Submitted:
04 June 2026
Posted:
05 June 2026
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Genome Editing Design
2.2. Bacterial strains and growth conditions
2.3. Isolation of plasmid DNA
2.4. Subcloning and construction of the pMBSacB-sip vector
2.5. Transformation of L. lactis with pMBSacB-sip and generation of single-crossover intermediates
2.6. Site-directed mutagenesis of the upp locus by allelic exchange and sucrose counterselection
2.7. DNA sequencing
2.8. Bioinformatic analysis
2.9. Comparison of bacterial growth kinetics
2.10. Analysis of rSIP expression by Western blotting
2.11. Indirect immunofluorescence and confocal microscopy
2.12. Ethical statement
2.13. Oral administration, clinical monitoring, and preliminary immunogenicity
2.14. ELISA
2.15. Statistical analyses
3. Results
3.1. Generation and Characterization of L. lactis-SIP
3.1.1. pMBSacB-sip enabled targeted knock-in of the sip expression cassette at the upp locus
3.1.2. The sip cassette was successfully integrated into the target locus of the L. lactis NZ9000 genome
3.1.3. Insertion of the rSIP expression cassette did not alter the in vitro growth of L. lactis-SIP
3.1.4. L. lactis-SIP expresses rSIP in a nisin-dependent manner
3.1.5. rSIP is localized on the bacterial surface of L. lactis-SIP
3.1.6. Pilot safety and preliminary immunogenicity after oral administration
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| APC | Antigen-Presenting Cells |
| bp | base pair |
| BHI | Brain Heart Infusion |
| CFU | colony-forming units |
| EOD | Early-Onset Disease |
| FDA | Food and Drug Administration |
| GBS | Group B Streptococcus |
| GALT | Gut-Associated Lymphoid Tissue |
| GMO | Genetically Modified Organism |
| GRAS | Generally Recognized as Safe |
| IAP | Intrapartum Antibiotic Prophylaxis |
| IGV | Integrative Genomics Viewer |
| LB | Luria Bertani |
| L. lactis | Lactococcus lactis |
| LOD | Late-Onset Disease |
| OD | optical density |
| ORF | Open Reading Frame |
| PFA | paraformaldehyde |
| rSIP | recombinant Surface Immunogenic Protein |
| SIP | Surface Immunogenic Protein |
| UMP | Uridine monophosphate |
| WHO | World Health Organization |
References
- B. Armistead, E. Oler, K. Adams Waldorf, and L. Rajagopal, “The Double Life of Group B Streptococcus: Asymptomatic Colonizer and Potent Pathogen,” Jul. 26, 2019, Academic Press. [CrossRef]
- S. Shabayek and B. Spellerberg, “Group B streptococcal colonization, molecular characteristics, and epidemiology,” Front. Microbiol., vol. 9, no. MAR, pp. 1–14, 2018. [CrossRef]
- American College of Obstetricians and Gynecologists, “Committee Opinion No. 797: Prevention of Group B Streptococcal Early-Onset Disease in Newborns: Correction,” Obstetrics & Gynecology, vol. 135, no. 4, pp. 978–979, Apr. 2020. [CrossRef]
- H. C. Slotved, F. Kong, L. Lambertsen, S. Sauer, and G. L. Gilbert, “Serotype IX, a proposed new Streptococcus agalactiae serotype,” J. Clin. Microbiol., vol. 45, no. 9, pp. 2929–2936, 2007. [CrossRef]
- N. J. Russell et al., “Risk of Early-Onset Neonatal Group B Streptococcal Disease with Maternal Colonization Worldwide: Systematic Review and Meta-analyses,” Clinical Infectious Diseases, vol. 65, no. Suppl 2, pp. S152–S159, 2017. [CrossRef]
- J. M. S. Pena, P. S. Lannes-Costa, and P. E. Nagao, “Vaccines for Streptococcus agalactiae: current status and future perspectives,” Front. Immunol., vol. 15, Jun. 2024. [CrossRef]
- S. Rioux, D. Martin, H. W. Ackermann, J. Dumont, J. Hamel, and B. R. Brodeur, “Localization of surface immunogenic protein on group B streptococcus,” Infect. Immun., vol. 69, no. 8, pp. 5162–5165, 2001. [CrossRef]
- D. Martin et al., “Protection from group B streptococcal infection in neonatal mice by maternal immunization with recombinant Sip protein,” Infect. Immun., vol. 70, no. 9, pp. 4897–4901, 2002. [CrossRef]
- B. R. Brodeur et al., “Identification of group B streptococcal sip protein, which elicits cross-protective immunity,” Infect. Immun., vol. 68, no. 10, pp. 5610–5618, 2000. [CrossRef]
- K. Firestone et al., “A CRISPRi library screen in group B Streptococcus identifies surface immunogenic protein (Sip) as a mediator of multiple host interactions,” Infect. Immun., vol. 93, no. 4, Apr. 2025. [CrossRef]
