from Pavlov Institute of Physiology, Saint-Petersburg, Russia for breeding of experimental animals.

Conflicts of Interest

The authors declare no conflict of interest; all authors have read and agreed to the published version of the manuscript. S.O.F. is an inventor on the patent protecting the use of anorexigenic properties of ClpB (WO2015082633). The patent is licensed to BIOCODEX, France which manufactures and commercializes ClpB-producing Hafnia alvei HA4597 probiotic for the control of body weight.

References

  1. Ramos-Vivas, J.; Tapia, O.; Elexpuru-Zabaleta, M.; Pifarre, K.T.; Armas Diaz, Y.; Battino, M.; et al. The molecular weaponry produced by the bacterium Hafnia alvei in foods. Molecules 2022, 27, 5585. [Google Scholar] [CrossRef] [PubMed]
  2. Vallianou, N.G.; Kounatidis, D.; Tsilingiris, D.; Panagopoulos, F.; Christodoulatos, G.S.; Evangelopoulos, A.; et al. The role of next-generation probiotics in obesity and obesity-associated disorders: current knowledge and future perspectives. Int. J. Mol. Sci. 2023, 24(7), 6755. [Google Scholar] [CrossRef] [PubMed]
  3. Déchelotte, P.; Breton, J.; Trotin-Picolo, C.; Grube, B.; Erlenbeck, C.; Bothe, G.; et al. The probiotic strain H. alvei HA4597® improves weight loss in overweight subjects under moderate hypocaloric diet: a proof-of-concept, multicenter randomized, double-blind placebo-controlled study. Nutrients 2021, 13(6), 1902. [Google Scholar] [CrossRef] [PubMed]
  4. Legrand, R.; Lucas, N.; Dominique, M.; Azhar, S.; Deroissart, C.; Le Solliec, M.A.; et al. Commensal Hafnia alvei strain reduces food intake and fat mass in obese mice-a new potential probiotic for appetite and body weight management. Int. J. Obes. (Lond) 2020, 44(5), 1041–1051. [Google Scholar] [CrossRef] [PubMed]
  5. Lucas, N.; Legrand, R.; Deroissart, C.; Dominique, M.; Azhar, S.; Le Solliec, M.A.; et al. Hafnia alvei HA4597 strain reduces food intake and body weight gain and improves body composition, glucose, and lipid metabolism in a mouse model of hyperphagic obesity. Microorganisms 2019, 8(1), 35. [Google Scholar] [CrossRef] [PubMed]
  6. Tennoune, N.; Chan, P.; Breton, J.; Legrand, R.; Chabane, Y.N.; Akkermann, K.; et al. Bacterial ClpB heat-shock protein, an antigen-mimetic of the anorexigenic peptide α-MSH, at the origin of eating disorders. Transl. Psychiatry. 2014, 4(10), e458. [Google Scholar] [CrossRef] [PubMed]
  7. Yeo, G.S.H.; Chao, D.H.M.; Siegert, A.M.; Koerperich, Z.M.; Ericson, M.D.; Simonds, S.E.; et al. The melanocortin pathway and energy homeostasis: From discovery to obesity therapy. Mol. Metab. 2021, 48, 101206. [Google Scholar] [CrossRef] [PubMed]
  8. Fan, W.; Boston, B.A.; Kesterson, R.A.; Hruby, V.J.; Cone, R.D. Role of melanocortinergic neurons in feeding and the agouti obesity syndrome. Nature 1997, 385(6612), 165–8. [Google Scholar] [CrossRef] [PubMed]
  9. Thomas, B.; Andreani, N.A.; Lahaye, E.; Wallart, L.; Duraisamy, K.; Lefranc, B.; et al. Immunization reveals a key role of Enterobacterial ClpB protein in the development of host anorexia. Brain Behav. Immun. 2026, 131, 106152. [Google Scholar] [CrossRef] [PubMed]
  10. Mountjoy, K.G.; Mortrud, M.T.; Low, M.J.; Simerly, R.B.; Cone, R.D. Localization of the melanocortin-4 receptor (MC4-R) in neuroendocrine and autonomic control circuits in the brain. Mol. Endocrinol. 1994, 8, 1298–1308. [Google Scholar] [CrossRef] [PubMed]
