Submitted:
20 April 2026
Posted:
21 April 2026
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Reagents and Chemicals
2.2. Network Pharmacology Analysis
2.2.1. DN-Related Target Identification
2.2.2. Astragalus Root Target Prediction
2.2.3. PPI Network Construction
2.2.4. Herb-Component-Target-Disease Network Construction
2.2.5. Hub Gene Identification
2.2.6. GO and KEGG Enrichment Analyses
2.3. Molecular Docking
2.4. Molecular Dynamics Simulation
2.5. Cell Culture
2.6. MTT Assay
2.7. Measurement of Pharmacodynamic Evaluation Indicators
2.8. Immunofluorescence
2.9. RT-qPCR Analysis
2.10. Western Blotting
2.11. Statistical Analysis
3. Results
3.1. Screening of Potential Targets and Pathways of Astragalus in the Treatment of DN Based on Network Pharmacology
3.2. Molecular Docking Validation
3.3. Molecular Dynamics Simulation
3.4. Effects of Kaempferol on AGE-BSA-Induced HK-2 Cell Viability and Oxidative Stress Markers
3.5. Effects of Kaempferol on AGE-BSA-Induced Expression of Fibrosis Markers in HK-2 Cells
3.6. Effect of Kaempferol on Inflammatory Cytokine Levels in HK-2 Cells
3.7. Kaempferol Reduces RAGE Immunofluorescence in HK-2 Cells
3.8. Kaempferol Suppresses p-PKC, RAGE, and TGF-β Protein Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| BP | Biological process |
| CC | Cellular component |
| KAE | Kaempferol |
| GSH | Glutathione |
| IL-1β | Interleukin-1β |
| IL-6 | Interleukin-6 |
| MCC | Maximum Cluster Centrality |
| MD | Molecular dynamics |
| MDA | Malondialdehyde |
| MF | Molecular function |
| Rg | Radius of gyration |
| RMSD | Root-mean-square deviation |
| RMSF | Root-mean-square fluctuation |
| ROS | Reactive oxygen species |
| SASA | Solvent Accessible Surface Area |
| TCM | Traditional Chinese Medicine |
| DN | Diabetic nephropathy |
| SOD | Superoxide dismutase |
| ECM | Extracellular matrix |
| Col I | Collagen Type I |
| Col IV | Collagen Type IV |
| FEL | Free energy landscapes |
| PPI | Protein-protein interaction |
References
- Zhou, T.; Fang, Y.; Tian, T.; Wang, G. Pathological mechanism of immune disorders in diabetic kidney disease and intervention strategies. World J Diabetes 2024, 15, 1111–1121. [Google Scholar] [CrossRef]
- Sun, H.; Saeedi, P.; Karuranga, S.; Pinkepank, M.; Ogurtsova, K.; Duncan, B.B.; Stein, C.; Basit, A.; Chan, J.C.N.; Mbanya, J.C.; et al. IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045. Diabetes Res Clin Pr 2022, 183, 109119. [Google Scholar] [CrossRef]
- Feng, L.; Feng, Y.; Ren, Q.; Fu, P.; Ma, L. Mesangial Cells in Diabetic Kidney Disease: From Mechanisms to Therapeutic Implications. Int J Biol Sci 2025, 21, 4762–4781. [Google Scholar] [CrossRef]
- Deng, J.; Liu, Y.; Liu, Y.; Li, W.; Nie, X. The Multiple Roles of Fibroblast Growth Factor in Diabetic Nephropathy. J Inflamm Res 2021, 14, 5273–5290. [Google Scholar] [CrossRef]
- Ni, Q.; Wang, J.Y.; Pang, Q.; Bai, Y. Guideline for the integrated traditional Chinese and western medicine prevention and treatment of diabetic kidney disease. J Glob Tradit Chin Med 2025, 18, 1731–1740. [Google Scholar]
- Blazek, O.; Bakris, G.L. Slowing the Progression of Diabetic Kidney Disease. Cells-Basel 2023, 12, 1975. [Google Scholar] [CrossRef]
- Gong, X.; Cao, L.; Ni, H.; Zang, Z.; Chang, H. Chinese herbal medicine for the treatment of diabetic nephropathy: From clinical evidence to potential mechanisms. J Ethnopharmacol 2024, 330, 118179. [Google Scholar] [CrossRef]
