Submitted:
27 June 2025
Posted:
30 June 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Presence of PLVH in Donor Pigs for Heart Xenotransplantation
2.2. Real-Time PCR-Based Detection of PLHV in Donor Pigs
3. Discussion
4. Materials and Methods
4.1. Animals and Tissue Samples
4.2. Blood Collection
4.3. Isolation of Peripheral Blood Mononuclear Cells (PBMCs)
4.3. DNA Isolation
4.4. PCR and Real-Time PCR
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AlHV-1 | Alcelaphine herpesvirus type 1 |
| DPS | Dippity pig syndrome |
| EBV | Epstein–Barr virus |
| HHV-4, HHV-8 | Human herpesvirus 4, 8 |
| IE | Immediate-early genes |
| KSHV | Kaposi sarcoma-associated herpesvirus |
| NF-κB | Nuclear factor κB |
| NFAT | Nuclear factor of activated T cells |
| OvHV-2 | Ovine herpesvirus type 2 |
| PBMCs | Peripheral blood mononuclear cells |
| PCMV/PRV | Porcine cytomegalovirus, a porcine roseolovirus virus |
| PLHV-1, PLHV-2, PLHV-3 | Porcine lymphotropic herpesviruses -1, -2, and -3 |
| SINE SuHV-1, SuHV-2, SuHV-3, SuHV-4, SuHV-5 |
Short Interspersed Nuclear Elements Suid herpesviruses 1, 2, 3, 4, and 5 |
| vGPCRs | Viral G protein-coupled receptors |
References
- Ali A, Kemter E, Wolf E. Advances in Organ and Tissue Xenotransplantation. Annu Rev Anim Biosci. 2024, 12, 369-390. [CrossRef]
- Fishman JA, Mueller NJ. Infectious Diseases and Clinical Xenotransplantation. Emerg Infect Dis. 2024, 30(7), 1311-1318.
- Griffith BP, Goerlich CE, Singh AK, Rothblatt M, Lau CL, Shah A, Lorber M, Grazioli A, Saharia KK, Hong SN, Joseph SM, Ayares D, Mohiuddin MM. Genetically Modified Porcine-to-Human Cardiac Xenotransplantation. N Engl J Med. 2022, 387(1), 35-44. [CrossRef]
- Ehlers B, Ulrich S, Goltz M. Detection of two novel porcine herpesviruses with high similarity to gammaherpesviruses. J Gen Virol 1999, 80, 971–978. [CrossRef]
- Chmielewicz B, Goltz M, Franz T, Bauer C, Brema S, Ellerbrok H, Beckmann S, Rziha HJ, Lahrmann KH, Romero C, Ehlers B. A novel porcine gammaherpesvirus. Virology 2003, 308, 317–329. [CrossRef]
- Marcaccini, A.; Pena, M.L.; Quiroga, M.I.; Bermudez, R.; Nieto, J.M.; Aleman, N. Pseudorabies virus infection in mink: A host-specific pathogenesis. Vet. Immunol. Immunopathol. 2008, 124, 264–273. [CrossRef]
- Glass, C.M.; McLean, R.G.; Katz, J.B.; Maehr, D.S.; Cropp, C.B.; Kirk, L.J.; McKeirnan, A.J.; Evermann, J.F. Isolation of pseudorabies (Aujeszky’sdisease) virus from a Florida panther. J. Wildl. Dis. 1994, 30, 180–184. [CrossRef]
- Denner, J.; Bigley, T.M.; Phan, T.L.; Zimmermann, C.; Zhou, X.; Kaufer, B.B. Comparative Analysis of Roseoloviruses in Humans, Pigs, Mice, and Other Species. Viruses 2019, 11, 1108.
