Submitted:
20 May 2026
Posted:
22 May 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Material and Methods
2.1. Animals and Ethical Approval
2.2. Reagents and Antibodies
2.3. C2C12 Myoblast Culture and Differentiation
2.4. Primary Mouse Myoblast Isolation and Culture
2.5. siRNA Transfection
2.6. Immunostaining and Cell Morphometry
2.7. RNA Isolation and Real-Time Quantitative PCR (RT-qPCR)
2.8. Cholesterol Depletion with Methyl-β-Cyclodextrin (MβCD)
2.9. MG29 Mutant Constructs
2.10. In Vivo Electroporation and MG29 Silencing in Intact Muscle
2.11. Store-Operated Ca2+ Entry (SOCE) Measurements
2.12. Lipidomic Profiling of Gastrocnemius Muscle
2.13. LC-MS/MS Analysis of Lipid Mediators
2.14. Lipidomic Analysis of Conditioned Medium
2.15. Cholesterol and Triglyceride Measurement
2.16. Statistical Analysis
3. Results
3.1. Reduced MG29/SYPL2 Expression Leads to Compromised Muscle Structure and Function
3.2. MG29 Domain Structure:
3.3. Lipidomics Analysis Reveals that Cholesterol and Overall Fatty Acid Content Are Decreased in mg29−/− Muscle
3.4. Altered Lipidomic Profiles in mg29−/− Gastrocnemius Muscle
3.5. Altered MG29/SYPL2 Levels and Membrane Cholesterol Similarly Impair SOCE
3.6. Acute MG29/SYPL2 Knockdown Recapitulates Chronic MG29 Deficiency and Alters Ca2+ Homeostasis
3.7. MG29/SYPL2 MARVEL Domain Mutations Uncouple Lipid Binding from SOCE Regulation
3.8. MG29 MARVEL Domain Mutations Differentially Impair SOCE in Skeletal Muscle Cells
3.9. MG29 MARVEL Domain Mutations Differentially Regulate Cellular Lipid Composition
4. Discussion
5. Clinical and Translational Implications
6. Study Limitations and Future Directions
7. Conclusion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Data Availability Statement
References
- López-Otín, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. The hallmarks of aging. Cell 2013, 153, 1194–1217. [Google Scholar] [CrossRef]
- Estebsari, F.; Dastoorpoor, M.; Khalifehkandi, Z.R.; Nouri, A.; Mostafaei, D.; Hosseini, M.; Esmaeili, R.; Aghababaeian, H. The Concept of Successful Aging: A Review Article. Curr. Aging Sci. 2020, 13, 4–10. [Google Scholar] [CrossRef]
- Abellan van Kan, G. Epidemiology and consequences of sarcopenia. J. Nutr. Health Aging 2009, 13, 708–712. [Google Scholar] [CrossRef]
- Kuo, P.-L.; Schrack, J.A.; Levine, M.E.; Shardell, M.D.; Simonsick, E.M.; Chia, C.W.; Moore, A.Z.; Tanaka, T.; An, Y.; Karikkineth, A.; et al. Longitudinal phenotypic aging metrics in the Baltimore Longitudinal Study of Aging. Nat. Aging 2022, 2, 635–643. [Google Scholar] [CrossRef]
- Lexell, J. Human aging, muscle mass, and fiber type composition. J. Gerontol. A Biol. Sci. Med. Sci. 1995, 50, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Lexell, J.; Taylor, C.C.; Sjöström, M. What is the cause of the ageing atrophy? Total number, size and proportion of different fiber types studied in whole vastus lateralis muscle from 15- to 83-year-old men. J. Neurol. Sci. 1988, 84, 275–294. [Google Scholar] [CrossRef] [PubMed]
