Submitted:
02 September 2025
Posted:
03 September 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Methods
2.1. Isolates
2.2. NG-Test Carba 5 Assay
2.3. DNA Isolation and Detection of Carbapenemase Genes by PCR
2.4. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
References
- WH Organization, WHO Bacterial Priority Pathogens List, 2024, Bacterial Pathogens of Public Health Importance, to Guide Research, Development, and Strategies to Prevent and Control Antimicrobial Resistance (World Health Organization, 2024).
- Wang, G.; Zhao, G.; Chao, X.; Xie, L.; Wang, H. The Characteristic of Virulence, Biofilm and Antibiotic Resistance of Klebsiella pneumoniae. Int J Environ Res Public Health. 2020, 17, 6278. [Google Scholar] [CrossRef] [PubMed]
- Nordmann, P.; Poirel, L. The difficult-to-control spread of carbapenemase producers among Enterobacteriaceae worldwide. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2014, 20, 821–830. [Google Scholar] [CrossRef] [PubMed]
- Nordmann, P.; Dortet, L.; Poirel, L. Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol Med 2012, 18, 263–272. [Google Scholar] [CrossRef] [PubMed]
- Keshta, A.S.; Elamin, N.; Hasan, M.R.; et al. Evaluation of Rapid Immunochromatographic Tests for the Direct Detection of Extended Spectrum Beta-Lactamases and Carbapenemases in Enterobacterales Isolated from Positive Blood Cultures. Microbiology Spectrum. 2021, 9, e0078521. [Google Scholar] [CrossRef]
- Moreira, N.K.; Wilhelm, C.M.; Volpato, F.C.Z.; Barth, A.L.; Caierão, J. Detection of Carbapenem Resistance in Enterobacterales Directly From Positive Blood Cultures Using Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry. Arch Pathol Lab Med. 2024, 148, 1145–1151. [Google Scholar] [CrossRef]
- Del Corpo, O.; Senécal, J.; Hsu, J.M.; Lawandi, A.; Lee, T.C. Rapid phenotypic testing for detection of carbapenemase- or extended-spectrum ß-lactamase-producing Enterobacterales directly from blood cultures: a systematic review and meta-analysis. Clin Microbiol Infect. 2023, 29, 1516–1527. [Google Scholar] [CrossRef]
- Pogue JM, Bonomo RA, Kaye KS: Ceftazidime_avibactam, meropenem_vaborbactam, or both_ clinical and formulary considerations. Clin Infect Dis 2019, 68, 519e524.
- van Duin D, Lok JJ, Earley M, Cober E, Richter SS, Perez F, Salata RA, Kalayjian RC, Watkins RR, Doi Y, Kaye KS,Fowler VG Jr, Paterson DL, Bonomo RA, Evans S; Antibacterial Resistance Leadership Group: Colistin versus ceftazidime-avibactam in the treatment of infections due to carbapenem-resistant Enterobacteriaceae. Clin Infect Dis 2018, 66, 163e171.
- Giordano L, Fiori B, D’Inzeo T, Parisi G, Liotti FM, Menchinelli G, De Angelis G, De Maio F, Luzzaro F, Sanguinetti M, Posteraro B, Spanu T: Simplified testing method for direct detection of carbapenemase-producing organisms from positive blood cultures using the NG-test Carba 5 assay. Antimicrob Agents Chemother 2019, 63, e00550-19.
- Bogaerts P, Berger AS, Evrard S, Huang TD: Comparison of two multiplex immunochromatographic assays for the rapid detection of major carbapenemases in Enterobacterales. J Antimicrob Chemother 2020, 75, 1491e1494.
- Boutal H, Vogel A, Bernabeu S, Devilliers K, Creton E, Cotellon G, Plaisance M, Oueslati S, Dortet L, Jousset A, Simon S, Naas T, Volland H: A multiplex lateral flow immunoassay for the rapid identification of NDM-, KPC-, IMP- and VIM-type and OXA-48-like carbapenemase-producing Enterobacteriaceae. J Antimicrob Chemother 2018, 73, 909e915.