- Denner, J. Porcine Lymphotropic Herpesviruses (PLHVs) and Xenotranplantation. Viruses 2021, 13, 1072. [CrossRef]
- Mueller, N.J.; Barth, R.N.; Yamamoto, S.; Kitamura, H.; Patience, C.; Yamada, K.; Cooper, D.K.; Sachs, D.H.; Kaur, A.; Fishman, J.A. Activation of cytomegalovirus in pig-to-primate organ xenotransplantation. J. Virol. 2002, 76, 4734–4740. [CrossRef]
- Tucker, A.; McNeill, F.; Meehan, B.; Galbraith, D.; McArdle, P.; Allan, G.; Patience, C. Methods for the exclusion of circoviruses and gammaherpesviruses from pigs. Xenotransplantation 2003, 10, 343–348. [CrossRef]
- Dor, F.J.; Doucette, K.E.; Mueller, N.J.; Wilkinson, R.A.; Bajwa, J.A.; McMorrow, I.M.; Tseng, Y.L.; Kuwaki, K.; Houser, S.L.; Fishman, J.A.; et al. Posttransplant lymphoproliferative disease after allogeneic transplantation of the spleen in miniature swine. Transplantation 2004, 78, 286–291. [CrossRef]
- Doucette, K.; Dor, F.J.;Wilkinson, R.A.; Martin, S.I.; Huang, C.A.; Cooper, D.K.; Sachs, D.H.; Fishman, J.A. Gene expression of porcine lymphotrophic herpesvirus-1 in miniature Swine with posttransplant lymphoproliferative disorder. Transplantation 2007, 83, 87–90. [CrossRef]
- Huang, C.; Fuchimoto, Y.; Gleit, Z.; Ericsson, T.; Griesemer, A.; Scheier-Dolberg, R.; Melendy, E.; Kitamura, H.; Fishman, J.; Ferry, J.; et al. Post-trans-plantation lymphoproliferative disease in miniature swine after allogeneic hematopoietic cell transplantation: Similarity to human PTLD and association with a porcine gammaherpesvirus. Blood 2001, 97, 1467–1473.
- Morozov VA, Plotzki E, Rotem A, Barkai U, Denner J. Extended microbiological characterization of Göttingen minipigs: porcine cytomegalovirus and other viruses. Xenotransplantation. 2016, 23(6), 490-496. [CrossRef]
- Plotzki, E., Keller, M., Ehlers, B. & Denner, J. Immunological methods for the detection of porcine lymphotropic herpesviruses (PLHV). J. Virol. Methods 2016, 233, 72–77. [CrossRef]
- Krüger L, Kristiansen Y, Reuber E, Möller L, Laue M, Reimer C, Denner J. A Comprehensive Strategy for Screening for Xenotransplantation-Relevant Viruses in a Second Isolated Population of Gottingen Minipigs. Viruses. 2019, 12(1), 38. [CrossRef]
- Jhelum H, Grand N, Jacobsen KR, Halecker S, Salerno M, Prate R, Krüger L, Kristiansen Y, Krabben L, Möller L, Laue M, Kaufer B, Kaaber K, Denner J. First virological and pathological study of Gottingen Minipigs with Dippity Pig Syndrome (DPS). PLoS One. 2023, 18(6), e0281521. [CrossRef]
- Plotzki, E.; Heinrichs, G.; Kubícková, B.; Ulrich, R.G.; Denner, J. Microbiological characterization of a newly established pig breed, Aachen Minipigs. Xenotransplantation 2016, 23, 159–167. [CrossRef]
- Halecker S, Metzger J, Strube C, Krabben L, Kaufer B, Denner J. Virological and Parasitological Characterization of Mini-LEWE Minipigs Using Improved Screening Methods and an Overview of Data on Various Minipig Breeds. Microorganisms. 2021, 9(12):2617. [CrossRef]