- Nilwik, R.; Snijders, T.; Leenders, M.; Groen, B.B.L.; van Kranenburg, J.; Verdijk, L.B.; van Loon, L.J.C. The decline in skeletal muscle mass with aging is mainly attributed to a reduction in type II muscle fiber size. Exp. Gerontol. 2013, 48, 492–498. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, D.J.; Piasecki, M.; Atherton, P.J. The age-related loss of skeletal muscle mass and function: Measurement and physiology of muscle fibre atrophy and muscle fibre loss in humans. Ageing Res. Rev. 2018, 47, 123–132. [Google Scholar] [CrossRef]
- Verdijk, L.B.; Koopman, R.; Schaart, G.; Meijer, K.; Savelberg, H.H.C.M.; van Loon, L.J.C. Satellite cell content is specifically reduced in type II skeletal muscle fibers in the elderly. Am. J. Physiol.-Endocrinol. Metab. 2007, 292, E151–E157. [Google Scholar] [CrossRef]
- Mao, X.; Lv, K.; Qi, W.; Cheng, W.; Li, T.; Sun, Y.; Jin, H.; Pan, H.; Wang, D. Research progress on sarcopenia in the musculoskeletal system. Bone Res. 2025, 13, 78. [Google Scholar] [CrossRef]
- Huo, F.; Liu, Q.; Liu, H. Contribution of muscle satellite cells to sarcopenia. Front Physiol. 2022, 13, 892749. [Google Scholar] [CrossRef]
- Riuzzi, F.; Sorci, G.; Arcuri, C.; Giambanco, I.; Bellezza, I.; Minelli, A.; Donato, R. Cellular and molecular mechanisms of sarcopenia: The S100B perspective. J. Cachexia Sarcopenia Muscle 2018, 9, 1255–1268. [Google Scholar] [CrossRef] [PubMed]
- Delbono, O. Molecular mechanisms and therapeutics of the deficit in specific force in ageing skeletal muscle. Biogerontology 2002, 3, 265–270. [Google Scholar] [CrossRef] [PubMed]
- Brown, M.; Sinacore, D.R.; Host, H.H. The relationship of strength to function in the older adult. J. Gerontol. A Biol. Sci. Med. Sci. 1995, 50, 55–59. [Google Scholar] [CrossRef]
- Visser, M.; Harris, T.B.; Fox, K.M.; Hawkes, W.; Hebel, J.R.; Yahiro, J.Y.; Michael, R.; Zimmerman, S.I.; Magaziner, J. Change in muscle mass and muscle strength after a hip fracture: Relationship to mobility recovery. J. Gerontol. A Biol. Sci. Med. Sci. 2000, 55, M434–440. [Google Scholar] [CrossRef] [PubMed]
- Visser, M.; Newman, A.B.; Nevitt, M.C.; Kritchevsky, S.B.; Stamm, E.B.; Goodpaster, B.H.; Harris, T.B. Reexamining the sarcopenia hypothesis. Muscle mass versus muscle strength. Health, Aging, and Body Composition Study Research Group. Ann. N Y Acad. Sci. 2000, 904, 456–461. [Google Scholar] [CrossRef]
- Russ, D.W.; Grandy, J.S.; Toma, K.; Ward, C.W. Ageing, but not yet senescent, rats exhibit reduced muscle quality and sarcoplasmic reticulum function. Acta Physiol. (Oxf) 2011, 201, 391–403. [Google Scholar] [CrossRef]