  11. Panaro, B.L.; Tough, I.R.; Engelstoft, M.S.; Matthews, R.T.; Digby, G.J.; Møller, C.L.; et al. The melanocortin-4 receptor is expressed in enteroendocrine L cells and regulates the release of peptide YY and glucagon-like peptide 1 in vivo. Cell Metab. 2014, 20(6), 1018–29. [Google Scholar] [CrossRef] [PubMed]
  12. Dominique, M.; Lucas, N.; Legrand, R.; Bouleté, I.-M.; Bôle-Feysot, C.; Deroissart, C.; et al. Effects of bacterial CLPB protein fragments on food intake and PYY secretion. Nutrients 2021, 13(7), 2223. [Google Scholar] [CrossRef] [PubMed]
  13. Breton, J.; Tennoune, N.; Lucas, N.; Francois, M.; Legrand, R.; Jacquemot, J.; et al. Gut commensal E. coli proteins activate host satiety pathways following nutrient-induced bacterial growth. Cell Metab. 2016, 23(2), 324–334. [Google Scholar] [CrossRef] [PubMed]
  14. Zolotarev, V.A.; Murovets, V.O.; Sepp, A.L.; Sozontov, E.A.; Lukina, E.A.; Khropycheva, R.P.; et al. Protein extract of a probiotic strain of Hafnia alvei and bacterial ClpB protein improve glucose tolerance in mice. Int. J. Mol. Sci. 2023, 24(13), 10590. [Google Scholar] [CrossRef] [PubMed]
  15. Clee, S.M.; Attie, A.D. The genetic landscape of type 2 diabetes in mice. Endocr. Rev. 2007, 28(1), 48–83. [Google Scholar] [CrossRef] [PubMed]
  16. Staats, J. Standardized nomenclature for inbred strains of mice: fifth listing. Cancer Res. 1972, 32(8), 1609–1646. [Google Scholar] [PubMed]
  17. Wang, Y.W.; Sun, G.D.; Sun, J.; Liu, S.J.; Wang, J.; Xu, X.H.; et al. Spontaneous type 2 diabetic rodent models. J. Diabetes Res. 2013, 2013, 401723. [Google Scholar] [CrossRef] [PubMed]
  18. Scroyen, I.; Hemmeryckx, B.; Lijnen, H.R. From mice to men--mouse models in obesity research: what can we learn? Thromb. Haemost. 2013, 110(4), 634–40. [Google Scholar] [CrossRef] [PubMed]
  19. Kanasaki, K.; Koya, D. Biology of obesity: lessons from animal models of obesity. J. BioMed Biotechnol. 2011, 2011, 197636. [Google Scholar] [CrossRef] [PubMed]
  20. Lee, W.S.; Kim, J. Application of animal models in diabetic cardiomyopathy. Diabetes Metab. J. 2021, 45(2), 129–145. [Google Scholar] [CrossRef] [PubMed]
  21. McNulty, J.C.; Jackson, P.J.; Thompson, D.A.; Chai, B.; Gantz, I.; Barsh, G.S.; et al. Structures of the agouti signaling protein. J. Mol. Biol. 2005, 346(4), 1059–70. [Google Scholar] [CrossRef] [PubMed]
  22. Lu, D.; Willard, D.; Patel, I.R.; Kadwell, S.; Overton, L.; Kost, T.; et al. Agouti protein is an antagonist of the melanocyte stimulating hormone receptor. Nature 1994, 371, 799–802. [Google Scholar] [CrossRef] [PubMed]
  23. Boston, B.A.; Cone, R.D. Characterization of melanocortin receptor subtype expression in murine adipose tissues and in 3T3-LI cell line. Endocrinology 1996, 137, 2043–50. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, Y.K.; Ollmann, M.M.; Wilson, B.D.; Dickinson, C.; Yamada, T.; Barsh, G.S.; et al. Effects of recombinant ASIP on melanocortin action. Mol. Endocrinol. 1997, 11, 274–280. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, Y.K.; Thompson, D.A.; Dickinson, C.J.; Wilken, J.; Barsh, G.S.; Kent, S.B.; et al. Characterization of Agouti-related protein binding to melanocortin receptors. Mol. Endocrinol. 1999, 13(1), 148–55. [Google Scholar] [CrossRef]
