Submitted:
24 March 2026
Posted:
25 March 2026
You are already at the latest version
Abstract
Postharvest fungal diseases remain a major cause of fruit losses during storage and distribution. In apples, grey mould caused by Botrytis cinerea is one of the most important postharvest pathogens, leading to significant economic losses worldwide. Although chemical fungicides are widely used to control this disease, increasing concerns about toxicity, environmental impact, and pathogen resistance have stimulated the search for safer and more sustainable alternatives. In this study, plant-derived antimicrobial peptides from the South American native species Peltophorum dubium were evaluated as potential natural antifungal agents for postharvest disease control. Four defensin candidates were selected from a catalogue of antimicrobial peptides previously generated through transcriptome mining of germinated seeds. Antifungal activity against B. cinerea was initially assessed using soluble protein fractions from recombinant production in Escherichia coli. Subsequently, the peptides PdDf11 and PdDf13 were purified from the two most active fractions; both peptides completely inhibited fungal growth in vitro, with a minimum inhibitory concentration of 6 µM. Finally, their protective effect was evaluated in apples stored under cold conditions. Purified PdDf11 showed the highest efficacy, reducing disease severity by 97% and disease incidence by 86%. These results highlight defensins as promising natural antifungal agents for sustainable postharvest protection of apples.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Fungal Strain
2.2. Cloning in pET32 and Generation of Recombinant Strains
2.3. Production and Purification of Recombinant Defensins
2.4. In Vitro Antifungal Screening and Determination of Minimum Inhibitory Concentration (MIC)
2.5. Control of Botrytis cinerea in Apples
3. Results
3.1. Selection of Candidate Defensins
3.2. Defensins Recombinant Production and Initial Antifungal Screening
3.3. Antifungal Activity of Purified Peptides Against B. cinerea
3.4. Protective Activity in Apples
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AMP | antimicrobial Peptide |
| IPTG | isopropyl β-D-1-thiogalactopyranoside |
| MIC | minimum inhibitory concentration |
| LB | Luria–Bertani medium |
| PDA | potato dextrose agar medium |
| MEB | malt extract broth |
| SDS–PAGE | sodium dodecyl sulfate–polyacrylamide gel electrophoresis |
| IMAC | immobilized metal affinity chromatography |
| TRX | thioredoxin |
| OD₆₀₀ | optical density at 600 nm |
Appendix A
| Primer | Sequence (5’→3’) |
|---|---|
| Pdf13/32_F1 | AAACCTGTATTTTCAGGGATCCCAGGACGATACCTCATCCATCC |
| Pdf13/32_R1 | CAGCTGCCGGATCCTTAAAAAAGGCCAAACAATACCG |
| Pdf11/32_F3 | AAACCTGTATTTTCAGGGATCCGCGTTAAGAATCCCTGAACATA |
| Pdf11/32_R3 | CAGCTGCCGGATCCTTAGAGAGGTGGGTCTTTACAATAATAAG |
| Pdf10/32_F4 | AAACCTGTATTTTCAGGGATCCAGAAGGTTTTGTTCAGTGGAGCTAG |
| Pdf10/32_R4 | CAGCTGCCGGATCCTTAAGGGCAGATATAGGAGCAGACG |

References
- Longa, C. M. O.; et al. Fungal Biodiversity of Apple Bark, Leaves, Stems, and Fruit Under Rain Shelters with Reduced Fungicide Schedule. Agriculture 2024, 15, 17. [Google Scholar] [CrossRef]
- Kemp, C. Apple revival: how science is bringing historic varieties back to life. Nature 2023, 622, 446–449. [Google Scholar] [CrossRef]
- Pimenta, R. S.; Morais, P. B.; Rosa, C. A.; Corrêa, A. Utilization of Yeasts in Biological Control Programs. In Yeast Biotechnology: Diversity and Applications; Satyanarayana, T., Kunze, G., Eds.; Springer Netherlands: Dordrecht, 2009; pp. 199–214. [Google Scholar] [CrossRef]
- Watkins, C.; Kupferman, E.; Rosenberger, D. Apple the commercial storage of fruits, vegetables, and florist and nursery stocks. 2004. [Google Scholar]
- Lawal, H.; et al. Biocontrol and Nanotechnology Strategies for Postharvest Disease Management in Fruits and Vegetables: A Comprehensive Review. Foods 14, 2782. [CrossRef]
- Sharma, R. R.; Singh, D.; Singh, R. Biological control of postharvest diseases of fruits and vegetables by microbial antagonists: A review. Biol. Control 2009, 50, 205–221. [Google Scholar] [CrossRef]