- Morse, C.I.; Thom, J.M.; Reeves, N.D.; Birch, K.M.; Narici, M.V. In vivo physiological cross-sectional area and specific force are reduced in the gastrocnemius of elderly men. J. Appl. Physiol. (1985) 2005, 99, 1050–1055. [Google Scholar] [CrossRef]
- Clark, B.C.; Manini, T.M. Functional consequences of sarcopenia and dynapenia in the elderly. Curr. Opin. Clin. Nutr. Metab. Care 2010, 13, 271–276. [Google Scholar] [CrossRef]
- Pan, Z.; Brotto, M.; Ma, J. Store-operated Ca2+ entry in muscle physiology and diseases. BMB Rep. 2014, 47, 69–79. [Google Scholar] [CrossRef] [PubMed]
- Lyfenko, A.D.; Dirksen, R.T. Differential dependence of store-operated and excitation-coupled Ca2+ entry in skeletal muscle on STIM1 and Orai1. J. Physiol. 2008, 586, 4815–4824. [Google Scholar] [CrossRef]
- Lowe, D.A.; Husom, A.D.; Ferrington, D.A.; Thompson, L.V. Myofibrillar myosin ATPase activity in hindlimb muscles from young and aged rats. Mech. Ageing Dev. 2004, 125, 619–627. [Google Scholar] [CrossRef]
- Lowe, D.A.; Thomas, D.D.; Thompson, L.V. Force generation, but not myosin ATPase activity, declines with age in rat muscle fibers. Am. J. Physiol. Cell Physiol. 2002, 283, C187–192. [Google Scholar] [CrossRef]
- Zhao, X.; Weisleder, N.; Thornton, A.; Oppong, Y.; Campbell, R.; Ma, J.; Brotto, M. Compromised store-operated Ca2+ entry in aged skeletal muscle. Aging Cell 2008, 7, 561–568. [Google Scholar] [CrossRef]
- Yarotskyy, V.; Dirksen, R.T. Temperature and RyR1 regulate the activation rate of store-operated Ca2+ entry current in myotubes. Biophys. J. 2012, 103, 202–211. [Google Scholar] [CrossRef]
- Launikonis, B.S.; Murphy, R.M.; Edwards, J.N. Toward the roles of store-operated Ca2+ entry in skeletal muscle. Pflug. Arch. 2010, 460, 813–823. [Google Scholar] [CrossRef] [PubMed]
- Edwards, J.N.; Friedrich, O.; Cully, T.R.; von Wegner, F.; Murphy, R.M.; Launikonis, B.S. Upregulation of store-operated Ca2+ entry in dystrophic mdx mouse muscle. Am. J. Physiol. Cell Physiol. 2010, 299, C42–50. [Google Scholar] [CrossRef]
- Launikonis, B.S.; Ríos, E. Store-operated Ca2+ entry during intracellular Ca2+ release in mammalian skeletal muscle. J. Physiol. 2007, 583, 81–97. [Google Scholar] [CrossRef] [PubMed]
- Brotto, M.; Weisleder, N.; Ma, J. Store-Operated Ca2+ Entry in Muscle Physiology. Curr. Chem. Biol. 2007, 1, 87–95. [Google Scholar] [CrossRef]
- Touchberry, C.D.; Elmore, C.J.; Nguyen, T.M.; Andresen, J.J.; Zhao, X.; Orange, M.; Weisleder, N.; Brotto, M.; Claycomb, W.C.; Wacker, M.J. Store-operated calcium entry is present in HL-1 cardiomyocytes and contributes to resting calcium. Biochem Biophys. Res. Commun. 2011, 416, 45–50. [Google Scholar] [CrossRef]
- Zhao, X.; Moloughney, J.G.; Zhang, S.; Komazaki, S.; Weisleder, N. Orai1 mediates exacerbated Ca(2+) entry in dystrophic skeletal muscle. PLoS ONE 2012, 7, e49862. [Google Scholar] [CrossRef]