  26. Ollmann, M.M.; Wilson, B.D.; Yang, Y.-K.; Kerns, J.A.; Chen, Y.; Gantz, I.; et al. Agouti-related protein is an endogenous antagonist of the melanocortin-4 receptor in vitro and in vivo. Science 1997, 278, 135–138. [Google Scholar] [CrossRef] [PubMed]
  27. Tao, Y.X.; Huang, H.; Wang, Z.-Q.; Yang, F.; Williams, J.N.; Nikiforovich, G.V. Constitutive activity of neural melanocortin receptors. Methods Enzymol. 2010, 484, 267–279. [Google Scholar] [CrossRef] [PubMed]
  28. Gantz, I.; Miwa, H.; Konda, Y.; Shimoto, Y.; Tashiro, T.; Watson, S.J.; et al. Molecular cloning, expression, and gene localization of a fourth melanocortin receptor. J. Biol. Chem. 1993, 268, 15174–15179. [Google Scholar] [CrossRef]
  29. Peach, M.; Marsh, N.; MacPhee, D.J. Protein solubilization: attend to the choice of lysis buffer. Methods Mol. Biol. 2012, 869, 37–47. [Google Scholar] [CrossRef] [PubMed]
  30. Weir, J. New methods for calculating metabolic rate with special reference to protein metabolism. J. Physiol. 1949, 109, 1–9. [Google Scholar] [CrossRef] [PubMed]
  31. Ferrannini, E. The theoretical bases of indirect calorimetry: a review. Metabolism 1988, 37, 287–301. [Google Scholar] [CrossRef] [PubMed]
  32. Peronnet, F.; Massicotte, D. Table of nonprotein quotient: An update. Can. J. Sport Sci. 1991, 16, 23–29. [Google Scholar] [PubMed]
  33. American Veterinary Medical Association. AVMA guidelines on euthanasia, 2007 update. 16 June 2011. Available online: http://www.avma.org/issues/animal_welfare/euthanasia.pdf.
  34. Danchenko, E.O.; Chirkin, A.A. A new approach to the determination of glycogen concentration in various tissues and comments on the interpretation of its results. Sud. Med. Ekspert. 2010, 53, 25–28. [Google Scholar] [PubMed]
  35. Mogk, A.; Schlieker, C.; Strub, C.; Rist, W.; Weibezahn, J.; Bukau, B. Roles of Individual Domains and Conserved Motifs of the AAA+ Chaperone ClpB in Oligomerization, ATP Hydrolysis, and Chaperone Activity. Journ. Biol. Chem. 2003, 278, 17615–17624. [Google Scholar] [CrossRef] [PubMed]
  36. Pizarroso, N.A.; Fuciños, P.; Gonçalves, C.; Pastrana, L.; Amado, I.R. A Review on the Role of Food-Derived Bioactive Molecules and the Microbiota-Gut-Brain Axis in Satiety Regulation. Nutrients 2021, 13(2), 632. [Google Scholar] [CrossRef] [PubMed]
  37. Halaas, J.L.; Gajiwala, K.S.; Maffei, M.; Cohen, S.L.; Chait, B.T.; Rabinowitz, D.; et al. Weight-reducing effects of the plasma protein encoded by the obese gene. Science 1995, 269(5223), 543–6. [Google Scholar] [CrossRef] [PubMed]
  38. Cowley, M.A.; Smart, J.L.; Rubinstein, M.; Cerdán, M.G.; Diano, S.; Horvath, TLet. Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature 2001, 411(6836), 480–4. [Google Scholar] [CrossRef] [PubMed]
  39. Chowdhury, N.N.; Surowiec, R.K.; Kohler, R.K.; Reul, O.N.; Segvich, D.M.; Wallace, J.M. Metabolic and skeletal characterization of the KK/A(y) mouse model-a polygenic mutation model of obese type 2 diabetes. Calcif. Tissue Int. 2024, 114, 638–649. [Google Scholar] [CrossRef] [PubMed]
  40. Patel, T.P.; Jun, J.Y.; Seo, A.Y.; Levi, N.J.; Elizondo, D.M.; Chen, J.; et al. Melanocortin 3 receptor regulates hepatic autophagy and systemic adiposity. Nat. Commun. 2025, 16, 1690. [Google Scholar] [CrossRef] [PubMed]