- Jhelum H, Papatsiros V, Papakonstantinou G, Krabben L, Kaufer B, Denner J. Screening for Viruses in Indigenous Greek Black Pigs. Microorganisms. 2024, 12(2), 315. [CrossRef]
- Halecker S, Papatsiros V, Psalla D, Krabben L, Kaufer B, Denner J. Virological characterization of pigs with erythema multiforme. Microorganisms. 2022, 10(3), 652. [CrossRef]
- Jhelum H, Kaufer B, Denner J. Application of Methods Detecting Xenotransplantation-Relevant Viruses for Screening German Slaughterhouse Pigs. Viruses. 2024, 16(7), 1119. [CrossRef]
- Mueller NJ, Livingston C, Knosalla C, Barth RN, Yamamoto S, Gollackner B, Dor FJ, Buhler L, Sachs DH, Yamada K, Cooper DK, Fishman JA. Activation of porcine cytomegalovirus, but not porcine lymphotropic herpesvirus, in pig-to-baboon xenotransplantation. J Infect Dis. 2004, 189(9), 1628-1633. [CrossRef]
- Cybulski P, Socha W, Jabłoński A, Kondratiuk R, Rybkowska W, Stadejek T, Larska M. First Molecular Detection of Porcine Cytomegalovirus (PCMV) and Porcine Lymphotropic Herpesvirus (PLHV) in Domestic Pigs in Poland. Pathogens. 2025, 14(4), 396. [CrossRef]
- Dall Agnol AM, Leme RA, Suphoronski SA, Oliveira TES, Possatti F, Saporiti V, Headley SA, Alfieri AA, Alfieri AF. Porcine lymphotropic herpesvirus DNA detection in multiple organs of pigs in Brazil. Braz J Microbiol. 2020, 51(4), 2145-2152. [CrossRef]
- Franzo G, Drigo M, Legnardi M, Grassi L, Menandro ML, Pasotto D, Cecchinato M, Tucciarone CM. Porcine Gammaherpesviruses in Italian Commercial Swine Population: Frequent but Harmless. Pathogens. 2021, 10(1), 47. [CrossRef]
- McMahon KJ, Minihan D, Campion EM, Loughran ST, Allan G, McNeilly F, Walls D. Infection of pigs in Ireland with lymphotropic gamma-herpesviruses and relationship to postweaning multisystemic wasting syndrome. Vet Microbiol. 2006, 116(1-3), 60-8. [CrossRef]
- Porto GS, Leme RA, Dall Agnol AM, Souza TCGD, Alfieri AA, Alfieri AF. Porcine lymphotropic herpesvirus (Gammaherpesvirinae) DNA in free-living wild boars (Sus scrofa Linnaeus, 1758) in Brazil. J Vet Sci. 2021, 22(6), e81.
- Brema S, Lindner I, Goltz M, Ehlers B. Development of a recombinant antigen-based ELISA for the sero-detection of porcine lymphotropic herpesviruses. Xenotransplantation. 2008, 15(6), 357-364. [CrossRef]
- Halecker S, Hansen S, Krabben L, Ebner F, Kaufer B, Denner J. How, where and when to screen for porcine cytomegalovirus (PCMV) in donor pigs for xenotransplantation. Sci Rep. 2022, 12(1), 21545. [CrossRef]
- Russell, G.C.; Stewart, J.P.; Haig, D.M. Malignant catarrhal fever: A review. Vet. J. 2009, 179, 324–335. [CrossRef]