- Xiang, S.; Shi, X.; Lv, M.; Gao, G.; Wang, P.; Ma, H.; Xu, J.; Xie, Z.; Zhang, X.; Li, G. Salvianolic acid C, a novel pyroptosis inhibitor, attenuates podocyte injury in diabetic kidney disease through regulating miRNA-21/A20 pathway. J Ethnopharmacol 2026, 365, 121589. [Google Scholar] [CrossRef] [PubMed]
- Gong, Y.X. Research progress of effective components of traditional Chinese medicine in intervening apoptosis of renal tubular epithelial cells in diabetic kidney disease. J Ethnopharmacol 2025, 348, 119874. [Google Scholar] [CrossRef]
- Chen, X.; Li, X.; Cao, B.; Chen, X.; Zhang, K.; Han, F.; Kan, C.; Zhang, J.; Sun, X.; Guo, Z. Mechanisms and efficacy of traditional Chinese herb monomers in diabetic kidney disease. Int Urol Nephrol 2024, 56, 571–582. [Google Scholar] [CrossRef]
- Zhang, L.; Shergis, J.L.; Yang, L.; Zhang, A.L.; Guo, X.; Zhang, L.; Zhou, S.; Zeng, L.; Mao, W.; Xue, C.C. Astragalus membranaceus (Huang Qi) as adjunctive therapy for diabetic kidney disease: An updated systematic review and meta-analysis. J Ethnopharmacol 2019, 239, 111921. [Google Scholar] [CrossRef]
- Liu, P.; Hong, K.; Liu, Y.; Sun, Z.; Zhao, T.; Li, X.; Lao, C.; Tan, S.; Zhang, H.; Zhao, Y.; et al. Total flavonoids of Astragalus protects glomerular filtration barrier in diabetic kidney disease. Chin Med-Uk 2024, 19, 27. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Xu, C.; Huang, J.; Xu, C.; Xiong, Y. Astragalus polysaccharide attenuates diabetic nephropathy by reducing apoptosis and enhancing autophagy through activation of Sirt1/FoxO1 pathway. Int Urol Nephrol 2024, 56, 3067–3078. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wang, J.; Xiang, S.; Zhao, L.; Lv, M.; Duan, Y.; Gao, G.; Wang, P.; Jie Chen, J.; Xu, J.; et al. Astragaloside I from Astragalus Attenuates Diabetic Kidney Disease by Regulating HDAC3/Klotho/TGF-β1 Loop. Am J Chin Med 2024, 52, 1795–1817. [Google Scholar] [CrossRef]
- Li, X.; Li, X.; Wang, L.; Hou, Y.; Liu, Y.; Mao, J.; Zhang, L.; Li, X. Advancing Traditional Chinese Medicine Research through Network Pharmacology: Strategies for Target Identification, Mechanism Elucidation and Innovative Therapeutic Applications. Am J Chin Med 2025, 53, 2021–2042. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Shao, N.; Gao, Y.; Li, B.; Liang, Y.; Yang, Y.; Li, J. Mechanistic Investigation of Astragalus Root in the Management of T2DM-NAFLD Comorbidity: An Integrated Network Pharmacology, Molecular Docking, Molecular Dynamics Simulation, and In Vitro Study. Pharmaceuticals 2026, Vol. 19, 289. [Google Scholar] [CrossRef]
- Gong, Y.; Tian, X.; Ma, X.; Xing, J.; Ji, Z.; Gao, X.; Chen, Z.; Hu, F.; Yin, D.; Li, F.; et al. New insights into the pharmacological mechanisms of Jinqi Jiangtang Tablets in the treatment of type 2 diabetes mellitus: A multi-omics approach combined with experimental validation. J Ethnopharmacol 2025, 350, 120020. [Google Scholar] [CrossRef]
- Ma, X.; Liu, R.; Xi, X.; Zhuo, H.; Gu, Y. Global burden of chronic kidney disease due to diabetes mellitus, 1990-2021, and projections to 2050. Front Endocrinol 2025, 16–2025. [Google Scholar] [CrossRef]
- Dai, Y.; Guo, M.; Jiang, L.; Gao, J. Network pharmacology-based identification of miRNA expression of Astragalus membranaceus in the treatment of diabetic nephropathy. Medicine 2022, 101, e28747. [Google Scholar] [CrossRef]