- Tripathi y, P.; Dubey, N. K. Exploitation of natural products as an alternative strategy to control postharvest fungal rotting of fruit and vegetables. Postharvest Biol. Technol. 2004, 32, 235–245. [Google Scholar] [CrossRef]
- Nadar, S.; Khan, T.; Patching, S. G.; Omri, A. Development of Antibiofilm Therapeutics Strategies to Overcome Antimicrobial Drug Resistance. Microorganisms 2022, 10, 303. [Google Scholar] [CrossRef]
- Tang, R.; et al. Application of antimicrobial peptides in plant protection: making use of the overlooked merits. Front. Plant Sci. 2023, 14, 1139539. [Google Scholar] [CrossRef]
- Liu, Z.; Zeng, M.; Dong, S.; Xu, J.; Song, H.; Zhao, Y. Effect of an antifungal peptide from oyster enzymatic hydrolysates for control of gray mold (Botrytis cinerea) on harvested strawberries. Postharvest Biol. Technol. 2007, 46, 95–98. [Google Scholar] [CrossRef]
- Zhang, B. Peptides derived from tryptic hydrolysate of Bacillus subtilis culture suppress fungal spoilage of table grapes. Food Chem. 2018, 239, 520–528. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Gao, L.; Lin, M.; Yu, T. Recombinant expression of antimicrobial peptides in Pichia pastoris: A strategy to inhibit the Penicillium expansum in pears. Postharvest Biol. Technol. 2021, 171, 111298. [Google Scholar] [CrossRef]
- Li, J.; Hu, S.; Jian, W.; Xie, C.; Yang, X. Plant antimicrobial peptides: structures, functions, and applications. Bot. Stud. 2021, 62, 5. [Google Scholar] [CrossRef]
- Lima, A. M.; et al. Plant antimicrobial peptides: An overview about classification, toxicity and clinical applications. Int. J. Biol. Macromol. 2022, 214, 10–21. [Google Scholar] [CrossRef]
- Zou, F.; et al. Plant antimicrobial peptides: a comprehensive review of their classification, production, mode of action, functions, applications, and challenges. Food Funct. 2023, 14, 5492–5515. [Google Scholar] [CrossRef]
- Kovaleva, V.; Bukhteeva, I.; Kit, O. Y.; Nesmelova, I. V. Plant Defensins from a Structural Perspective. Int. J. Mol. Sci. 2020, 21, 5307. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Decuadro, S. Antimicrobial peptides in the seedling transcriptome of the tree legume Peltophorum dubium. Biochimie 2021, 180, 229–242. [Google Scholar] [CrossRef]
- Van Der Weerden, N. L.; Anderson, M. A.; et al. Plant defensins: Common fold, multiple functions. Fungal Biol. Rev. 2013, 26, 121–131. [Google Scholar] [CrossRef]
- Bond y, S. R.; Naus, C. C. RF-Cloning.org: an online tool for the design of restriction-free cloning projects. Nucleic Acids Res. 2012, 40, W209–W213. [Google Scholar] [CrossRef] [PubMed]
- Van Den Ent y, F.; Löwe, J. RF cloning: A restriction-free method for inserting target genes into plasmids. J. Biochem. Biophys. Methods 2006, 67, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Decuadro, S.; Dans, P. D.; Borba, M. A.; Benko-Iseppon, A. M.; Cecchetto, G. Gene isolation and structural characterization of a legume tree defensin with a broad spectrum of antimicrobial activity. Planta 2019, 250, 1757–1772. [Google Scholar] [CrossRef]
- Arrarte, E.; Garmendia, G.; Rossini, C.; Wisniewski, M.; Vero, S. Volatile organic compounds produced by Antarctic strains of Candida sake play a role in the control of postharvest pathogens of apples. Biol. Control 2017, 109, 14–20. [Google Scholar] [CrossRef]
- Vero, S.; Mondino, P.; Burgueño, J.; Soubes, M.; Wisniewski, M. Characterization of biocontrol activity of two yeast strains from Uruguay against blue mold of apple. Postharvest Biol. Technol. 2002, 26, 91–98. [Google Scholar] [CrossRef]
- Madden, L. V.; Hughes, G.; Van Den Bosch, F. The Study of Plant Disease Epidemics; The American Phytopathological Society, 2017. [Google Scholar] [CrossRef]
- Badosa, E. Sporicidal Activity of Synthetic Antifungal Undecapeptides and Control of Penicillium Rot of Apples. Appl. Environ. Microbiol. 2009, 75, 5563–5569. [Google Scholar] [CrossRef] [PubMed]
- Delgado, J.; Ballester, A.-R.; Núñez, F.; González-Candelas, L. Evaluation of the activity of the antifungal PgAFP protein and its producer mould against Penicillium spp postharvest pathogens of citrus and pome fruits. Food Microbiol. 2019, 84, 103266. [Google Scholar] [CrossRef] [PubMed]




Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).