- Längin, M., Mayr, T., Reichart, B., Michel, S., Buchholz, S., Guethoff, S., Dashkevich, A., Baehr, A., Egerer, S., Bauer, A., Mihalj, M., Panelli, A., Issl, L., Ying, J., Fresch, A. K., Buttgereit, I., Mokelke, M., Radan, J., Werner, F., Lutzmann, I., Steen, S., Sjöberg, T., Paskevicius, A., Qiuming, L., Sfriso, R., Rieben, R., Dahlhoff, M., Kessler, B., Kemter, E., Klett, K., Hinkel, R., Kupatt, C., Falkenau, A., Reu, S., Ellgass, R., Herzog, R., Binder, U., Wich, G., Skerra, A., Ayares, D., Kind, A., Schönmann, U., Kaup, F. J., Hagl, C., Wolf, E., Klymiuk, N., Brenner, P., Abicht, J. M. Consistent success in life-supporting porcine cardiac xenotransplantation. Nature 2018, 564(7736), 430–433. [CrossRef]
- Denner J, Längin M, Reichart B, Krüger L, Fiebig U, Mokelke M, Radan J, Mayr T, Milusev A, Luther F, Sorvillo N, Rieben R, Brenner P, Walz C, Wolf E, Roshani B, Stahl-Hennig C, Abicht JM. Impact of porcine cytomegalovirus on long-term orthotopic cardiac xenotransplant survival. Sci Rep. 2020, 10(1), 17531. [CrossRef]
- Jhelum H, Papatsiros V, Papakonstantinou G, Krabben L, Kaufer B, Denner J. Screening for Viruses in Indigenous Greek Black Pigs. Microorganisms. 2024, 12(2, :315. [CrossRef]
- Jhelum H, Bender M, Reichart B, Mokelke M, Radan J, Neumann E, Krabben L, Abicht JM, Kaufer B, Längin M, Denner J. Evidence for Microchimerism in Baboon Recipients of Pig Hearts. Viruses. 2023, 15(7), 1618. [CrossRef]
- Fiebig U, Abicht JM, Mayr T, Längin M, Bähr A, Guethoff S, Falkenau A, Wolf E, Reichart B, Shibahara T, Denner J. Distribution of Porcine Cytomegalovirus in Infected Donor Pigs and in Baboon Recipients of Pig Heart Transplantation. Viruses. 2018, 10(2), 66. [CrossRef]
- Yamada, K.; Tasaki, M.; Sekijima, M.; Wilkinson, R.A.; Villani, V.; Moran, S.G.; Cormack, T.A.; Hanekamp, I.M.; Hawley, R.J.; Arn, J.S.; et al. Porcine cytomegalovirus infection is associated with early rejection of kidney grafts in a pig to baboon xenotransplantation model. Transplantation 2014, 98, 411–418. [CrossRef]
- Sekijima, M, Waki, S, Sahara, H, Tasaki, M, Wilkinson, RA, Villani, V, et al. Results of Life-Supporting Galactosyltransferase Knockout Kidneys in Cynomolgus Monkeys Using Two Different Sources of Galactosyltransferase Knockout Swine. Transplantation 2014, 98(4), 419–426. [CrossRef]
- Denner, J. Reduction of the survival time of pig xenotransplants by porcine cytomegalovirus. Virol. J. 2018, 15, 171. [CrossRef]
- Morozov, V.A.; Abicht, J.M.; Reichart, B.; Mayr, T.; Guethoff, S.; Denner, J. Active replication of porcine cytomegalovirus (PCMV) following transplantation of a pig heart into a baboon despite undetected virus in the donor pig. Ann. Virol. Res. 2016, 2, 1018.
- Denner J. How Does a Porcine Herpesvirus, PCMV/PRV, Induce a Xenozoonosis. Int J Mol Sci. 2025, 26(8), 3542. [CrossRef]
- Issa NC, Wilkinson RA, Griesemer A, Cooper DK, Yamada K, Sachs DH, Fishman JA. Absence of replication of porcine endogenous retrovirus and porcine lymphotropic herpesvirus type 1 with prolonged pig cell microchimerism after pig-to-baboon xenotransplantation. J Virol. 2008, 82(24), 12441-12448. [CrossRef]
