Submitted:
23 September 2025
Posted:
23 September 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Expression and Location of ESR1/ERα
2.2. Verification of siRNA-ESR1 Transfection Efficiency
2.3. ESR1 Knockdown Inhibits ESCs Proliferation In Vitro
2.4. ESR1 Knockdown Accelerated Cell Apoptosis and Arrested Cell Cycle Progress in Hu Sheep ESCs
2.5. ESR1 Knockdown Inhibits Migration of Hu Sheep ESCs In Vitro
3. Discussion
4. Materials and Methods
4.1. Tissue Sample Collection
4.2. Cell Isolation and Culture
4.3. Total RNAs of Tissue and Cell Isolation and qRT-PCR
4.4. Immunohistochemistry
4.5. Western Blot
4.7. Analysis of Cell Proliferation
4.8. Analysis of Apoptosis and Cell Cycle
4.9. Wound Assay
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Osz, J.; Brélivet, Y.; Peluso-Iltis, C.; Cura, V.; Eiler, S.; Ruff, M.; Bourguet, W.; Rochel moras, N.; Moras, D. Structural basis for a molecular allosteric control mechanism of cofactor binding to nuclear receptors. Proc. Natl. Acad. Sci. USA 2012, 109, E588–E594. [Google Scholar] [CrossRef] [PubMed]
- Couse, J.F.; Lindzey, J.; Grandien, K.; Gustafsson, J.A.; Korach, K.S. Tissue distribution and quantitative analysis of estrogen receptor-alpha (ERalpha) and estrogen receptor-beta (ERbeta) messenger ribonucleic acid in the wild-type and ERalpha-knockout mouse. Endocrinology 1997, 138, 9. [Google Scholar] [CrossRef] [PubMed]
- Yu, K.; Huang, Z.Y.; Xu, X.L.; Li, J.; Fu, X.W.; Deng, S.L. Estrogen Receptor Function: Impact on the Human Endometrium. Front Endocrinol (Lausanne) 2022, 13, 827724. [Google Scholar] [CrossRef] [PubMed]
- J. A. McCracken, W.S., W.C. Okulicz. Hormone receptor control of pulsatile secretion of PGF2α from the ovine uterus during luteolysis and its abrogation in early pregnancy. animal reproduction science 1984, 7, 5. [Google Scholar]
- Byers, M.J.; Zangl, A.; Phernetton, T.M.; Lopez, G.; Chen, D.B.; Magness, R.R. Endothelial vasodilator production by ovine uterine and systemic arteries: ovarian steroid and pregnancy control of ERalpha and ERbeta levels. J Physiol 2005, 565, 85–99. [Google Scholar] [CrossRef]
- Pastore, M.B.; Jobe, S.O.; Ramadoss, J.; Magness, R.R. Estrogen receptor-α and estrogen receptor-β in the uterine vascular endothelium during pregnancy: functional implications for regulating uterine blood flow. Semin Reprod Med 2012, 30, 46–61. [Google Scholar] [CrossRef]
- Couse, J.F.; Korach, K.S. Contrasting phenotypes in reproductive tissues of female estrogen receptor null mice. Ann N Y Acad Sci 2001, 948, 1–8. [Google Scholar] [CrossRef]
- Couse, J.F.; Korach, K.S. Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 1999, 20, 358–417. [Google Scholar] [CrossRef]
- Hess, R.A. Estrogen in the adult male reproductive tract: a review. Reprod Biol Endocrinol 2003, 1, 52. [Google Scholar] [CrossRef]
