Submitted:
12 November 2025
Posted:
14 November 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Animals, Materials and Methods
2.1. Blood Sampling
2.2. DNA Extraction
2.3. Genetic Testing
2.4. Statistical Analysis
3. Results
3.1. Dutch Cohort

3.2. Australian Cohort
4. Discussion
5. Conclusions
Funding
Acknowledgments
Conflicts of Interest
Ethics Statement
References
- Fox, P.R. Pathology of myxomatous mitral valve disease in the dog. J. Vet. Cardiol. 2012, 14, 103–126. [Google Scholar] [CrossRef] [PubMed]
- Borgarelli, M.; Savarino, P.; Crosara, S.; Santilli, R.A.; Chiavegato, D.; Poggi, M.; Bellino, C.; La Rosa, G.; Zanatta, R.; Haggstrom, J.; Tarducci, A. Survival characteristics and prognostic variables of dogs with mitral regurgitation attributable to myxomatous valve disease. J. Vet. Intern. Med. 2008, 22, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Axelsson, E.; Ljungvall, I.; Bhoumik, P.; Conn, L.B.; Muren, E.; Ohlsson, Å.; Olsen, L.H.; Engdahl, K.; Hagman, R.; Hanson, J.; Kryvokhyzha, D.; Pettersson, M.; Grenet, O.; Moggs, J.; Del Rio-Espinola, A.; Epe, C.; Taillon, B.; Tawari, N.; Mane, S.; Hawkins, T.; Hedhammar, Å.; Gruet, P.; Häggström, J.; Lindblad-Toh, K. The genetic consequences of dog breed formation-Accumulation of deleterious genetic variation and fixation of mutations associated with myxomatous mitral valve disease in cavalier King Charles spaniels. PLoS Genet. 2021, 17, e1009726. [Google Scholar] [CrossRef] [PubMed]
- Lewis, T.; Swift, S.; Woolliams, J.A.; Blott, S. Heritability of premature mitral valve disease in Cavalier King Charles spaniels. Vet. J. 2011, 188, 73–76. [Google Scholar] [CrossRef] [PubMed]
- Swenson, L.; Häggström, J.; Kvart, C.; Juneja, R.K. Relationship between parental cardiac status in Cavalier King Charles spaniels and prevalence and severity of chronic valvular disease in offspring. J. Am. Vet. Med. Assoc. 1996, 208, 2009–2012. [Google Scholar] [CrossRef] [PubMed]
- Mead, S.E.; Beijerink, N.J.; O’Brien, M.; Wade, C.M. Genetic Variants at the Nebulette Locus Are Associated with Myxomatous Mitral Valve Disease Severity in Cavalier King Charles Spaniels. Genes 2022, 13. [Google Scholar] [CrossRef] [PubMed]
- Birkegård, A.C.; Reimann, M.J.; Martinussen, T.; Häggström, J.; Pedersen, H.D.; Olsen, L.H. Breeding Restrictions Decrease the Prevalence of Myxomatous Mitral Valve Disease in Cavalier King Charles Spaniels over an 8- to 10-Year Period. J. Vet. Intern. Med. 2016, 30, 63–68. [Google Scholar] [CrossRef] [PubMed]
- Swift, S.; Baldin, A.; Cripps, P. Degenerative Valvular Disease in the Cavalier King Charles Spaniel: Results of the UK Breed Scheme 1991-2010. J. Vet. Intern. Med. 2017, 31, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Bannasch, D.; Famula, T.; Donner, J.; Anderson, H.; Honkanen, L.; Batcher, K.; Safra, N.; Thomasy, S.; Rebhun, R. The effect of inbreeding, body size and morphology on health in dog breeds. Canine Med. Genet. 2021, 8, 12. [Google Scholar] [CrossRef] [PubMed]
- Templeton, A.R. The reality and importance of founder speciation in evolution. Bioessays 2008, 30, 470–479. [Google Scholar] [CrossRef] [PubMed]
- Dussex, N.; Morales, H.E.; Grossen, C.; Dalén, L.; van Oosterhout, C. Purging and accumulation of genetic load in conservation. Trends Ecol. Evol. 2023, 38, 961–969. [Google Scholar] [CrossRef] [PubMed]
- Marsden, C.D.; Ortega-Del Vecchyo, D.; O’Brien, D.P.; Taylor, J.F.; Ramirez, O.; Vilà, C.; Marques-Bonet, T.; Schnabel, R.D.; Wayne, R.K.; Lohmueller, K.E. Bottlenecks and selective sweeps during domestication have increased deleterious genetic variation in dogs. Proc Natl Acad Sci USA 2016, 113, 152–157. [Google Scholar] [CrossRef] [PubMed]
- Dreger, D.L.; Rimbault, M.; Davis, B.W.; Bhatnagar, A.; Parker, H.G.; Ostrander, E.A. Whole-genome sequence, SNP chips and pedigree structure: building demographic profiles in domestic dog breeds to optimize genetic-trait mapping. Dis. Model. Mech. 2016, 9, 1445–1460. [Google Scholar] [CrossRef] [PubMed]
- Coile, D.C. Cavalier King Charles Spaniel (Complete Pet Owner’s Manuals); B.E.S. Publishing: Hauppauge, NY, USA, 1998; p. 120. ISBN 0764102273. [Google Scholar]
- Arnold, M. Katz, M.D. Physiology of the Heart, 5th ed.; LWW: Philadelphia, PA, USA, 2010; p. 576. ISBN 978-1-60831-171-2. [Google Scholar]
- Moncman, C.L.; Wang, K. Targeted disruption of nebulette protein expression alters cardiac myofibril assembly and function. Exp. Cell Res. 2002, 273, 204–218. [Google Scholar] [CrossRef] [PubMed]
- Korec, E.; Ungrová, L.; Kalvas, J.; Hejnar, J. Identification of genes associated with longevity in dogs: 9 candidate genes described in Cavalier King Charles Spaniel. Veterinary and Animal Science 2025, 27, 100420. [Google Scholar] [CrossRef] [PubMed]
| Primer | Sequence 5’-3’ |
|---|---|
| NEBL1_Forward | 5’- GGAAGCAGGCTCAGACTCTC -3’ |
| NEBL1_Reverse | 5’- AACCTGACCAGTCCTTGGTG -3’ |
| NEBL2_Forward | 5’- GCAGAAGGGCAACACTCTCT -3’ |
| NEBL2_Reverse | 5’- TCTCTTTCTTTTGCCGCCCT -3’ |
| NEBL3_Forward | 5’- AGCCCTCCTTCTGTGCTTTA -3’ |
| NEBL3_Reverse | 5’- CTCCAAGGAGCCATCACATT -3’ |
| Primer | Sequence 5’-3’ |
|---|---|
| NEBL3_Forward (wildtype allele) | 5’-CAGCAGACCCCAGCAGAGCG-3' |
| NEBL3_Forward (risk allele) | 5’-AACTGATAGATCGGAATGGTCAGCAGACCCCAGCAGAATA-3' |
| NEBL3_Reverse | 5’-TACAGAGTTTCAGTCCTGCCAAA-3' |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).