- Thornton, A.M.; Zhao, X.; Weisleder, N.; Brotto, L.S.; Bougoin, S.; Nosek, T.M.; Reid, M.; Hardin, B.; Pan, Z.; Ma, J.; et al. Store-operated Ca(2+) entry (SOCE) contributes to normal skeletal muscle contractility in young but not in aged skeletal muscle. Aging 2011, 3, 621–634. [Google Scholar] [CrossRef]
- Weisleder, N.; Brotto, M.; Komazaki, S.; Pan, Z.; Zhao, X.; Nosek, T.; Parness, J.; Takeshima, H.; Ma, J. Muscle aging is associated with compromised Ca2+ spark signaling and segregated intracellular Ca2+ release. J. Cell Biol. 2006, 174, 639–645. [Google Scholar] [CrossRef]
- Hirata, Y.; Brotto, M.; Weisleder, N.; Chu, Y.; Lin, P.; Zhao, X.; Thornton, A.; Komazaki, S.; Takeshima, H.; Ma, J.; et al. Uncoupling store-operated Ca2+ entry and altered Ca2+ release from sarcoplasmic reticulum through silencing of junctophilin genes. Biophys. J. 2006, 90, 4418–4427. [Google Scholar] [CrossRef]
- Larsson, L.; Degens, H.; Li, M.; Salviati, L.; Lee, Y.I.; Thompson, W.; Kirkland, J.L.; Sandri, M. Sarcopenia: Aging-Related Loss of Muscle Mass and Function. Physiol. Rev. 2019, 99, 427–511. [Google Scholar] [CrossRef]
- Palus, S.; Springer, J.I.; Doehner, W.; von Haehling, S.; Anker, M.; Anker, S.D.; Springer, J. Models of sarcopenia: Short review. Int. J. Cardiol. 2017, 238, 19–21. [Google Scholar] [CrossRef]
- Brandt, N.R.; Franklin, G.; Brunschwig, J.P.; Caswell, A.H. The role of mitsugumin 29 in transverse tubules of rabbit skeletal muscle. Arch. Biochem Biophys. 2001, 385, 406–409. [Google Scholar] [CrossRef] [PubMed]
- Treves, S.; Vukcevic, M.; Maj, M.; Thurnheer, R.; Mosca, B.; Zorzato, F. Minor sarcoplasmic reticulum membrane components that modulate excitation-contraction coupling in striated muscles. J. Physiol. 2009, 587, 3071–3079. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Yoshida, M.; Brotto, L.; Takeshima, H.; Weisleder, N.; Hirata, Y.; Nosek, T.M.; Ma, J.; Brotto, M. Enhanced resistance to fatigue and altered calcium handling properties of sarcalumenin knockout mice. Physiol. Genom. 2005, 23, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Mo, C.; Wang, Z.; Bonewald, L.; Brotto, M. Multi-Staged Regulation of Lipid Signaling Mediators during Myogenesis by COX-1/2 Pathways. Int. J. Mol. Sci. 2019, 20, 4326. [Google Scholar] [CrossRef]
- Wang, Z.; Bian, L.; Mo, C.; Kukula, M.; Schug, K.A.; Brotto, M. Targeted quantification of lipid mediators in skeletal muscles using restricted access media-based trap-and-elute liquid chromatography-mass spectrometry. Anal. Chim. Acta 2017, 984, 151–161. [Google Scholar] [CrossRef] [PubMed]
- Korhonen, M.T.; Cristea, A.; Alén, M.; Häkkinen, K.; Sipilä, S.; Mero, A.; Viitasalo, J.T.; Larsson, L.; Suominen, H. Aging, muscle fiber type, and contractile function in sprint-trained athletes. J. Appl. Physiol. (1985) 2006, 101, 906–917. [Google Scholar] [CrossRef] [PubMed]