- Liu, M.; Di, Y.M.; May, B.; Zhang, A.L.; Zhang, L.; Chen, J.; Wang, R.; Liu, X.; Xue, C.C. Renal protective effects and mechanisms of Astragalus membranaceus for diabetic kidney disease in animal models: An updated systematic review and meta-analysis. Phytomedicine 2024, 129, 155646. [Google Scholar] [CrossRef]
- Bai, Z.; Xie, T.; Liu, T.; Chen, Z.; Yu, L.; Zhang, C.; Luo, J.; Chen, L.; Zhao, X.; Xiao, Y. An integrated RNA sequencing and network pharmacology approach reveals the molecular mechanism of dapagliflozin in the treatment of diabetic nephropathy. Front Endocrinol 2022, 13–2022. [Google Scholar] [CrossRef]
- Ma, Y.; Deng, Y.; Li, N.; Dong, A.; Li, H.; Chen, S.; Zhang, S.; Zhang, M. Network pharmacology analysis combined with experimental validation to explore the therapeutic mechanism of Schisandra Chinensis Mixture on diabetic nephropathy. J Ethnopharmacol 2023, 302, 115768. [Google Scholar] [CrossRef]
- Hu, X.; Yin, Y.; Xu, P.; Wei, M.; Zhang, W. Network toxicology and cell experiments reveal the mechanism of DEHP-induced diabetic nephropathy via Wnt signaling pathway. Toxicol Appl Pharm 2024, 493, 117144. [Google Scholar] [CrossRef] [PubMed]
- Choi, S.; Hong, S.P.; Bae, J.H.; Suh, S.H.; Bae, H.; Kang, K.P.; Lee, H.J.; Koh, G.Y. Hyperactivation of YAP/TAZ Drives Alterations in Mesangial Cells through Stabilization of N-Myc in Diabetic Nephropathy. Journal of the American Society of Nephrology: JASN 2023, 34, 809–828. [Google Scholar] [CrossRef] [PubMed]
- Mima, A.; Nomura, A.; Yasuzawa, T. Update on the pathophysiology and treatment of diabetic kidney disease: a narrative review. Expert Rev Clin Immu 2025, 21, 921–928. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Mei, J. Advances in Targeting the AGEs-RAGE Pathway for the Treatment of Diabetic Kidney Disease. Drug Des Devel Ther 2026, 20, 586198. [Google Scholar] [CrossRef]
- Shi, Q.; Zhou, T.; Hou, W.; Zhou, Y.; Deng, S.; Song, Y. Isoliquiritigenin Protects Against Diabetic Nephropathy in db/db Mice by Inhibiting Advanced Glycation End Product–Receptor for Advanced Glycation End Product Axis. Drug Develop Res 2025, 86, e70051. [Google Scholar] [CrossRef]
- Chen, J.; Chen, Y.; Shu, A.; Lu, J.; Du, Q.; Yang, Y.; Lv, Z.; Xu, H. Radix Rehmanniae and Corni Fructus against Diabetic Nephropathy via AGE-RAGE Signaling Pathway. J Diabetes Res 2020, 2020, 8358102. [Google Scholar] [CrossRef]
- Fang, Y.; Zhang, Y.; Jia, C.; Ren, C.; Zhao, X.; Zhang, X. Niaoduqing alleviates podocyte injury in high glucose model via regulating multiple targets and AGE/RAGE pathway: Network pharmacology and experimental validation. Front Pharmacol 2023, 14–2023. [Google Scholar] [CrossRef]
- Yu, R.; Wu, R.; Chen, T.; Zhang, Y.; Chen, X. Yiqi Yangyin Tongluo Recipe Alleviates Diabetic Kidney Disease Through AGE-RAGE Signalling Axis. Diabetes Metab Syndr Obes 2025, 18, 2041–2055. [Google Scholar] [CrossRef]
- Kriz, W.; Löwen, J.; Gröne, H. The complex pathology of diabetic nephropathy in humans. Nephrol Dial Transpl 2023, 38, 2109–2119. [Google Scholar] [CrossRef]
- Zhang, L.; Jin, G.; Zhang, W.; Wang, Q.; Liang, Y.; Dong, Q. CircRNA Arf3 suppresses glomerular mesangial cell proliferation and fibrosis in diabetic nephropathy via miR-107-3p/Tmbim6 axis. J Bioenerg Biomembr 2024, 56, 543–552. [Google Scholar] [CrossRef]
- Herrington, W.; Che, Z.; Sardell, R. Effects of empagliflozin on conventional and exploratory acute and chronic kidney outcomes: an individual participant-level meta-analysis. Lancet Diabetes Endocrinol 2025, 13, 1003–1014. [Google Scholar] [CrossRef]