- D. A. Diaz-Dinamarca et al., “Surface immunogenic protein of streptococcus group b is an agonist of toll-like receptors 2 and 4 and a potential immune adjuvant,” Vaccines (Basel)., vol. 8, no. 1, Mar. 2020. [CrossRef]
- M. M. Mosaheb, M. L. Reiser, and L. M. Wetzler, “Toll-like receptor ligand-based vaccine adjuvants require intact MyD88 signaling in antigen-presenting cells for germinal center formation and antibody production,” Front. Immunol., vol. 8, no. MAR, 2017. [CrossRef]
- V. Gent et al., “Surface protein distribution in Group B Streptococcus isolates from South Africa and identifying vaccine targets through in silico analysis,” Sci. Rep., vol. 14, no. 1, p. 22665, Sep. 2024. [CrossRef]
- D. A. Diaz-Dinamarca et al., “Oral vaccine based on a surface immunogenic protein mixed with alum promotes a decrease in Streptococcus agalactiae vaginal colonization in a mouse model,” Mol. Immunol., vol. 103, pp. 63–70, Nov. 2018. [CrossRef]
- L. G. Bermúdez-Humarán, “Lactococcus lactis as a live vector for mucosal delivery of therapeutic proteins,” Hum. Vaccin., vol. 5, no. 4, pp. 264–267, 2009. [CrossRef]
- V. Chamcha, A. Jones, B. R. Quigley, J. R. Scott, and R. R. Amara, “Oral Immunization with a Recombinant Lactococcus lactis –Expressing HIV-1 Antigen on Group A Streptococcus Pilus Induces Strong Mucosal Immunity in the Gut,” The Journal of Immunology, vol. 195, no. 10, pp. 5025–5034, Nov. 2015. [CrossRef]
- X. Peng et al., “Production and delivery of Helicobacter pylori NapA in Lactococcus lactis and its protective efficacy and immune modulatory activity,” Sci. Rep., vol. 8, no. 1, p. 6435, Apr. 2018. [CrossRef]
- S. K. Murali and T. J. Mansell, “Next generation probiotics: Engineering live biotherapeutics,” Biotechnol. Adv., vol. 72, p. 108336, May 2024. [CrossRef]
- T. Ozdemir, A. J. H. Fedorec, T. Danino, and C. P. Barnes, “Synthetic Biology and Engineered Live Biotherapeutics: Toward Increasing System Complexity,” Cell Syst., vol. 7, no. 1, pp. 5–16, Jul. 2018. [CrossRef]
- R. R. C. New, “Formulation technologies for oral vaccines,” Clin. Exp. Immunol., vol. 198, no. 2, pp. 153–169, 2019. [CrossRef]
- J. L. Owen, B. Sahay, and M. Mohamadzadeh, “New generation of oral mucosal vaccines targeting dendritic cells,” Curr. Opin. Chem. Biol., vol. 17, no. 6, pp. 918–924, 2013. [CrossRef]
- J. E. Vela Ramirez, L. A. Sharpe, and N. A. Peppas, “Current state and challenges in developing oral vaccines,” Adv. Drug Deliv. Rev., vol. 114, pp. 116–131, 2017. [CrossRef]
- U.S. Food and Drug Administration, “Early Clinical Trials with Live Biotherapeutic Products: Chemistry, Manufacturing, and Control Information. Guidance for Industry,” Silver Spring, MD, Sep. 2003. Accessed: Nov. 11, 2025. [Online]. Available: https://www.fda.gov/regulatory-information/search-fda-guidance-documents/early-clinical-trials-live-biotherapeutic-products-chemistry-manufacturing-and-control-information.
- A. Bolotin et al., “The Complete Genome Sequence of the Lactic Acid Bacterium Lactococcus lactis ssp. lactis IL1403,” Genome Res., vol. 11, no. 5, pp. 731–753, May 2001. [CrossRef]
- D. M. Linares, J. Kok, and B. Poolman, “Genome Sequences of Lactococcus lactis MG1363 (Revised) and NZ9000 and Comparative Physiological Studies,” J. Bacteriol., vol. 192, no. 21, pp. 5806–5812, Nov. 2010. [CrossRef]
- K. H. Schleifer, J. Kraus, C. Dvorak, R. Kilpper-Bälz, M. D. Collins, and W. Fischer, “Transfer of Streptococcus lactis and Related Streptococci to the Genus Lactococcus gen. nov.,” Syst. Appl. Microbiol., vol. 6, no. 2, pp. 183–195, Sep. 1985. [CrossRef]
- M. J. Gasson, “Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing,” J. Bacteriol., vol. 154, no. 1, pp. 1–9, Apr. 1983. [CrossRef]
- O. P. Kuipers, P. G. G. A. de Ruyter, M. Kleerebezem, and W. M. de Vos, “Quorum sensing-controlled gene expression in lactic acid bacteria,” J. Biotechnol., vol. 64, no. 1, pp. 15–21, Sep. 1998. [CrossRef]
- O. P. Kuipers, M. M. Beerthuyzen, R. J. Siezen, and W. M. de Vos, “Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis,” Eur. J. Biochem., vol. 216, no. 1, pp. 281–291, Aug. 1993. [CrossRef]
- Food and Agriculture Organization of the United Nations and World Health Organization, “Probiotics in food: Health and nutritional properties and guidelines for evaluation,” Rome, 2006. Accessed: Nov. 11, 2025. [Online]. Available: https://openknowledge.fao.org/items/1c836817-9be2-4256-83ae-0b5055039b50.
