Submitted:
02 June 2026
Posted:
04 June 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Data Collection and Preprocessing
2.2. Pan-cancer Expression Analysis of EEF1A1
2.3. Expression and Clinicopathological Correlation Analysis in KIRC
2.4. Prognostic Value and DNA Methylation Analysis
2.5. PPI Network, Hub Gene Identification, and Functional Enrichment
2.6. Immune Infiltration, Checkpoints, and Immunomodulatory Analysis
2.7. Drug Sensitivity Analysis
2.8. Cell Culture and Establishment of Stable EEF1A1-Overexpressing Cell Lines
2.9. qRT-PCR and Western Blotting
2.10. Cell Viability Assay (CCK8)
2.11. Wound Healing Assay
2.12. Transwell Migration and Invasion Assay
2.13. Statistical Analysis
3. Results
3.1. Expression Characteristics of EEF1A1 in Pan-cancer and KIRC
3.2. Correlation with Clinical Features and Prognostic Value of EEF1A1 in KIRC
3.3. Association Between EEF1A1 Methylation and Prognosis
3.4. PPI Network, Hub Gene Identification, and Functional Enrichment
3.5. Correlation of EEF1A1 with Immune Infiltration and Immunomodulators
3.6. Correlation with Drug Sensitivity
3.7. Verification of EEF1A1 Expression and its Impact on Biological Behavior of KIRC
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rose, T.L.; Kim, W.Y. Renal Cell Carcinoma: A Review. JAMA 2024, 332, 1001–1010. [Google Scholar] [CrossRef] [PubMed]
- Bahadoram, S.; Davoodi, M.; Hassanzadeh, S.; Bahadoram, M.; Barahman, M.; Mafakher, L. Renal cell carcinoma: an overview of the epidemiology, diagnosis, and treatment. G. Ital. Nefrol. Organo Uff. Della Soc. Ital. Nefrol. 2022, 39, 2022–vol3. [Google Scholar]
- Browne, G.J.; Proud, C.G. Regulation of peptide-chain elongation in mammalian cells. Eur. J. Biochem. 2002, 269, 5360–5368. [Google Scholar] [CrossRef] [PubMed]
- Abbas, W.; Kumar, A.; Herbein, G. The eEF1A Proteins: At the Crossroads of Oncogenesis, Apoptosis, and Viral Infections. Front Oncol. 2015, 5. [Google Scholar] [CrossRef] [PubMed]
- Blanch, A.; Robinson, F.; Watson, I.R.; Cheng, L.S.; Irwin, M.S. Eukaryotic translation elongation factor 1-alpha 1 inhibits p53 and p73 dependent apoposis and chemotherapy sensitivity. PLoS ONE 2013, 8, e66436. [Google Scholar] [CrossRef] [PubMed]
- Tarrant, D.J.; Stirpe, M.; Rowe, M.; Howard, M.J.; von der Haar, T.; Gourlay, C.W. Inappropriate expression of the translation elongation factor 1A disrupts genome stability and metabolism. J. Cell Sci. 2016, 129, 4455–4465. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Shi, A.; Liu, J.; et al. CDCA5-EEF1A1 interaction promotes progression of clear cell renal cell carcinoma by regulating mTOR signaling. Cancer Cell Int. 2024, 24, 147. [Google Scholar] [CrossRef] [PubMed]
- Cui, H.; Li, H.; Wu, H.; et al. A novel 3’tRNA-derived fragment tRF-Val promotes proliferation and inhibits apoptosis by targeting EEF1A1 in gastric cancer. Cell Death Dis. 2022, 13, 471. [Google Scholar] [CrossRef] [PubMed]
- Xing, L.; Wu, T.; Xu, H.; et al. Single-Cell Transcriptomics Uncover EEF1A1-Driven Ubiquitination Dysregulation in T Cell Exhaustion and SLE Pathogenesis via STAT1-Mediated Th1/Th2 Imbalance. Mediat. Inflamm. 2025, 2025, 3708640. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Huo, Q.; Zhang, J.; et al. UCHL3 promotes hepatocellular carcinoma progression by stabilizing EEF1A1 through deubiquitination. Biol. Direct 2024, 19, 53. [Google Scholar] [CrossRef] [PubMed]