- Parlevliet, J.M.; Pearl, C.A.; Hess, M.F.; Famula, T.R.; Roser, J.F. Immunolocalization of estrogen and androgen receptors and steroid concentrations in the stallion epididymis. Theriogenology 2006, 66, 755–765. [Google Scholar] [CrossRef]
- Hess, R.A.; Bunick, D.; Bahr, J. Oestrogen, its receptors and function in the male reproductive tract - a review. Mol Cell Endocrinol 2001, 178, 29–38. [Google Scholar] [CrossRef]
- Ge, W.; Xiao, L.; Duan, H.; Jiang, Y.; Lv, J.; Ding, Z.; Hu, J.; Zhao, X.; Zhang, Y. Androgen receptor, aromatase, oestrogen receptor alpha/beta and G protein-coupled receptor 30 expression in the testes and epididymides of adult sheep. Reprod Domest Anim 2020, 55, 460–468. [Google Scholar] [CrossRef] [PubMed]
- Winuthayanon, W.; Lierz, S.L.; Delarosa, K.C.; Sampels, S.R.; Donoghue, L.J.; Hewitt, S.C.; Korach, K.S. Juxtacrine Activity of Estrogen Receptor α in Uterine Stromal Cells is Necessary for Estrogen-Induced Epithelial Cell Proliferation. Sci Rep 2017, 7, 8377. [Google Scholar] [CrossRef] [PubMed]
- Pawar, S.; Laws, M.J.; Bagchi, I.C.; Bagchi, M.K. Uterine Epithelial Estrogen Receptor-α Controls Decidualization via a Paracrine Mechanism. Mol Endocrinol 2015, 29, 1362–1374. [Google Scholar] [CrossRef]
- Taylor, K.M.; Gray, C.A.; Joyce, M.M.; Stewart, M.D.; Bazer, F.W.; Spencer, T.E. Neonatal ovine uterine development involves alterations in expression of receptors for estrogen, progesterone, and prolactin. Biol Reprod 2000, 63, 1192–1204. [Google Scholar] [CrossRef]
- Burns, K.A.; Rodriguez, K.F.; Hewitt, S.C.; Janardhan, K.S.; Young, S.L.; Korach, K.S. Role of estrogen receptor signaling required for endometriosis-like lesion establishment in a mouse model. Endocrinology 2012, 153, 3960–3971. [Google Scholar] [CrossRef]
- Wang, T.; Wang, Z. Targeting the "Undruggable": Small-Molecule Inhibitors of Proliferating Cell Nuclear Antigen (PCNA) in the Spotlight in Cancer Therapy. J Med Chem 2025. [Google Scholar] [CrossRef]
- Dong, A.; Yu, X.; Zhang, Y.; Liu, L.; Liu, F.; Song, W.; Zheng, J. Anti-Müllerian hormone regulates ovarian granulosa cell growth in PCOS rats through SMAD4. Int J Gynaecol Obstet 2025. [Google Scholar] [CrossRef]
- Ai, Y.; Meng, Y.; Yan, B.; Zhou, Q.; Wang, X. The biochemical pathways of apoptotic, necroptotic, pyroptotic, and ferroptotic cell death. Mol Cell 2024, 84, 170–179. [Google Scholar] [CrossRef]
- Boldin, M.P.; Varfolomeev, E.E.; Pancer, Z.; Mett, I.L.; Camonis, J.H.; Wallach, D. A Novel Protein That Interacts with the Death Domain of Fas/APO1 Contains a Sequence Motif Related to the Death Domain (∗). Journal of Biological Chemistry 1995, 270, 7795–7798. [Google Scholar] [CrossRef] [PubMed]
- Pihán, P.; Carreras-Sureda, A.; Hetz, C. BCL-2 family: integrating stress responses at the ER to control cell demise. Cell Death Differ 2017, 24, 1478–1487. [Google Scholar] [CrossRef]
- Czabotar, P.E.; Lessene, G.; Strasser, A.; Adams, J.M. Control of apoptosis by the BCL-2 protein family: implications for physiology and therapy. Nat Rev Mol Cell Biol 2014, 15, 49–63. [Google Scholar] [CrossRef]