- Jannas-Vela, S.; Espinosa, A.; Candia, A.A.; Flores-Opazo, M.; Peñailillo, L.; Valenzuela, R. The Role of Omega-3 Polyunsaturated Fatty Acids and Their Lipid Mediators on Skeletal Muscle Regeneration: A Narrative Review. Nutrients 2023, 15, 871. [Google Scholar] [CrossRef] [PubMed]
- Al-Shaer, A.E.; Buddenbaum, N.; Shaikh, S.R. Polyunsaturated fatty acids, specialized pro-resolving mediators, and targeting inflammation resolution in the age of precision nutrition. Biochim. Et. Biophys. Acta (BBA) —Mol. Cell Biol. Lipids 2021, 1866, 158936. [Google Scholar] [CrossRef] [PubMed]









| Primer | Primer sequence (5′ to 3′) |
|---|---|
| GAPDH F | TGCGATGGGTGTGAACCACGAGAA |
| GAPDH R | GAGCCCTTCCACAATGCCAAAGTT |
| MyoD F | CCCCGGCGGCAGAATGGCTACG |
| MyoD R | GGTCTGGGTTCCCTGTTCTGTGT |
| MyoG F | TGAGCATTGTCCAGGCCAG |
| MyoG R | GCTTCTCCCTCAGTGTGGCT |
| Metabolic pathways | LMs | C57BL6 | Mg29 KO | ||||||
|---|---|---|---|---|---|---|---|---|---|
| 13 weeks | 55 weeks | 16 weeks | 50 weeks | ||||||
| mean | SD | mean | SD | mean | SD | mean | SD | ||
| Arachidonic acid (AA), n-6 PUFA |
20-hydroxy-PGF2a | 100.0 | 38.7 | 310.9*** | 23.0 | 71.1bbb | 16.2 | 754.8***, aaa, bbb, ccc | 45.3 |
| 6-keto-PGF1a | 100.0 | 9.0 | 33.7** | 17.8 | 101.1bb | 37.5 | 46.1*, a, c | 17.7 | |
| 8-iso-PGE2 | 100.0 | 42.9 | 180.0 | 94.7 | 115.1 | 34.1 | 341.2***, aaa, bb | 39.5 | |
| 13,14-dihydro-15-keto-PGE2 | 100.0 | 23.2 | 129.5 | 46.1 | 267.9aaa, bb | 55.9 | 170.5* | 30.6 | |
| 8-HETE | 100.0 | 52.6 | 162.6 | 53.1 | 119.5 | 60.0 | 289.2*, aa | 85.3 | |
| 5-HETE | 100.0 | 43.8 | 363.5 | 233.4 | 216.4 | 148.1 | 700.1*, aa | 286.5 | |
| 5-KETE | 100.0 | 34.7 | 282.2 | 92.6 | 192.6 | 168.2 | 617.1**, aa, b | 192.6 | |
| AA | 100.0 | 34.7 | 35.5 | 24.6 | 143.5 | 32.1 | 45.8** | 30.9 | |
| Linoleic acid (LA), n-6 PUFA |
13-KODE | 100.0 | 14.7 | 183.7 | 47.1 | 116.6 | 39.3 | 482.1*, aa, b | 256.5 |
| Eicosapentaenoic acid (EPA), n-3 PUFA | 17,18-DiHETE | 100.0 | 81.8 | 490.8** | 176.4 | 66.4bb | 22.2 | 335.7 | 174.1 |
| EPA | 100.0 | 43.5 | 214.0** | 48.9 | 147.7 | 2.5 | 100.7bb | 21.8 | |
| Docosahexaenoic acid (DHA), n-3 PUFA | 20-HDoHE | 100.0 | 22.8 | 413.2* | 322.2 | 252.3 | 157.4 | 880.2**, aaa | 215.1 |
| 16-HDoHE | 100.0 | 38.6 | 871.3*** | 165.8 | 252.4bb | 152.5 | 1325.2***, aaa, b | 270.2 | |
| 13-HDoHE | 100.0 | 39.7 | 674.5*** | 263.8 | 222.8bb | 127.3 | 733.0**, aaa | 49.5 | |
| 10-HDoHE | 100.0 | 60.6 | 393.5* | 154.2 | 142.0b | 82.8 | 437.9*, aa | 121.4 | |
| 4-HDoHE | 100.0 | 30.5 | 945.0* | 614.4 | 225.3 | 180.4 | 1192.4*, aa | 338.8 | |
| DHA | 100.0 | 29.1 | 53.5 | 14.1 | 188.7aa, bbb | 41.4 | 64.9*** | 1.8 | |
| α-linolenic acid (ALA), n-3 PUFA |
9-HOTrE | 100.0 | 112.6 | 806.8* | 266.9 | 236.4 | 84.0 | 722.7a | 487.1 |
| Lysophosphatidylcholine (lysoPC) | Lyso-PAF | 100.0 | 10.1 | 31.3*** | 6.0 | 98.2bbb | 13.7 | 37.7***, aaa | 6.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).