- Su, D.; Wang, R.; Chen, G.; et al. FBXO32 Stimulates Protein Synthesis to Drive Pancreatic Cancer Progression and Metastasis. Cancer Res. 2024, 84, 2607–2625. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Ning, D.; Du, P.; et al. USP11 potentiates HGF/AKT signaling and drives metastasis in hepatocellular carcinoma. Oncogene 2024, 43, 123–135. [Google Scholar] [CrossRef] [PubMed]
- Wu, A.; Tang, J.; Guo, Z.; et al. Long Non-Coding RNA CRYBG3 Promotes Lung Cancer Metastasis via Activating the eEF1A1/MDM2/MTBP Axis. Int. J. Mol. Sci. 2021, 22, 3211. [Google Scholar] [CrossRef] [PubMed]
- J, Y.; Ry, C.; Yj, L.; et al. Identification of EEF1A1 as a therapeutic target in TNBC: Anticancer action of a novel Penicillide-derived inhibitor through ribosomal protein regulation. Bioorganic Chem. 2026, 172. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Chen, N.; Zhou, L.; et al. Genome-wide target interactome profiling reveals a novel EEF1A1 epigenetic pathway for oncogenic lncRNA MALAT1 in breast cancer. Am. J. Cancer Res. 2019, 9, 714–729. [Google Scholar] [PubMed]
- Lin, K.W.; Souchelnytskyi, S. Translational connection of TGFβ signaling: Phosphorylation of eEF1A1 by TβR-I inhibits protein synthesis. Small GTPases 2011, 2, 104–108. [Google Scholar] [CrossRef] [PubMed]
- Negrutskii, B.S.; Porubleva, L.V.; Malinowska, A.; Novosylna, O.V.; Dadlez, M.; Knudsen, C.R. Understanding functions of eEF1 translation elongation factors beyond translation. A proteomic approach. Adv. Protein Chem. Struct. Biol. 2024, 138, 67–99. [Google Scholar] [CrossRef] [PubMed]
- Fancello, L.; Kampen, K.R.; Hofman, I.J.F.; Verbeeck, J.; De Keersmaecker, K. The ribosomal protein gene RPL5 is a haploinsufficient tumor suppressor in multiple cancer types. Oncotarget 2017, 8, 14462–14478. [Google Scholar] [CrossRef] [PubMed]
- Paquet, É.R.; Hovington, H.; Brisson, H.; et al. Low level of the X-linked ribosomal protein S4 in human urothelial carcinomas is associated with a poor prognosis. Biomark. Med. 2015, 9, 187–197. [Google Scholar] [CrossRef] [PubMed]
- El Khoury, W.; Nasr, Z. Deregulation of ribosomal proteins in human cancers. Biosci. Rep. 2021, 41, BSR20211577. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Hao, Q.; Liao, J.; Zhang, Q.; Lu, H. Ribosomal protein S14 unties the MDM2-p53 loop upon ribosomal stress. Oncogene 2013, 32, 388–396. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Ruan, B.; Wei, J.; et al. ACYP2 contributes to malignant progression of glioma through promoting Ca2+ efflux and subsequently activating c-Myc and STAT3 signals. J. Exp. Clin. Cancer Res. CR 2020, 39, 106. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.B.; Kozlov, A.M.; Hatam Tehrani, H.; et al. Elongation factor 1A1 regulates metabolic substrate preference in mammalian cells. J. Biol. Chem. 2024, 300, 105684. [Google Scholar] [CrossRef] [PubMed]