- Bianco, G.; Boattini, M.; van Asten, S.A.V.; Iannaccone, M.; Zanotto, E.; Zaccaria, T.; Bernards, A.T.; Cavallo, R.; Costa C: RESIST-5, O.O.K.N.V. and NG-test Carba 5 assays for the rapid detection of carbapenemaseproducing Enterobacterales from positive blood cultures: a comparative study. J Hosp Infect 2020, 105, 162e166. [Google Scholar] [CrossRef] [PubMed]
- Munguia-Ramos, D.; Xancal-Salvador, L.F.; Esteban-Kenel, V.; Ortiz-Conchi, N.; Jaimes-Aquino, R.A.; Mendoza-Rojas, M.; Cervantes-Sánchez, A.; Méndez-Ramos, S.; Rivera-Villegas, H.O.; Rajme-Lopez, S.; Tamez-Torres, K.M.; Roman-Montes, C.M.; Martínez-Gamboa, A.; Bobadilla Del-Valle, M.; Sifuentes-Osornio, J.; Ponce-de-Leon, A.; Gonzalez-Lara, M.F.; Martinez-Guerra, B.A. Rapid Detection of Carbapenemases Using NG-Test® CARBA 5 in Positive Blood Cultures: A Diagnostic Test Study. Antibiotics (Basel). 2024, 13, 1105. [Google Scholar] [CrossRef] [PubMed]
- Huang YT, Kuo YW, Lee NY, Tien N, Liao CH, Teng LJ, Ko WC, Hsueh PR; SMART study group. Evaluating NG-Test CARBA 5 Multiplex Immunochromatographic and Cepheid Xpert CARBA-R Assays among Carbapenem-Resistant Enterobacterales Isolates Associated with Bloodstream Infection. Microbiol Spectr. 2022, 10, e0172821. [Google Scholar] [CrossRef]
- Saito, K.; Mizuno, S.; Nakano, R.; Tanouchi, A.; Mizuno, T.; Nakano, A.; Suzuki, Y.; Kakuta, N.; Yano, H. Evaluation of NG-Test CARBA 5 for the detection of carbapenemase-producing Gram-negative bacilli. J Med Microbiol. 2022, 71. [Google Scholar] [CrossRef]
- Yang X, Wang D, Zhou Q, Nie F, Du H, Pang X, Fan Y, Bai T, Xu Y
Antimicrobial susceptibility testing of Enterobacteriaceae: determination of disk content and Kirby-Bauer breakpoint for ceftazidime/avibactam. BMC Microbiol. 2019, 19, 240. [CrossRef] - European Society of Clinical Microbiology and Infectious Diseases. European Committee of Antimicrobial Susceptibility Testing. EUCAST guideline for the detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance. EUCAST 2023. Version 2.0. www.eucast.org/resistance_mechanisms.
- Jenkins, S.; Ledeboer, N.A.; Westblade, L.F.; et al. Evaluation of NG-Test Carba 5 for Rapid Phenotypic Detection and Differentiation of Five Common Carbapenemase Families: Results of a Multicenter Clinical Evaluation. J Clin Microbiol 2020, 58, e00344-20. [Google Scholar] [CrossRef]
- Bratu, S.; Tolaney, P.; Karumudi, U.; Quale, J.; Mooty, M.; Nichani, S.; Landman, D. Carbapenemase-producing Klebsiella pneumoniae in Brooklyn, NY: molecular epidemiology and in vitro activity of polymyxin B and other agents. J Antimicrob Chemother. 2005, 56, 128–132. [Google Scholar] [CrossRef]
- Ellington, M.J.; Kistler, J.; Livermore, D.M.; Woodford, N. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J Antimicrob Chemother. 2007, 59, 321–322. [Google Scholar] [CrossRef]
- Manchanda, V.; Rai, S.; Gupta, S.; Rautela, R.S.; Chopra, R.; Rawat, D.S.; Verma, N.; Singh, N.P.; Kaur, I.R.; Bhalla, P. Development of TaqMan real-time polymerase chain reaction for the detection of the newly emerging form of carbapenem resistance gene in clinical isolates of Escherichia coli, Klebsiella pneumoniae, and Acinetobacter baumannii. Indian J Med Microbiol. 2011, 29, 249–253. [Google Scholar] [CrossRef]
- Poirel, L.; Potron, A.; Nordmann, P. OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother. 2012, 67, 1597–1606. [Google Scholar] [CrossRef]
- Iovleva, A.; Doi, Y. Carbapenem-Resistant Enterobacteriaceae. Clin Lab Med. 2017, 37, 303–315. [Google Scholar] [CrossRef]