- Green, D.R. The Mitochondrial Pathway of Apoptosis Part II: The BCL-2 Protein Family. Cold Spring Harb Perspect Biol 2022, 14. [Google Scholar] [CrossRef] [PubMed]
- White, M.J.; McArthur, K.; Metcalf, D.; Lane, R.M.; Cambier, J.C.; Herold, M.J.; van Delft, M.F.; Bedoui, S.; Lessene, G.; Ritchie, M.E.; et al. Apoptotic caspases suppress mtDNA-induced STING-mediated type I IFN production. Cell 2014, 159, 1549–1562. [Google Scholar] [CrossRef]
- Riley, J.S.; Quarato, G.; Cloix, C.; Lopez, J.; O'Prey, J.; Pearson, M.; Chapman, J.; Sesaki, H.; Carlin, L.M.; Passos, J.F.; et al. Mitochondrial inner membrane permeabilisation enables mtDNA release during apoptosis. Embo j 2018, 37. [Google Scholar] [CrossRef]
- Wang, Z. Cell Cycle Progression and Synchronization: An Overview. Methods Mol Biol 2022, 2579, 3–23. [Google Scholar] [CrossRef] [PubMed]
- Bashir, T.; Pagano, M. Cdk1: the dominant sibling of Cdk2. Nat Cell Biol 2005, 7, 779–781. [Google Scholar] [CrossRef] [PubMed]
- Kastenhuber, E.R.; Lowe, S.W. Putting p53 in Context. Cell 2017, 170, 1062–1078. [Google Scholar] [CrossRef]
- Manohar, S.; Estrada, M.E.; Uliana, F.; Vuina, K.; Alvarez, P.M.; de Bruin, R.A.M.; Neurohr, G.E. Genome homeostasis defects drive enlarged cells into senescence. Mol Cell 2023, 83, 4032–4046.e4036. [Google Scholar] [CrossRef]
- Scarpa, E.; Mayor, R. Collective cell migration in development. J Cell Biol 2016, 212, 143–155. [Google Scholar] [CrossRef]
- Shuai, Q.; Liang, Y.; Xu, X.; Halbiyat, Z.; Wang, X.; Cheng, J.; Liu, J.; Huang, T.; Peng, Z.; Wang, L.; et al. Sodium alginate hydrogel integrated with type III collagen and mesenchymal stem cell to promote endometrium regeneration and fertility restoration. Int J Biol Macromol 2023, 253, 127314. [Google Scholar] [CrossRef]
- Bashiri, A.; Halper, K.I.; Orvieto, R. Recurrent Implantation Failure-update overview on etiology, diagnosis, treatment and future directions. Reprod Biol Endocrinol 2018, 16, 121. [Google Scholar] [CrossRef]
- Feng, X.; Li, F.; Wang, F.; Zhang, G.; Pang, J.; Ren, C.; Zhang, T.; Yang, H.; Wang, Z.; Zhang, Y. Genome-wide differential expression profiling of mRNAs and lncRNAs associated with prolificacy in Hu sheep. Biosci Rep 2018, 38. [Google Scholar] [CrossRef]
- Gao, X.X.; Li, X.H.; Zhang, Q.F.; Zhu, M.; Guo, Y.X.; Deng, K.P.; Zhang, G.M.; Wang, F. Effects of l-arginine on endometrial microvessel density in nutrient-restricted Hu sheep. Theriogenology 2018, 119, 252–258. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Liu, X.; Liu, J.; Ma, X.; Zhou, Z.; Song, Y.; Cao, B. miR-26a promoted endometrial epithelium cells (EECs) proliferation and induced stromal cells (ESCs) apoptosis via the PTEN-PI3K/AKT pathway in dairy goats. J Cell Physiol 2018, 233, 4688–4706. [Google Scholar] [CrossRef]