- Legátová, A.; Pelantová, M.; Rösel, D.; Brábek, J.; Škarková, A. The emerging role of microtubules in invasion plasticity. Front Oncol. 2023, 13, 1118171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Su, W.; Ji, X.; et al. PCSK9 promotes progression of anaplastic thyroid cancer through E-cadherin endocytosis. Cell Death Dis. 2025, 16, 362. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Cai, J.; Yu, S.; Sun, B.; Zhang, W. Anticancer Small-Molecule Agents Targeting Eukaryotic Elongation Factor 1A: State of the Art. Int. J. Mol. Sci. 2023, 24, 5184. [Google Scholar] [CrossRef] [PubMed]
- Hou, Y.; Lu, H.; Li, J.; et al. A photoaffinity labeling strategy identified EF1A1 as a binding protein of cyclic dinucleotide 2’3’-cGAMP. Cell Chem. Biol. 2022, 29, 133–144.e20. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Wang, J.; Shan, C. The eEF1A protein in cancer: Clinical significance, oncogenic mechanisms, and targeted therapeutic strategies. Pharmacol. Res. 2024, 204, 107195. [Google Scholar] [CrossRef] [PubMed]
- Xu, B.; Liu, L.; Song, G. Functions and Regulation of Translation Elongation Factors. Front Mol. Biosci. 2021, 8, 816398. [Google Scholar] [CrossRef] [PubMed]
- Estephan, H.; Tailor, A.; Parker, R.; et al. Hypoxia promotes tumor immune evasion by suppressing MHC-I expression and antigen presentation. EMBO J. 2025, 44, 903–922. [Google Scholar] [CrossRef] [PubMed]
- Liao, Q.; Jin, Z.; Long, H.; Zhu, B. Deciphering cancer complexity: perspective on hematopoietic remodeling-mediated immunosuppression. Oncogene 2025, 44, 1230–1233. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Ding, L.; Mei, J.; et al. Dual roles and therapeutic targeting of tumor-associated macrophages in tumor microenvironments. Signal Transduct. Target Ther. 2025, 10, 268. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Lu, Y.; Zheng, J.; et al. Exploring the crosstalk between endothelial cells, immune cells, and immune checkpoints in the tumor microenvironment: new insights and therapeutic implications. Cell Death Dis. 2023, 14, 586. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Fu, L.; Wu, R.; et al. Immunocytes in the tumor microenvironment: recent updates and interconnections. Front Immunol. 2025, 16. [Google Scholar] [CrossRef] [PubMed]
- Koelsch, N.; Manjili, M.H. Moving beyond cytotoxicity in cancer immunotherapy: embracing tumor microenvironment remodeling for durable control. Br. J. Cancer 2025, 133, 1233–1240. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Shao, J.; Shao, L.; et al. Immunotherapy strategies targeting tumor-associated macrophages and their mechanisms of action in tumor progression. Front Immunol. 2025, 16, 1680455. [Google Scholar] [CrossRef] [PubMed]
- S, X.; J X., S. L. Unravelling T cell exhaustion through co-inhibitory receptors and its transformative role in cancer immunotherapy. Clin. Transl. Med. 2025, 15. [Google Scholar] [CrossRef]
- Perales, O.; Jilaveanu, L.; Adeniran, A.; et al. TIGIT expression in renal cell carcinoma infiltrating T cells is variable and inversely correlated with PD-1 and LAG3. Cancer Immunol. Immunother. CII 2024, 73, 192. [Google Scholar] [CrossRef] [PubMed]