- D. A. Diaz-Dinamarca et al., “Mucosal Vaccination with Lactococcus lactis-Secreting Surface Immunological Protein Induces Humoral and Cellular Immune Protection against Group B Streptococcus in a Murine Model,” Vaccines (Basel)., vol. 8, no. 2, p. 146, Mar. 2020. [CrossRef]
- World Health Organization, “Immunization, Vaccines and Biologicals,” Group B Streptococcus (GBS). Accessed: Nov. 11, 2025. [Online]. Available: https://www.who.int/teams/immunization-vaccines-and-biologicals/diseases/group-b-streptococcus-(gbs).
- World Health Organization, “Annex 1 WHO guidelines on nonclinical,” no. 927, 2005, Accessed: Nov. 11, 2025. [Online]. Available: https://www.who.int/publications/m/item/annex1-nonclinical.p31-63.
- J. Martinussen and K. Hammer, “Cloning and characterization of upp, a gene encoding uracil phosphoribosyltransferase from Lactococcus lactis,” J. Bacteriol., vol. 176, no. 21, pp. 6457–6463, Nov. 1994. [CrossRef]
- L. Song et al., “Construction of upp deletion mutant strains of Lactobacillus casei and Lactococcus lactis based on counterselective system using temperature-sensitive plasmid,” J. Microbiol. Methods, vol. 102, pp. 37–44, Jul. 2014. [CrossRef]
- T. A. Hooven, M. Bonakdar, A. B. Chamby, and A. J. Ratner, “A counterselectable sucrose sensitivity marker permits efficient and flexible mutagenesis in streptococcus agalactiae,” Appl. Environ. Microbiol., vol. 85, no. 7, Apr. 2019. [CrossRef]
- MoBiTec GmbH, “NICE expression system: Handbook for Lactococcus lactis expression system,” Goettingen, Mar. 2015. Accessed: Nov. 11, 2025. [Online]. Available: https://www.mobitec.com/media/mobitec/old_content/NICE_Expression_System-Handbook.pdf.
- S. Andrews, “FastQC: A quality control tool for high throughput sequence data.,” Babraham Bioinformatics, Babraham Institute. Accessed: Dec. 03, 2025. [Online]. Available: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/.
- A. Bankevich et al., “SPAdes: A New Genome Assembly Algorithm and Its Applications to Single-Cell Sequencing,” Journal of Computational Biology, vol. 19, no. 5, pp. 455–477, May 2012. [CrossRef]
- A. Gurevich, V. Saveliev, N. Vyahhi, and G. Tesler, “QUAST: quality assessment tool for genome assemblies,” Bioinformatics, vol. 29, no. 8, pp. 1072–1075, Apr. 2013. [CrossRef]
- S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman, “Basic local alignment search tool,” J. Mol. Biol., vol. 215, no. 3, pp. 403–410, Oct. 1990. [CrossRef]
- H. Li and R. Durbin, “Fast and accurate short read alignment with Burrows–Wheeler transform,” Bioinformatics, vol. 25, no. 14, pp. 1754–1760, Jul. 2009. [CrossRef]
- J. T. Robinson et al., “Integrative genomics viewer,” Nat. Biotechnol., vol. 29, no. 1, pp. 24–26, Jan. 2011. [CrossRef]
- A. R. Quinlan and I. M. Hall, “BEDTools: a flexible suite of utilities for comparing genomic features,” Bioinformatics, vol. 26, no. 6, pp. 841–842, Mar. 2010. [CrossRef]
- D. A. Díaz-Dinamarca et al., “The Optimisation of the Expression of Recombinant Surface Immunogenic Protein of Group B Streptococcus in Escherichia coli by Response Surface Methodology Improves Humoral Immunity,” Mol. Biotechnol., vol. 60, no. 3, pp. 215–225, Mar. 2018. [CrossRef]
- E. Vicencio et al., “Aggregatibacter actinomycetemcomitans Induces Autophagy in Human Junctional Epithelium Keratinocytes,” Cells, vol. 9, no. 5, p. 1221, May 2020. [CrossRef]
- Y. Xin, D. Guo, Y. Nan, P. Yang, and M. Qiao, “An efficient platform for markerless large-scale genomic deletions in Lactococcus lactis,” Food Biosci., vol. 70, p. 107057, Aug. 2025. [CrossRef]