- De Clercq, K.; Hennes, A.; Vriens, J. Isolation of Mouse Endometrial Epithelial and Stromal Cells for In Vitro Decidualization. J Vis Exp 2017. [Google Scholar] [CrossRef] [PubMed]
- Ayako MASUDA, N.K. , Kazuhiko NAKABAYASHI, et al. An improved method for isolation of epithelial and stromal cells from the human endometrium. Journal of Reproduction and Development 2016, 62, 6. [Google Scholar]
- Sun, X.; Yuan, X.; Chen, L.; Wang, T.; Wang, Z.; Sun, G.; Li, X.; Li, X.; Liu, G. Histamine Induces Bovine Rumen Epithelial Cell Inflammatory Response via NF-κB Pathway. Cell Physiol Biochem 2017, 42, 1109–1119. [Google Scholar] [CrossRef]
- Guo, Y.X.; Nie, H.T.; Sun, L.W.; Zhang, G.M.; Deng, K.P.; Fan, Y.X.; Wang, F. Effects of diet and arginine treatment during the luteal phase on ovarian NO/PGC-1alpha signaling in ewes. Theriogenology 2017, 96, 76–84. [Google Scholar] [CrossRef]
Short Biography of Authors





| Items | Primer Sequences (5ʹ–3ʹ) | Fragment Size (bp) | Gene Bank No. |
|---|---|---|---|
| SUZ12 | F: CTTTGAGAAACCAACGCAGATCTAT | 207 | XM_015098517.1 |
| R: TGCAGATGAGCTGACAAGCTA | |||
| β-actin | F: TCAGCAAGCAGGAGTACGAC R: ACGAGGCCAATCTCATCTCG |
138 | NM_001009784.3 |
| ESR1 | F: TCTGGAAGAGAAGGACCAC R: AAGTGAGAGAGGAGGAGGAG |
138 | XM_042253634.1 |
| P53 | F: TTCCCCTTCCCTCAACAAGC R: GCGCGTAAATTCCCTTCCAC |
143 | NM_001009403.1 |
| Bax | F: CGAGTGGCGGCTGAAAT | 286 | XM_015100640.1 |
| R: GGTCTGCCATGTGGGTGTC | |||
| Bcl-2 | F: CGCATCGTGGCCTTCTTT | 113 | XM_012103831.2 |
| R: CGGTTCAGGTACTCGGTCATC | |||
| Caspase3 | F: GGCTCTGAGTGTTTGGGGAA | 131 | XM_015104560.1 |
| R: CCTGGACAAAGTTCCGTGGT | |||
| Caspase9 | F: GCCAAGCCAAGGAAAACTCG R: CACGGCAGAAGTTCACGTTG |
236 | XM_012187488.2 |
| P21 | F: TGCCGCTGCCTCTTTGGT R: AAAGTCGAAGTTCCATCGCTCT |
108 | XM_012100423.3 |
| CDK4 | F: GCTGCTGCTGGAGATGCTGAC R: CTCTGCGTCACCTTCTGCCTTG |
100 | XM_012158548.3 |
| CDK6 | F: TCATTCTCACCGAGTGGTGC R: ATAGCTGGACTGCAGGAGGA |
181 | XM_012177413.4 |
| CyclinD1 | F: ACATGGAGCTGGTCCTGGTGA R: GGAGGGTGGGTTGGAAATGAA |
188 | XM_015102997.1 |
| CyclinD2 | F: AGCACGCTCAGACCTTCATC R: AGGCAATCCACATCCGTGTT |
193 | NM_001127290.1 |
| CyclinE1 | F: TTGCTGCTTCCGCCTTGTATC R: ACCATCCACTTGACACACTTCTC |
100 | XM_060398020.1 |
| Antibodies | Cat No. | Source | Dilution of IHC/IF | Dilution of WB |
|---|---|---|---|---|
| ERα | sc-787 | Sant Cruz, Dallas, TX, USA | 1:250 | 1:1000 |
| β-actin | T0022 | Affinity Biosciences, USA | - | 1:5000 |
| Bax | 50599-2-ig | Proteintech, Chicago, IL, USA | - | 1:5000 |
| Bcl-2 | 12789-1-AP | Proteintech, Chicago, IL, USA | - | 1:1000 |
| PCNA | ab15497 | Abcam, Cambridge, UK | - | 1:500 |
| Goat anti-Rabbit IgG | SA00001-2 | Proteintech, Chicago, IL, USA | - | 1:5000 |
| Goat anti-Mouse IgG | SA00001-1 | Proteintech, Chicago, IL, USA | - | 1:5000 |
| Items | Sequences(5ʹ–3ʹ) |
|---|---|
| siRNA-ESR1-1053 | Sense: GGAGAAUGUUGAAGCACAATT |
| Antisense: UUGUGCUUCAACAUUCUCCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).