  41. Holland, J.; Sorrell, J.; Yates, E.; Smith, K.; Arbabi, S.; Arnold, M.; et al. Brain-melanocortin-vagus axis mediates adipose tissue expansion independently of energy intake. Cell Rep. 2019, 27(8), 2399–2410. [Google Scholar] [CrossRef] [PubMed]
  42. Ji, L.Q.; Hong, Y.; Tao, Y.X. Melanocortin-5 receptor: pharmacology and its regulation of energy metabolism. Int. J. Mol. Sci. 2022, 23(15), 8727. [Google Scholar] [CrossRef] [PubMed]
  43. Shipp, S.L.; Cline, M.A.; Gilbert, E.R. Recent advances in the understanding of how neuropeptide Y and α-melanocyte stimulating hormone function in adipose physiology. Adipocyte 2016, 5, 333–350. [Google Scholar] [CrossRef] [PubMed]
  44. Hoggard, N.; Hunter, L.; Duncan, J.S.; Rayner, D.V. Regulation of adipose tissue leptin secretion by alpha-melanocyte-stimulating hormone and agouti-related protein: further evidence of an interaction between leptin and the melanocortin signaling system. J. Mol. Endocrinol. 2004, 32(1), 145–53. [Google Scholar] [CrossRef] [PubMed]
  45. Thaiss, C.A.; Zeevi, D.; Levy, M.; Zilberman-Schapira, G.; Suez, J.; et al. Trans kingdom control of microbiota diurnal oscillations promotes metabolic homeostasis. Cell. 2014, 159(3), 514–29. [Google Scholar] [CrossRef] [PubMed]
  46. Girardet, C.; Butler, A.A. Neural melanocortin receptors in obesity and related metabolic disorders. Biochim Biophys. Acta 2014, 1842, 482–494. [Google Scholar] [CrossRef] [PubMed]
  47. Rossi, J.; Balthasar, N.; Olson, D.; Scott, M.; Berglund, E.; Lee, C.E.; et al. Melanocortin-4 receptors expressed by cholinergic neurons regulate energy balance and glucose homeostasis. Cell Metab. 2011, 13, 195–204. [Google Scholar] [CrossRef] [PubMed]
  48. Jimenez-Gonzalez, M.; Li, R.; Pomeranz, L.E.; Alvarsson, A.; Marongiu, R.; Hampton, R.F.; et al. Mapping and targeted viral activation of pancreatic nerves in mice reveal their roles in the regulation of glucose metabolism. Nat. BioMed Eng. 2022, 6, 1298–1316. [Google Scholar] [CrossRef] [PubMed]
  49. De Wied, Jolles J. Neuropeptides derived from pro-opiocortin: behavioral, physiological, and neurochemical effects. Physiol. Rev. 1982, 62, 976–1059. [Google Scholar] [CrossRef] [PubMed]
  50. Kempf, E.; Landgraf, K.; Stein, R.; Hanschkow, M.; Hilbert, A.; Abou Jamra, R.; et al. Aberrant expression of agouti signaling protein (ASIP) as a cause of monogenic severe childhood obesity. Nat. Metab. 2022, 4(12), 1697–1712. [Google Scholar] [CrossRef] [PubMed]
  51. Roubalová, R.; Procházková, P.; Kovářová, T.; Ježková, J.; Hrnčíř, T.; Tlaskalová-Hogenová, H.; et al. Influence of the gut microbiome on appetite-regulating neuropeptides in the hypothalamus: insight from conventional, antibiotic-treated, and germ-free mouse models of anorexia nervosa. Neurobiol. Dis. 2024, 193, 106460. [Google Scholar] [CrossRef] [PubMed]
  52. Shin, A.C.; Filatova, N.; Lindtner, C.; Chi, T.; Degann, S.; Oberlin, D.; et al. Insulin receptor signaling in POMC, but not AgRP, neurons controls adipose tissue insulin action. Diabetes 2017, 66(6), 1560–1571. [Google Scholar] [CrossRef] [PubMed]
  53. Korner, J.; Savontaus, E.; Chua, S.C., Jr.; Leibel, R.L.; Wardlaw, S.L. Leptin regulation of Agrp and Npy mRNA in the rat hypothalamus. J. Neuroendocrinol. 2001, 13(11), 959–66. [Google Scholar] [CrossRef] [PubMed]
Preprints 218644 g001
Figure 1. Experimental design.