- Ma, L.; Liu, D.; Yu, Y.; Li, Z.; Wang, Q. Immune-mediated renal injury in diabetic kidney disease: from mechanisms to therapy. Front Immunol 2025, 16–2025. [Google Scholar] [CrossRef]
- Feng, Y.; Zhang, Y.; Gao, F.; Liu, M.; Luo, Y. HOXD9/APOC1 axis promotes macrophage M1 polarization to exacerbate diabetic kidney disease progression through activating NF-κB signaling pathway. Hereditas 2024, 161, 40. [Google Scholar] [CrossRef]
- Njeim, R.; Alkhansa, S.; Fornoni, A. Unraveling the Crosstalk between Lipids and NADPH Oxidases in Diabetic Kidney Disease. Pharmaceutics 2023, Vol. 15, 1360. [Google Scholar] [CrossRef] [PubMed]
- Al-Masri, S.; Coelho, J.N.; Thomas, L. Molecular pathways and emerging therapeutic targets in the pathogenesis of diabetic kidney disease. Front Physiol 2026, 17–2026. [Google Scholar] [CrossRef] [PubMed]
- Zhou, M.; Zhang, Y.; Shi, L.; Li, L.; Zhang, D.; Gong, Z.; Wu, Q. Activation and modulation of the AGEs-RAGE axis: Implications for inflammatory pathologies and therapeutic interventions – A review. Pharmacol Res 2024, 206, 107282. [Google Scholar] [CrossRef]
- Mo, G.P.; Zhu, Y.; You, Y.; Chen, H.; Zhang, J.; Ku, B.; Yu, H.; Peng, Z. Diabetic Kidney Disease: Disease Progression Driven by Positive Feedback Loops and Therapeutic Strategies Targeting Pathogenic Pathways. Diabetes Metab Syndr Obes 2025, 18, 1073–1085. [Google Scholar] [CrossRef]
- Tian, J.; Chen, J.; Sun, Q.; Huang, T.; Xu, H.; Wang, J.; Ma, Z. Effects of the S1P/S1PR1 Signaling Pathway on High Glucose-Induced NRK-52E Epithelial-Mesenchymal Transition Via Regulation of ROS/NLRP3. Inflammation 2025, 48, 1285–1299. [Google Scholar] [CrossRef] [PubMed]
- Sopel, N.; Ohs, A.; Schiffer, M.; Müller-Deile, J. A Tight Control of Non-Canonical TGF-β Pathways and MicroRNAs Downregulates Nephronectin in Podocytes. Cells 2022, Vol. 11, 149. [Google Scholar] [CrossRef]
- Wang, L.; Wang, H.; Liu, T.; Lan, H. TGF-Beta as a Master Regulator of Diabetic Nephropathy. Int J Mol Sci 2021, Vol. 22, 7881. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Tang, L.; Wei, W. Berberine exerts renoprotective effects by regulating the AGEs-RAGE signaling pathway in mesangial cells during diabetic nephropathy. Mol Cell Endocrinol 2017, 443, 89–105. [Google Scholar] [CrossRef] [PubMed]
- Abo El- Nasr, N.M.E.; Saleh, D.O.; Hashad, I.M. Role of olmesartan in ameliorating diabetic nephropathy in rats by targeting the AGE/PKC, TLR4/P38-MAPK and SIRT-1 autophagic signaling pathways. Eur J Pharmacol 2022, 928, 175117. [Google Scholar] [CrossRef] [PubMed]
- Qin, J.; Peng, Z.; Yuan, Q.; Li, Q.; Peng, Y.; Wen, R.; Hu, Z.; Liu, J.; Xia, X.; Deng, H.; et al. AKF-PD alleviates diabetic nephropathy via blocking the RAGE/AGEs/NOX and PKC/NOX Pathways. Sci Rep-Uk 2019, 9, 4407. [Google Scholar] [CrossRef] [PubMed]










| Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| IL-6 | CACAAGTCCGGAGAGGAGAC | ACAGTGCATCATCGCTGTTC |
| IL-1β | AGGCTGACAGACCCCAAAAG | CTCCACGGGCAAGACATAGG |
| TNF-α | ATGGCCTCCCTCTCATCAGT | TTTGCTACGACGTGGGCTAC |
| PKC | AGCCCCACGTTTTGTGACC | GCTGGGAACATTCATCACGC |
| RAGE | AGGTGAGTGGAGAAAGCCAG | ATGTGTCAGGTGTTTAATCA |
| TGF-β | CTGCTGACCCCCACTGATAC | GGCTGATCCCGTTGATTTC |
| β-actin | ACCTCTATGCCAACACAGTG | GGACTCATCGTACTCCTGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).