- Mueller NJ, Kuwaki K, Knosalla C, Dor FJ, Gollackner B, Wilkinson RA, Arn S, Sachs DH, Cooper DK, Fishman JA. Early weaning of piglets fails to exclude porcine lymphotropic herpesvirus. Xenotransplantation. 2005, 12(1), 59-62. [CrossRef]
- Egerer S, Fiebig U, Kessler B, Zakhartchenko V, Kurome M, Reichart B, Kupatt C, Klymiuk N, Wolf E, Denner J, Bähr A. Early weaning completely eliminates porcine cytomegalovirus from a newly established pig donor facility for xenotransplantation. Xenotransplantation. 2018, 25(4, e12449. [CrossRef]
- Goltz M, Ericsson T, Patience C, Huang CA, Noack S, Sachs DH, Ehlers B. Sequence analysis of the genome of porcine lymphotropic herpesvirus 1 and gene expression during posttransplant lymphoproliferative disease of pigs. Virology. 2002, 294(2), 383-393. [CrossRef]
- Rovnak J, Quackenbush SL, Reyes RA, Baines JD, Parrish CR, Casey JW. Detection of a novel bovine lymphotropic herpesvirus. J Virol. 1998, 72(5), 4237-4242. [CrossRef]
- Li H, Keller J, Knowles DP, Crawford TB. Recognition of another member of the malignant catarrhal fever virus group: an endemic gammaherpesvirus in domestic goats. J Gen Virol. 2001, 82(Pt 1), 227-232. [CrossRef]
- Li H, Keller J, Knowles DP, Taus NS, Oaks JL, Crawford TB. Transmission of caprine herpesvirus 2 in domestic goats. Vet Microbiol. 2005, 107(1-2), 23-29. [CrossRef]
- Zhu H, Huang Q, Hu X, Chu W, Zhang J, Jiang L, Yu X, Zhang X, Cheng S. Caprine herpesvirus 2-associated malignant catarrhal fever of captive sika deer (Cervus nippon) in an intensive management system. BMC Vet Res. 2018, 14(1), 38. [CrossRef]
- Ulrich S, Goltz M, Ehlers B. Characterization of the DNA Polymerase Loci of the Novel Porcine Lymphotropic Herpesviruses 1 and 2 in Domestic and Feral Pigs. J Gen Virol 1999, 80 (12), 3199–3205. [CrossRef]
- Krüger L, Böttger J, Huang CA, Denner J. Absence of porcine endogenous retrovirus (PERV) production from pig lymphoma cell lines. Virus Res. 2021, 295, 198286. [CrossRef]
- Allen U, Preiksaitis J; AST Infectious Diseases Community of Practice. Epstein-barr virus and posttransplant lymphoproliferative disorder in solid organ transplant recipients. Am J Transplant. 2009, 9 Suppl 4, S87-96.
- El-Mallawany NK, Rouce RH. EBV and post-transplant lymphoproliferative disorder: a complex relationship. Hematology Am Soc Hematol Educ Program. 2024, 2024(1), 728-735. [CrossRef]
- Lindner, I, Ehlers, B, Noack, S, Dural, G, Yasmum, N, Bauer, C, and Goltz, M. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression. Virology 2007, 357(2), 134-148. [CrossRef]
- Zuo J, Currin A, Griffin BD, Shannon-Lowe C, Thomas WA, Ressing ME, et al. The Epstein-Barr Virus G-Protein-Coupled Receptor Contributes to Immune Evasion by Targeting MHC Class I Molecules for Degradation. PloS Pathog 2009, 5(1), e1000255. [CrossRef]