Figure 1. Experimental design.
Preprints 218644 g001
Preprints 218644 g002
Figure 2. The effect of a 21-day gavage of KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay) mice with total protein extract of Hafnia alvei (H. alvei protein) or suspension of H. alvei bacteria (H. alvei susp.). Body weight (a), body fat content (b), liver mass (c) and pancreatic mass (d) relative to 100% of body mass (b–d). Control mice received 200 µL of saline by gavage. Comparisons using Student’s t-test: && p<0.01 –between control groups of KK and KK-Ay; ** p<0.01 – KK control vs. KK protein; # p<0.05, ## p<0.01 – KK-Ay control vs. KK-Ay experiment group. Number of animals KK/Agouti yellow per group: controls – 12/15, H. alvei protein extract – 5/10, H. alvei suspension – 6/8.
Figure 2. The effect of a 21-day gavage of KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay) mice with total protein extract of Hafnia alvei (H. alvei protein) or suspension of H. alvei bacteria (H. alvei susp.). Body weight (a), body fat content (b), liver mass (c) and pancreatic mass (d) relative to 100% of body mass (b–d). Control mice received 200 µL of saline by gavage. Comparisons using Student’s t-test: && p<0.01 –between control groups of KK and KK-Ay; ** p<0.01 – KK control vs. KK protein; # p<0.05, ## p<0.01 – KK-Ay control vs. KK-Ay experiment group. Number of animals KK/Agouti yellow per group: controls – 12/15, H. alvei protein extract – 5/10, H. alvei suspension – 6/8.
Preprints 218644 g002
Preprints 218644 g003
Figure 3. The effect of intragastric administration of H. alvei protein extract (H. alvei protein) or H. alvei bacterial suspension (H. alvei susp.) on baseline glucose level (a), glycogen concentration in the liver (b), insulin (c) and leptin (d) levels in plasma in mouse sub-strains KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay). Nonfasted animals after 21 days of probiotic treatment. Control mice received 200 µL of saline by gavage. Comparisons using Student’s t-test: && p<0.01 –between control groups of KK and KK-Ay; * p<0.05 – KK control vs. KK protein; # p<0.05 – control KK-Ay vs. KK-Ay protein group. Number of animals per strain: KK control – 9~12; KK with H. alvei protein – 4~5; KK with H. alvei suspension – 6; KK-Ay control – 11~15; KK-Ay with H. alvei protein – 9~10; KK-Ay with H. alvei suspension – 8.
Figure 3. The effect of intragastric administration of H. alvei protein extract (H. alvei protein) or H. alvei bacterial suspension (H. alvei susp.) on baseline glucose level (a), glycogen concentration in the liver (b), insulin (c) and leptin (d) levels in plasma in mouse sub-strains KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay). Nonfasted animals after 21 days of probiotic treatment. Control mice received 200 µL of saline by gavage. Comparisons using Student’s t-test: && p<0.01 –between control groups of KK and KK-Ay; * p<0.05 – KK control vs. KK protein; # p<0.05 – control KK-Ay vs. KK-Ay protein group. Number of animals per strain: KK control – 9~12; KK with H. alvei protein – 4~5; KK with H. alvei suspension – 6; KK-Ay control – 11~15; KK-Ay with H. alvei protein – 9~10; KK-Ay with H. alvei suspension – 8.