- Maeda, T.K.; Sugiura, D.; Okazaki, I.M.; Maruhashi, T.; Okazaki, T. Atypical motifs in the cytoplasmic region of the inhibitory immune co-receptor LAG-3 inhibit T cell activation. J. Biol. Chem. 2019, 294, 6017–6026. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.T.; Prieto, L.I.; Zhang, C.; et al. Protein kinase Cι dictates tumor trajectory, cell plasticity, and immune surveillance in lung adenocarcinoma. Cell Rep. 2025, 44, 116606. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Zhang, H.; Zhan, Y.; Li, Z.; Li, S.; Guo, S. Comprehensive in silico analysis of prognostic and immune infiltrates for FGFs in human ovarian cancer. J. Ovarian Res. 2024, 17, 197. [Google Scholar] [CrossRef] [PubMed]
- Ruan, R.; Li, L.; Li, X.; et al. Unleashing the potential of combining FGFR inhibitor and immune checkpoint blockade for FGF/FGFR signaling in tumor microenvironment. Mol. Cancer 2023, 22, 60. [Google Scholar] [CrossRef] [PubMed]
- Charpentier, M.; Formenti, S.; Demaria, S. CD40 agonism improves anti-tumor T cell priming induced by the combination of radiation therapy plus CTLA4 inhibition and enhances tumor response. Oncoimmunology 2023, 12, 2258011. [Google Scholar] [CrossRef] [PubMed]
- Wennhold, K.; Shimabukuro-Vornhagen, A.; von Bergwelt-Baildon, M. B Cell-Based Cancer Immunotherapy. Transfus. Med. Hemotherapy Off. Organ Dtsch. Ges. Transfusionsmedizin Immunhamatol. 2019, 46, 36–46. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.L.; Lu, S.X.; Liu, L.L.; et al. eEF1A1 Overexpression Enhances Tumor Progression and Indicates Poor Prognosis in Hepatocellular Carcinoma. Transl. Oncol. 2018, 11, 125–131. [Google Scholar] [CrossRef] [PubMed]
- Liposomal Elongation Factor-1α Triggers Effector CD4 and CD8 T Cells for Induction of Long-Lasting Protective Immunity against Visceral Leishmaniasis - PubMed. Available online: https://pubmed.ncbi.nlm.nih.gov/29441060/.
- Jd, B.F.; J, B.A.; K, M.M.; et al. Targeting of Non-Classical Human Leukocyte Antigens as Novel Therapeutic Strategies in Cancer. Cancers 2024, 16. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Luo, J.; Tian, D.; et al. HLA-DOB: A Key “Coordinator” Between Cutaneous Melanoma and Psoriasis. J. Cancer 2025, 16, 3415–3424. [Google Scholar] [CrossRef] [PubMed]
- Tumor-derived CCL5 recruits cancer-associated fibroblasts and promotes tumor cell proliferation in esophageal squamous cell carcinoma - PMC. Available online: https://pmc.ncbi.nlm.nih.gov/articles/PMC10330279/.
- D X, X L, S K, Y G, C Z, H C. CCL19/CCR7 drives regulatory T cell migration and indicates poor prognosis in gastric cancer. BMC Cancer 2023, 23. [CrossRef] [PubMed]
- S L, N. Z.; Y Y, T. L. Transcriptionally activates CCL28 expression to inhibit M2 polarization of macrophages and prevent immune escape in colorectal cancer cells. Transl. Oncol. 2024, 40. [Google Scholar] [CrossRef]
- Ej, K.; Hj, C. Systematic omics analysis identifies CCR6 as a therapeutic target to overcome cancer resistance to EGFR inhibitors. iScience 2024, 27. [Google Scholar] [CrossRef] [PubMed]
- Lepsenyi, M.; Algethami, N.; Al-Haidari, A.A.; et al. CXCL2-CXCR2 axis mediates αV integrin-dependent peritoneal metastasis of colon cancer cells. Clin. Exp. Metastasis 2021, 38, 401–410. [Google Scholar] [CrossRef] [PubMed]








| Gene | forward primer(5’-3’) | reverse primer(5’-3’) |
|---|---|---|
| EEF1A1 | ACCACTACTGGCCATCTGATCTA | GTTTATCCAAGACCCAGGCATAC |
| GAPDH | AAGCTCATTTCCTGGTATGACAA | CTTACTCCTTGGAGGCCATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).