- I. Mierau and M. Kleerebezem, “10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis,” Appl. Microbiol. Biotechnol., vol. 68, no. 6, pp. 705–717, Oct. 2005. [CrossRef]
- I. Mierau, K. Olieman, J. Mond, and E. J. Smid, “Optimization of the Lactococcus lactis nisin-controlled gene expression system NICE for industrial applications,” Microb. Cell Fact., vol. 4, no. 1, p. 16, Dec. 2005. [CrossRef]
- Y. Le Loir, S. Nouaille, J. Commissaire, L. Brétigny, A. Gruss, and P. Langella, “Signal Peptide and Propeptide Optimization for Heterologous Protein Secretion in Lactococcus lactis,” Appl. Environ. Microbiol., vol. 67, no. 9, pp. 4119–4127, Sep. 2001. [CrossRef]
- Y. Le Loir et al., “Protein secretion in Lactococcus lactis: an efficient way to increase the overall heterologous protein production,” Microb. Cell Fact., vol. 4, no. 1, p. 2, Jan. 2005. [CrossRef]
- E. C. Conley and J. R. Saunders, “Recombination-dependent recircularization of linearized pBR322 plasmid DNA following transformation of Escherichia coli,” Mol. Gen. Genet., vol. 194, no. 1–2, pp. 211–218, Apr. 1984. [CrossRef]
- G. S. Tamura, D. S. Bratt, H. H. Yim, and A. Nittayajarn, “Use of glnQ as a Counterselectable Marker for Creation of Allelic Exchange Mutations in Group B Streptococci,” Appl. Environ. Microbiol., vol. 71, no. 1, pp. 587–590, Jan. 2005. [CrossRef]
- E. Maguin, H. Prévost, S. D. Ehrlich, and A. Gruss, “Efficient insertional mutagenesis in lactococci and other gram-positive bacteria,” J. Bacteriol., vol. 178, no. 3, pp. 931–935, Feb. 1996. [CrossRef]
- J. B. Divya and K. M. Nampoothiri, “Encapsulated Lactococcus lactis with enhanced gastrointestinal survival for the development of folate enriched functional foods,” Bioresour. Technol., vol. 188, pp. 226–230, Jul. 2015. [CrossRef]
- X. Wang et al., “Microencapsulating Alginate-Based Polymers for Probiotics Delivery Systems and Their Application,” Pharmaceuticals, vol. 15, no. 5, p. 644, May 2022. [CrossRef]
- T. Jiang et al., “Oral delivery of probiotic expressing M cell homing peptide conjugated BmpB vaccine encapsulated into alginate/chitosan/alginate microcapsules,” European Journal of Pharmaceutics and Biopharmaceutics, vol. 88, no. 3, pp. 768–777, Nov. 2014. [CrossRef]
- J. Grossolli-Galvez, M. Imarai, J. A. Soto, and A. E. Vasquez, “Lactococcus lactis as a New Strategy for Oral Vaccination: Current Insights and Future Perspectives,” Pharmaceutics, vol. 18, no. 3, p. 307, Feb. 2026. [CrossRef]







| Strain/plasmid | Characteristics | Source |
|---|---|---|
| E. coli DH5α | Chemically competent cloning host used to maintain recombinant plasmids | Lab collection |
| L. lactis NZ9000 | Derivative of MG1363; pepN::nisRK | Lab collection |
| L. lactis-SIP | Derivative of L. lactis NZ9000; Δupp::PnisA-Usp45-sip | This study |
| pUC57-sip | pUC57 plasmid carrying the synthesized upp-targeting recombination cassette | GenScript |
| pMBsacB | Temperature-sensitive pHY304-derived allelic-exchange vector carrying erythromycin resistance and sacB for sucrose counterselection | [36] |
| pMBsacB-sip | pMBSacB carrying the upp-targeting PnisA-Usp45-sip recombination cassette cloned between XhoI and BamHI sites | This study |
| Primer/probe | Sequence (5’- 3’) | Source |
|---|---|---|
| KI_lactis_F | ATGGAGGGTCTGGGACTCAT | This study |
| KI_lactis_R | GCGACTTTTCCTCTGTAGGAACT | This study |
| pMBsacB_MCS_F | CAATACGCAAACCGCCTCTC | [36] |
| T7 promoter | TAATACGACTCACTATAGGG | Invitrogen |
| M13 reverse | CAGGAAACAGCTATGAC | Invitrogen |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).