Preprints 218644 g003
Preprints 218644 g004
Figure 4. The effect of H. alvei protein extract (H. alvei protein) or H. alvei bacterial suspension (H. alvei susp.) on food (a) and water (b) consumption and locomotor activity (c) in KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay) mice. Control groups received saline.
Figure 4. The effect of H. alvei protein extract (H. alvei protein) or H. alvei bacterial suspension (H. alvei susp.) on food (a) and water (b) consumption and locomotor activity (c) in KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay) mice. Control groups received saline.
Preprints 218644 g004
Preprints 218644 g005
Figure 5. The effect of intragastric administration of H. alvei protein extract (H. alvei protein) or H. alvei bacterial suspension (H. alvei susp.) on respiratory exchange and energy balance in KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay) mice: a) oxygen consumption, b) CO2 production, c) respiratory exchange ratio – RER, d) energy expenditure, e) carbohydrate oxidation, f) lipid oxidation. The control group received saline solution.
Figure 5. The effect of intragastric administration of H. alvei protein extract (H. alvei protein) or H. alvei bacterial suspension (H. alvei susp.) on respiratory exchange and energy balance in KK.Cg-a/a (KK) and KK.Cg-Ay/a (Agouti yellow; KK-Ay) mice: a) oxygen consumption, b) CO2 production, c) respiratory exchange ratio – RER, d) energy expenditure, e) carbohydrate oxidation, f) lipid oxidation. The control group received saline solution.
Preprints 218644 g005
Preprints 218644 g006
Figure 6. The effect of intragastric administration of H. alvei protein extract or H. alvei bacterial suspension on glucose (a–d) and insulin (e, f) tolerance in the KK.Cg-a/a (KK) or KK.Cg-Ay/a (KK-Ay) mouse sub-strains as compared to controls receiving saline. Panels a-d demonstrate the change in plasma glucose concentration following oral (O) or IP glucose load. The area under the concentration curve (AUC) is shown as a histogram in the panel. Glucose tolerance was evaluated following a 6-hour food deprivation; animals were administrated 1.0 g/kg glucose.
Figure 6. The effect of intragastric administration of H. alvei protein extract or H. alvei bacterial suspension on glucose (a–d) and insulin (e, f) tolerance in the KK.Cg-a/a (KK) or KK.Cg-Ay/a (KK-Ay) mouse sub-strains as compared to controls receiving saline. Panels a-d demonstrate the change in plasma glucose concentration following oral (O) or IP glucose load. The area under the concentration curve (AUC) is shown as a histogram in the panel. Glucose tolerance was evaluated following a 6-hour food deprivation; animals were administrated 1.0 g/kg glucose.
Preprints 218644 g006
Preprints 218644 g007
Figure 7. Expression of mRNA of hypothalamic metabolism-regulating genes in mouse sub-strains KK.Cg-a/a (KK, a) and KK.Cg-Ay/a (KK-Ay, b) treated via gavage with H. alvei protein extract or H. alvei bacterial suspension for 21 days. The control group received saline. Data is presented as a relative quantity (RQ=2-ddCt) to the control group. POMC – proopiomelanocortin, AgRP – agouti-related peptide, Oxt- oxytocin, InsR- insulin receptor, LepR -leptin receptor, GLUT2 – glucose transporter 2, Tas1r3 – type 1 taste receptor subtype 3. Comparisons with control group were made using Student’s t-test: * p<0.05, ** p<0.01 – control vs. protein; # p<0.05, ## p<0.01 – control vs. bacteria. Number of animals KK/KK-Ay per group: control – 5/7, H. alvei protein extract – 5/3~8, H. alvei suspension – 4/3.