- Paudel, R.; Shrestha, E.; Chapagain, B.; Raj Tiwari, B. Carbapenemase producing Gram negative bacteria: Review of resistance and detection methods. Diagn Microbiol Infect Dis. 2024, 110, 116370. [Google Scholar] [CrossRef] [PubMed]
- Segagni Lusignani, L.; Presterl, E.; Zatorska, B.; Van den Nest, M.; Diab-Elschahawi, M. Infection control and risk factors for acquisition of carbapenemase-producing Enterobacteriaceae. A 5 year (2011-2016) case‒control study. Antimicrob Resist Infect Control. 2020, 9, 18. [Google Scholar] [CrossRef] [PubMed]
- Arum, N.; Ghafur, A.; Kazi, M.; et al. Prevalence of fecal carriage of carbapenemase producing Enterobacteriaceae in healthy Indian subjects from the community. Ind J Med Microbiol. 2022, 40, 374–377. [Google Scholar] [CrossRef] [PubMed]
- Zou, C.; Wei, J.; Shan, B.; Chen, X.; Wang, D.; Niu, S. In vitro activity of ceftazidime-avibactam and aztreonam-avibactam against carbapenem-resistant Enterobacteriaceae isolates collected from three secondary hospitals in southwest china between 2018 and 2019. Infect Drug Resist. 2020, 13, 3563–3568. [Google Scholar] [CrossRef]
- Brkić S, Božić DD, Stojanović N, Bulbuk D, Mihajlo Jovanović, Ćirković I. Carbapenemase-producing Klebsiella pneumoniae in community settings: a cross-sectional study in Belgrade, Serbia. Future Microbiol. 2023, 18, 389–397. [CrossRef]
- Tamma, P.D.; Hsu, A.J. Defining the role of novel β-lactam agents that target carbapenem-resistant gram-negative organisms. J Pediatr Infect Dis Soc. 2019, 8, 251–260. [Google Scholar] [CrossRef]
- Castanheira, M.; Doyle, T.B.; Collingsworth, T.D.; Sader, H.S.; Mendes, R.E. Increasing frequency of OXA-48-producing Enterobacterales worldwide and activity of ceftazidime/avibactam, meropenem/vaborbactam and comparators against these isolates. J Antimicrob Chemother. 2021, 76, 3125–3134. [Google Scholar] [CrossRef]
- E Durante-Mangoni, R Andini, R Zampino Management of carbapenem-resistant Enterobacteriaceae infections Clin Microbiol Infect. 2019, 25, 943–950. [CrossRef]
- Paul, M.; Carrara, E.; Retamar Pet, a.l. European Society of Clinical Microbiology and Infectious Diseases (ESCMID) guidelines for the treatment of infections caused by multidrug-resistant Gram-negative bacilli (endorsed by European society of intensive care medicine). Clin Microbiol Infect 2022, 28, 521–47. [Google Scholar] [CrossRef]
- Tamma PD, Heil EL, Justo JA et al. Infectious Diseases Society of America 2024 guidance on the treatment of antimicrobial-resistant gram-negative infections. Clin Infect Dis 2024, ciae403. [CrossRef]
- Baer D, Azrad M, Saleh N, Peretz A, Detection of Carbapenem-Resistant Enterobacterales in Simulated Blood Culture in 15 Minutes, Life (Basel), 2021 14; 11, 145. [CrossRef]
- Pruss, A.; Skierska, A.; Kwiatkowski, P.; Masiuk, H.; Jursa-Kulesza, J.; Giedrys-Kalemba, S.; Bilska, I.; Sienkiewicz, M.; Melnyk, M.; Dołęgowska, B. Comparative analysis of selected methods of carbapenemase determination among clinical Klebsiella pneumoniae. PLoS One. 2025, 20, e0318852. [Google Scholar] [CrossRef]
- Liu Z, Bai L, Liu J, Lei J, Gao X, Tenover FC, Lei K, Tang Y, Geng Y, He A Parallel Validation of the NG-Test Carba 5 and the Xpert Carba-R for Detection and Characterization of Carbapenem-Resistant Enterobacterales Causing Bloodstream Infections. J Mol Diagn, 2021, 23, 1007–1014. [CrossRef]
- Liu, P.; Qin, M.; Zhao, C.; Yi, S.; Ye, M.; Liao, K.; Deng, J.; Chen, Y. Evaluating the Performance of Two Rapid Immunochromatographic Techniques for Detecting Carbapenemase in Carbapenem-Resistant Enterobacterales Clinical Isolates. Infect Drug Resist. 2025, 18, 1415–1424. [Google Scholar] [CrossRef]
- Zhang, Z.; Wang, D.; Li, Y.; Liu, Y.; Qin, X. Comparison of the performance of phenotypic methods for the detection of carbapenem-resistant enterobacteriaceae (CRE) in clinical practice. Front Cell Infect Microbiol. 2022, 12, 849564. [Google Scholar] [CrossRef]
- Rakovitsky, N.; Lurie-Weinberger, M.N.; Temkin, E.; Hameir, A.; Efrati-Epchtien, R.; Wulffhart, L.; Keren Paz, A.; Schwartz, D.; Carmeli, Y. Evaluation of the CARBA PAcE test, a colorimetric imipenem hydrolysis test for rapid detection of carbapenemase activity. Microbiol Spectr. 2024, 12, e0089124. [Google Scholar] [CrossRef]
- Qin, H.F.; He, J.K.; Chen, X.; Jiang, K.; Cai, X.Y.; Wu, X.N.; Ye, L.; Chen, H.K.; Guo, X.G.; Xia, Y. Evaluation of the NG-Test Carba 5 for the clinical detection of carbapenemase-producing gram-negative bacteria. Front Med (Lausanne). 2025, 12, 1512345. [Google Scholar] [CrossRef]
| Primer | Sequence 5’-3’ | Amplicon size (bp) | Reference |
| blaKPC Fw | ATGTCACTGTATCGCCGTCT | 893 | [20] |
| blaKPC Rw | TTTTCAGAGCCTTACTGCCC | ||
| blaVIM Fw | GATGGTGTTTGGTCGCATA | 390 | [21] |
| blaVIM Rw | CGAATGCGCAGCACCAG | ||
| blaNDM Fw | GGGCAGTCGCTTCCAACGGT | 475 | [22] |
| blaNDM Rw | GTAGTGCTCAGTGTCGGCAT | ||
| blaIMP Fw | GGAATAGAGTGGCTTAATTCTC | 188 | [21] |
| blaIMP Rw | CCAAACCACTACGTTATCT | ||
| blaOXA-48-like Fw | TTGGTGGCATCGATTATCGG | 744 | [23] |
| blaOXA-48-like Rw | GAGCACTTCTTTTGTGATGGC |
| Categories | Frequency | Percent (%) | |
| Specimen | Urine culture | 34 | 10.9 |
| Blood culture | 171 | 54.8 | |
| BALL | 13 | 4.2 | |
| Aspirate | 67 | 21.5 | |
| Kiss swab | 25 | 8.0 | |
| Liquor | 2 | 0.6 | |
| PCR-NDM | Negative | 235 | 75.3 |
| Positive | 77 | 24.7 | |
| PCR-OXA48 | Negative | 102 | 32.7 |
| Positive | 210 | 67.3 | |
| PCR-KPC | Negative | 255 | 81.7 |
| Positive | 57 | 18.3 | |
| PCR-VIM | Negative | 307 | 98.4 |
| Positive | 5 | 1.6 | |
| PCR-IMP | Negative | 312 | 100.0 |
| Positive | 0 | 0.0 | |
| NG-Test Carba5/NDM | Negative | 241 | 77.2 |
| Positive | 71 | 22.8 | |
| NG-Test Carba5/OXA48 | Negative | 108 | 34.6 |
| Positive | 204 | 65.4 | |
| NG-Test Carba5/KPC | Negative | 257 | 82.4 |
| Positive | 55 | 17.6 | |
| NG-Test Carba5/VIM | Negative | 312 | 100.0 |
| Positive | 0 | 0.0 | |
| NG-Test Carba5/IMP | Negative | 312 | 100.0 |
| Positive | 0 | 0.0 | |
| All PCR | Negative | 2 | 0.6 |
| One gene detected | 272 | 87.2 | |
| Two genes detected | 37 | 11.9 | |
| Three genes detected | 1 | 0.3 | |
| All NG-Test Carba5 | Negative | 6 | 1.9 |
| Single carbapenemase detected | 282 | 90.4 | |
| Double carbapenemases detected | 24 | 7.7 | |
| Results by reference methods (n) | NG Carba 5 | |||||||
| TP | FP | TN | FN | Sensitivity (%) | Specificity (%) | Positive predictive value (%) | Negative predictive value (%) | |
| PCR-NDM | 71 | 0 | 235 | 6 | 92.2 | 100.0 | 100.0 | 97.5 |
| PCR-OXA48 | 204 | 0 | 102 | 6 | 97.1 | 100.0 | 100.0 | 94.4 |
| PCR-KPC | 55 | 0 | 255 | 2 | 96.5 | 100.0 | 100.0 | 99.2 |
| PCR-VIM | 0 | 0 | 307 | 5 | / | 100.0 | / | 98.4 |
| PCR-IMP | 0 | 0 | 312 | 0 | / | 100.0 | / | 100.0 |
| ALL PCR | 306 | 0 | 2 | 4 | 98.7 | 100.0 | 100.0 | 66.7 |
| PCR vs. NG-Test Carba 5 | Kappa | p |
| PCR-blaNDM vs. NG Carba 5 NDM | 0.947 | <0.001 |
| PCR-blaOXA48-like vs. NG Carba 5 OXA48-like | 0.957 | <0.001 |
| PCR-blaKPC vs. NG Carba 5 KPC | 0.978 | <0.001 |
| PCR-blaVIM vs. NG Carba 5 VIM | 0.000 | 1.000 |
| PCR-blaIMP vs. NG Carba 5 IMP | / | / |
| ALL blaPCR vs. all NG Carba 5 | 0.495 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).