- Zuo J, Quinn LL, Tamblyn J, Thomas WA, Feederle R, Delecluse HJ, et al. The Epstein-Barr Virus-Encoded BILF1 Protein Modulates Immune Recognition of Endogenously Processed Antigen by Targeting Major Histocompatibility Complex Class I Molecules Trafficking on Both the Exocytic and Endocytic Pathways. J Virol 2011, 85(4), 1604–1614. [CrossRef]
- Griffin BD, Gram AM, Mulder A, Van Leeuwen D, Claas FH, Wang F, et al. EBV BILF1 Evolved to Downregulate Cell Surface Display of a Wide Range of HLA Class I Molecules Through Their Cytoplasmic Tail. J Immunol 2013, 190(4), 1672–1684. [CrossRef]
- Quinn LL, Zuo J, Abbott RJ, Shannon-Lowe C, Tierney RJ, Hislop AD, et al. Cooperation Between Epstein-Barr Virus Immune Evasion Proteins Spreads Protection From CD8+ T Cell Recognition Across All Three Phases of the Lytic Cycle. PloS Pathog 2014, 10(8), e1004322. [CrossRef]
- Paulsen SJ, Rosenkilde MM, Eugen-Olsen J, Kledal TN. Epstein-Barr Virus-Encoded BILF1 is a Constitutively Active G Protein-Coupled Receptor. J Virol 2005, 79(1), 536–546. [CrossRef]
- Lyngaa R, Norregaard K, Kristensen M, Kubale V, Rosenkilde MM, Kledal TN. Cell Transformation Mediated by the Epstein-Barr Virus G Protein-Coupled Receptor BILF1 is Dependent on Constitutive Signaling. Oncogene 2010, 29(31), 4388–4398. [CrossRef]
- Mavri M, Kubale V, Depledge DP, Zuo J, Huang CA, Breuer J, Vrecl M, Jarvis MA, Jovičić EJ, Petan T, Ehlers B, Rosenkilde MM, Spiess K. Epstein-Barr Virus-Encoded BILF1 Orthologues From Porcine Lymphotropic Herpesviruses Display Common Molecular Functionality. Front Endocrinol (Lausanne). 2022, 13, 862940. [CrossRef]
- Santoni F, Lindner I, Caselli E, Goltz M, Di Luca D, Ehlers B. Molecular interactions between porcine and human gammaherpesviruses: implications for xenografts? Xenotransplantation. 2006, 13(4), 308-317. [CrossRef]
- Ehlers, B. (Robert Koch Institute, Berlin, Germany). 2002. Unpublished work.
- Duvigneau, J.; Hartl, R.; Groiss, S.; Gemeiner, M. Quantitative simultaneous multiplex real-time PCR for the detection of porcine cytokines. J. Immunol. Methods 2005, 306, 16–27. [CrossRef]
- Behrendt R, Fiebig U, Norley S, Gürtler L, Kurth R, Denner J. A Neutralization Assay for HIV-2 Based on Measurement of Provirus Integration by Duplex Real-Time PCR. J Virol Methods 2009, 159, 40–46. [CrossRef]
- Walker, J.A.; Hughes, D.A.; Anders, B.A.; Shewale, J.; Sinha, S.K.; Batzer, M.A. Quantitative intra-short interspersed element PCR for species-specific DNA identification. Anal. Biochem. 2003, 316, 259–269. [CrossRef]
| Pig breed | Detection of virus using real-time PCR | Western blot analysis | Reference | ||
|---|---|---|---|---|---|
| PLHV-1 | PLHV-2 | PLHV-3 | |||
| Number of positive animals / number of tested animals | |||||
| Göttingen minipigs 1 | 0/10 (0%) | 0/10 (0%) | 0/10 (0%) | 1/10 (0%) | Morozov et al., 2016 [15] |
| Göttingen minipigs 2 | 0/10 (0%) | 0/10 (0%) | 0/10 (0%) | 0/10 (0%) | Plotzki et al., 2016 [16] |
| Göttingen minipigs 3 | 2/11 (18%) | 2/11 (18%) | 2/11 (18%) | n.t. | Krüger et al., 2019 [17] |
| Göttingen minipigs with DPSa | 0/7 (0%) | 0/7 (0%) | 1/4 (25%) | n.t. | Jhelum et al., 2023 [18] |
| Aachen minipigs | 0/18 (0%) | 5/18 (28%) | 2/18 (16%) | 0/10 (0%) | Plotzki et al., 2016 [19] |
| Mini LEWE | 0/10 (0%) | 0/10 (0%) | 0/10 (0%) | n.t. | Halecker et al., 2021 [20] |
| Indigenous Greek black pigs | 12/21 (57%) | 15/21 (71%) | 21/21 (100%) | n.t. | Jhelum et al., 2024 [21] |
| Greek pigs with erythema multiforme | 5/5 (100%) | 1/5 (20%) | 4/5 (80%) | n.t. | Halecker et al., 2022 [22] |
| German slaughterhouse pigs 1 | 2/36 (6%) | 0/36 (0%) | 10/36 (28%) | 7/36 (19%) | Plotzki et al., 2016 [16] |
| German slaughterhouse pigs 2 | 10/10 (100%) | 0/10 (0%) | 10/10 (100%) | n.t. | Jhelum et al., 2024 [23] |
| Large White x Landrace | 12/22 (55%) | 2/22 (9%) | n.t. | n.t. | Mueller et al., 2004 [24] |
| Farm animals, Poland | 11/45 (24%) | n.t. | n.t. | n.t. | Cybulski et al. 2025 [25] |
| Farm animals, Brazil | 12/19 (63%) | n.t. | n.t. | n.t. | Dall Agnol et al., 2020 [26] |
| Italien pigs | 50/168 (30%) | 19/168 (11%) | 7/168 (7%) | n.t. | Franzo et al., 2021 [27] |
| German pigs, lung spleen Italien pigs, blood |
21/27 (78%) 20/34 (59%) 16/20 (80%) |
11/27 (41% 9/34 (26%) 4/29 (20%) |
16/27 (59%) 21/34 (62%) 13/20 (65%) |
n.t. | Chmielewicz et al., 2003 [5] |
| Farm pigs, Ireland | 25/32 (78%) | 7/32 (22%) | 37/65 (60%) | n.t. | McMahon et al., 2006 [28] |
| Wild boars, Brazil | 48/50 (96%) | 28/50 (56%) | 22/50 (44%) | n.t. | Porto et al., 2021 [29] |
| Animal | ID number | Transplant survival days | PCMV/PRV real-time PCR |
PLHV-1, -2 PCR |
PLHV-3 PCR |
|---|---|---|---|---|---|
| Pig 5528 | - | ++ | - | ||
| Baboon J | 17186 | 90 | - | - | - |
| Pig 5415 | - | +++ | - | ||
| Baboon K | 17187 | 50 | - | - | - |
| Pig 5420 | - | +++ | - | ||
| Baboon L | 17290 | 90 | - | - | - |
| Pig 5623 | ++ | + | - | ||
| Baboon M | 17188 | 10 | ++ | - | - |
| Pig 5803 | - | +++ | - | ||
| Baboon O | 17493 | 195 | - | - | - |
| Pig 5807 | - | +++ | - | ||
| Baboon N | 17491 | 182 | - | - | - |
| Pig 6249 | ++ | +++ | - | ||
| Baboon P | 17494 | 15 | +++ | - | - |
| Pig 6253 | + | ++ | - | ||
| Baboon Q | 17492 | 27 | ++ | - | - |
| Animal | Organ tested |
PCMV/PRV real-time PCR ct |
PLHV-1 | PLHV-2 | PLHV-3 | SINE | ||||
|---|---|---|---|---|---|---|---|---|---|---|
| real-time PCR ct |
copy number | real-time PCR ct |
copy number | real-time PCR ct |
copy number | real-time PCR ct |
copy number | |||
| Pig 7649 | Spleen | n.d. | n.d | n.d | n.d | n.t. | ||||
| Liver | n.d | n.d | n.d | n.d | n.t. | |||||
| Baboon A | Spleen | n.d | n.d | n.d | n.d | 16.86 | 106 | |||
| Liver | n.d | n.d | n.d | n.d | 23.12 | 104 | ||||
| RVa | n.d | n.d | n.d | n.d | 28.48 | 103 | ||||
| LVb | n.d | n.d | n.d | n.d | 28.00 | 103 | ||||
| Pig 7654 | Spleen | n.d | n.d | 26.38 | 103 | n.d | n.t. | |||
| Liver | n.d | n.d | 26.94 | 103 | n.d | n.t. | ||||
| Baboon B | RV | n.d | n.d | n.d | n.d | 7.05 | 1010 | |||
| LV | n.d | n.d | n.d. | n.d | 7.06 | 1010 | ||||
| Pig 7687 | Spleen | n.d | 27.51 | 103 | n.d | 35.13 | 101 | n.t. | ||
| Liver | n.d | 28.51 | 102 | n.d | 35.17 | 101 | n.t. | |||
| Baboon C | Spleen | n.d | n.d | n.d | n.d | 19.55 | 106 | |||
| Liver | n.d | n.d | n.d | n.d | 20.64 | 105 | ||||
| RV | n.d | n.d | n.d | n.d | 7.2 | 1010 | ||||
| LV | n.d | n.d | n.d | n.d | 6.54 | 1010 | ||||
| Primers Used for PCR | Sequence 5′-3′ | Nucleotide Position | Accession Number | Reference |
|---|---|---|---|---|
| Primers used for PCR | ||||
| PLHV-1,-2 (747) fw PLHV-1,-2 (747) rev |
CAYGGTAGTATTTATTCAGACA GATATCCTGGTACATTGGAAAG |
21,146–21,167 21,488–21,467 |
AF478169.1 | Ehlers B., 2002 [64] |
| PLHV-3 (905) fw PLHV-3 (905) rev |
ACAAGAGCCTTAGGGTTCCAAACT GTGTCCAGTGTTGTAATGGATGCC |
13,472–13,495 13,727–13,704 |
AY170316.1 | Chmielewicz et al., 2003 [5] |
| Primers and probes used for real-time PCR | ||||
| pGAPDH fw pGAPDH rev pGAPDH probe |
ACATGGCCTCCAAGGAGTAAGA GATCGAGTTGGGGCTGTGACT HEX-CCACCAACCCCAGCAAGAGCACGC-BHQ1 |
1083–1104 1188-–1168 1114–1137 |
NM_001206359.1 | Duvigneau et al., 2005 [65] |
| hGAPDH fw hGAPDH rev hGAPDH probe |
GGCGATGCTGGCGCTGAGTAC TGGTTCACACCCATGACGA HEX-CTTCACCACCATGGAGAAGGCTGGG-BHQ1 |
3568–3587 3803–3783 3655–3678 |
AF261085 | Behrendt et al., 2009 [66] |
| PCMV/PRV fw PCMV/PRV rev PCMV/PRV probe |
ACTTCGTCGCAGCTCATCTGA GTTCTGGGATTCCGAGGTTG 6FAM-CAGGGCGGCGGTCGAGCTC-BHQ! |
45206 – 45226 45268 – 45249 45247 - 45229 |
AF268039 | Mueller et al., 2002 [10] |
| PLHV-1 (1125) fw PLHV-1 rev PLHV-1 probe |
CTC ACC TCC AAA TAC AGC GA GCT TGA ATC GTG TGT TCC ATA G 6FAM-CTG GTC TAC TGA ATC GCC GCT AAC AG-TAMR |
14808-14827 14880-14859 14829-14854 |
AF478169 | Chmielewicz et al., 2003 [5 |
| PLHV-2 (1155) fw PLHV-2 rev PLHV-2 probe |
GTC ACC TGC AAA TAC ACA GG GGC TTG AAT CGT ATG TTC CAT AT 6FAM-CTG GTC TAC TGA AGC GCT GCC AAT AG-TAMRA |
10814-10833 10887-10865 10835-10860 |
AY170314 | Chmielewicz et al., 2003 [5] |
| PLHV-3 /210s) fw PLHV-3 (210as) rev PLHV-3 (210) probe |
AAC AGC GCC AGA AAA AAA GG GGA AAG GTA GAA GGT GAA CCA TAA AA 6-FAM CCA AAG AGG AAA ATC-MGB |
11999-12018 12064-12039 12022-12036 |
AY170315.1 |
McMahon et al., 2006 [28] |
| PRE-1 fwd PRE-1 rev PRE-1 probe |
5‘ GACTAGGAACCATGAGGTTGCG 3′ 5′ AGCCTACACCACAGCCACAG 3′ 5′ FAM-TTTGATCCCTGGCCTTGCTCAGTGG-BHQ1 3′ |
37–58 61–85 151–170 |
Y00104 | Walker et al., 2003 [67] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).