Figure 7. Expression of mRNA of hypothalamic metabolism-regulating genes in mouse sub-strains KK.Cg-a/a (KK, a) and KK.Cg-Ay/a (KK-Ay, b) treated via gavage with H. alvei protein extract or H. alvei bacterial suspension for 21 days. The control group received saline. Data is presented as a relative quantity (RQ=2-ddCt) to the control group. POMC – proopiomelanocortin, AgRP – agouti-related peptide, Oxt- oxytocin, InsR- insulin receptor, LepR -leptin receptor, GLUT2 – glucose transporter 2, Tas1r3 – type 1 taste receptor subtype 3. Comparisons with control group were made using Student’s t-test: * p<0.05, ** p<0.01 – control vs. protein; # p<0.05, ## p<0.01 – control vs. bacteria. Number of animals KK/KK-Ay per group: control – 5/7, H. alvei protein extract – 5/3~8, H. alvei suspension – 4/3.
Preprints 218644 g007
Preprints 218644 g008
Figure 8. In vitro activation of MC4R by bacterial protein extracts from E. coli K12 (n=10), E. coli K12 ΔClpB (n=10), and H. alvei (n=10) using TANGO assay of β-arrestin recruitment measured as relative luminescence units (RLU). A) Dose-response of MC4R activation by bacterial protein extracts as fold RLU change over baseline. B) The maximal RLU fold change of MC4R activation at 10 µg/mL of bacterial protein extracts. C) The area under the curve (AUC) of MC4R activation over the full range of bacterial protein extract concentrations. Data are presented as mean ± SEM. Kruskal-Wallis tests, p<0.0001 and p<0.05, Dunn’s post-tests, ***p<0.001 and *p<0.05 in B and C, respectively.
Figure 8. In vitro activation of MC4R by bacterial protein extracts from E. coli K12 (n=10), E. coli K12 ΔClpB (n=10), and H. alvei (n=10) using TANGO assay of β-arrestin recruitment measured as relative luminescence units (RLU). A) Dose-response of MC4R activation by bacterial protein extracts as fold RLU change over baseline. B) The maximal RLU fold change of MC4R activation at 10 µg/mL of bacterial protein extracts. C) The area under the curve (AUC) of MC4R activation over the full range of bacterial protein extract concentrations. Data are presented as mean ± SEM. Kruskal-Wallis tests, p<0.0001 and p<0.05, Dunn’s post-tests, ***p<0.001 and *p<0.05 in B and C, respectively.
Preprints 218644 g008
Table 1. PCR primer sequences.
Table 1. PCR primer sequences.
Gene (abbreviation) Forward primer (5’ to 3’) Reverse primer (5’ to 3’) Tann (f/r) Pro-duct length, b.p.
Beta-2-microglobulin (B2M) ACAGTTCCACCCGCCT
CACATT		 TAGAAAGACCAGTCCTTGCT
GAAG		 60/60 105
Beta-actin (ActB) CATTGCTGACAGGATG
CAGAAGG		 TGCTGGAAGGTGGACAGTG
AGG		 60/60 138
Type 1 taste receptor subtype 3 (Tas1r3) ATAGTGCCAGCATGGA
TCGG		 CCTTCCCGGCCATAGTC
ATC		 60/60 166
Leptin receptor (LepR) GTGATATTTGGTCCTCT
TCTTCTGG		 CTGCTTTCAGGGTCTGG
TGT		 59.2/59.9 140
Insulin receptor (InsR) TTGGAGCCTTTCTAA
ATGTTTCCCTGT		 AATACAGTTCAGCTCTTC
CTGCCAATC		 63/63.4 129
Pro-opiomelanocortin (POMC) CAGTGCCAGGACCTCA
CC		 CAGCGAGAGGTCGAG
TTTG		 59/59 72
Agouti-related peptide (AgRP) CCCAGAGTTCCCAGGTCT
AAGTCT		 CACCTCCGCCAAAGC
TTCT		 61/61 100
Oxytocin (Oxt) GACCTGGATATGCGCAA
GTGT 		GAAGCAGCCCAGCTC
GTC		 60/61 96
Facilitated glucose transporter, member 2 (GLUT2) GCCTAAAACCGAGGAA
CCGAC		 TCGCACACCGAGGAAG
GAAT		 61.3/61.5 72
Tann (f/r) - annealing temperature.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
bsky
MDPI Initiatives
Important Links
Subscribe

© 2026 MDPI (Basel, Switzerland) unless otherwise stated

Accessibility

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings