Submitted:
26 March 2025
Posted:
27 March 2025
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Maintenance
2.2. Sample Processing for Transmission Electron Microscopy (TEM)
2.3. Cellular Calcification Induction
2.4. Cell Lysis and Intracellular Calcium Quantification
2.5. Immunofluorescence Analysis (ORDINE Nr.5)
2.6. Total RNA Extraction, Quantification, and Quality Assessment, cDNA Synthesis
2.7. Real-Time qPCR Analysis
2.8. Statistical Analysis
3. Results and Discussion
3.1. Confocal Imaging Reveals Morphological Changes During VSMCs Phenotypic Switch
3.2. Transmission Electron Microscopy Images Allow to Look Deeply Inside Vascular Smooth Cells
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| α-SMA BSA CAL CON DMEM FBS GAPDH HCASMCs LSCM PBS RER RUNX-2 SYN TEM VSMCs |
alpha-Smooth Muscle Actin Bovine Serum Albumin Calcified Contractile Dulbecco's Modified Eagle Medium Fetal Bovine Serum Glyceraldehyde-3-Phosphate Dehydrogenase Human Coronary Artery Smooth Muscle Cells Scanning Confocal Microscopy Phosphate-Buffered Saline Rough Endoplasmic Reticulum Runt-Related Transcription Factor 2 Synthetic Transmission Electron Microscopy Vascular Smooth Muscle Cells |
References
- Libby, P. Inflammation in Atherosclerosis. Nature 2002, 420, 868–874. [Google Scholar] [CrossRef]
- Ross, R. Atherosclerosis — An Inflammatory Disease. N Engl J Med 1999, 340, 115–126. [Google Scholar] [CrossRef] [PubMed]
- Cao, G.; Xuan, X.; Hu, J.; Zhang, R.; Jin, H.; Dong, H. How Vascular Smooth Muscle Cell Phenotype Switching Contributes to Vascular Disease. Cell Commun Signal 2022, 20, 180. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.; McVey, D.G.; Shen, D.; Huang, X.; Ye, S. Phenotypic Switching of Vascular Smooth Muscle Cells in Atherosclerosis. J Am Heart Assoc 2023, 12, e031121. [Google Scholar] [CrossRef] [PubMed]
- Gomez, D.; Owens, G.K. Smooth Muscle Cell Phenotypic Switching in Atherosclerosis. Cardiovasc Res 2012, 95, 156–164. [Google Scholar] [CrossRef]
- Petsophonsakul, P.; Furmanik, M.; Forsythe, R.; Dweck, M.; Schurink, G.W.; Natour, E.; Reutelingsperger, C.; Jacobs, M.; Mees, B.; Schurgers, L. Role of Vascular Smooth Muscle Cell Phenotypic Switching and Calcification in Aortic Aneurysm Formation. Arterioscler Thromb Vasc Biol 2019, 39, 1351–1368. [Google Scholar] [CrossRef]
- Zhang, F.; Guo, X.; Xia, Y.; Mao, L. An Update on the Phenotypic Switching of Vascular Smooth Muscle Cells in the Pathogenesis of Atherosclerosis. Cell. Mol. Life Sci. 2022, 79, 6. [Google Scholar] [CrossRef]
- Bochaton-Piallat, M.-L.; Ropraz, P.; Gabbiani, F.; Gabbiani, G. Phenotypic Heterogeneity of Rat Arterial Smooth Muscle Cell Clones: Implications for the Development of Experimental Intimal Thickening. ATVB 1996, 16, 815–820. [Google Scholar] [CrossRef]
- Worth, N.F.; Rolfe, B.E.; Song, J.; Campbell, G.R. Vascular Smooth Muscle Cell Phenotypic Modulation in Culture Is Associated with Reorganisation of Contractile and Cytoskeletal Proteins. Cell Motil. Cytoskeleton 2001, 49, 130–145. [Google Scholar] [CrossRef]
- Reutelingsperger, C.; Schurgers, L. Coronary Artery Calcification. JACC: Cardiovascular Imaging 2018, 11, 1324–1326. [Google Scholar] [CrossRef]
- Shioi, A.; Ikari, Y. Plaque Calcification During Atherosclerosis Progression and Regression. J Atheroscler Thromb 2018, 25, 294–303. [Google Scholar] [CrossRef] [PubMed]
- Bobryshev, Y.V. Transdifferentiation of Smooth Muscle Cells into Chondrocytes in Atherosclerotic Arteries in Situ : Implications for Diffuse Intimal Calcification. The Journal of Pathology 2005, 205, 641–650. [Google Scholar] [CrossRef]
- Durham, A.L.; Speer, M.Y.; Scatena, M.; Giachelli, C.M.; Shanahan, C.M. Role of Smooth Muscle Cells in Vascular Calcification: Implications in Atherosclerosis and Arterial Stiffness. Cardiovascular Research 2018, 114, 590–600. [Google Scholar] [CrossRef]
- Tyson, K.L.; Reynolds, J.L.; McNair, R.; Zhang, Q.; Weissberg, P.L.; Shanahan, C.M. Osteo/Chondrocytic Transcription Factors and Their Target Genes Exhibit Distinct Patterns of Expression in Human Arterial Calcification. ATVB 2003, 23, 489–494. [Google Scholar] [CrossRef]
- Shanahan, C.M.; Crouthamel, M.H.; Kapustin, A.; Giachelli, C.M. Arterial Calcification in Chronic Kidney Disease: Key Roles for Calcium and Phosphate. Circ Res 2011, 109, 697–711. [Google Scholar] [CrossRef]
- Ceccherini, E.; Gisone, I.; Persiani, E.; Ippolito, C.; Falleni, A.; Cecchettini, A.; Vozzi, F. Novel in Vitro Evidence on the Beneficial Effect of Quercetin Treatment in Vascular Calcification. Front. Pharmacol. 2024, 15, 1330374. [Google Scholar] [CrossRef] [PubMed]
- Pugliese, G.; Iacobini, C.; Fantauzzi, C.B.; Menini, S. The Dark and Bright Side of Atherosclerotic Calcification. Atherosclerosis 2015, 238, 220–230. [Google Scholar] [CrossRef] [PubMed]
- Tian, L.; Chen, K.; Cao, J.; Han, Z.; Wang, Y.; Gao, L.; Fan, Y.; Wang, C. Galectin-3 Induces the Phenotype Transformation of Human Vascular Smooth Muscle Cells via the Canonical Wnt Signaling. Molecular Medicine Reports 2017, 15, 3840–3846. [Google Scholar] [CrossRef]
- Alencar, G.F.; Owsiany, K.M.; Karnewar, S.; Sukhavasi, K.; Mocci, G.; Nguyen, A.T.; Williams, C.M.; Shamsuzzaman, S.; Mokry, M.; Henderson, C.A.; et al. Stem Cell Pluripotency Genes Klf4 and Oct4 Regulate Complex SMC Phenotypic Changes Critical in Late-Stage Atherosclerotic Lesion Pathogenesis. Circulation 2020, 142, 2045–2059. [Google Scholar] [CrossRef]
- Poliseno, L.; Cecchettini, A.; Mariani, L.; Evangelista, M.; Ricci, F.; Giorgi, F.; Citti, L.; Rainaldi, G. Resting Smooth Muscle Cells as a Model for Studying Vascular Cell Activation. Tissue and Cell 2006, 38, 111–120. [Google Scholar] [CrossRef]
- Persiani, E.; Ceccherini, E.; Gisone, I.; Cecchettini, A.; Vozzi, F. Protocol to Generate an in Vitro Model to Study Vascular Calcification Using Human Endothelial and Smooth Muscle Cells. STAR Protocols 2023, 4, 102328. [Google Scholar] [CrossRef]
- Ceccherini, E.; Persiani, E.; Cabiati, M.; Guiducci, L.; Del Ry, S.; Gisone, I.; Falleni, A.; Cecchettini, A.; Vozzi, F. A Dynamic Cellular Model as an Emerging Platform to Reproduce the Complexity of Human Vascular Calcification In Vitro. IJMS 2024, 25, 7427. [Google Scholar] [CrossRef]
- Ni, D.; Mo, Z.; Yi, G. Recent Insights into Atherosclerotic Plaque Cell Autophagy. Exp Biol Med (Maywood) 2021, 246, 2553–2558. [Google Scholar] [CrossRef]
- Zheng, Y.; Tian, C.; Meng, Y.; Qin, Y.; Du, Y.; Du, J.; Li, H. Osteopontin Stimulates Autophagy via Integrin/CD44 and P38 MAPK Signaling Pathways in Vascular Smooth Muscle Cells. Journal Cellular Physiology 2012, 227, 127–135. [Google Scholar] [CrossRef]
- García-Miguel, M.; Riquelme, J.A.; Norambuena-Soto, I.; Morales, P.E.; Sanhueza-Olivares, F.; Nuñez-Soto, C.; Mondaca-Ruff, D.; Cancino-Arenas, N.; San Martín, A.; Chiong, M. Autophagy Mediates Tumor Necrosis Factor-α-Induced Phenotype Switching in Vascular Smooth Muscle A7r5 Cell Line. PLoS ONE 2018, 13, e0197210. [Google Scholar] [CrossRef] [PubMed]
- Rattazzi, M.; Bennett, B.J.; Bea, F.; Kirk, E.A.; Ricks, J.L.; Speer, M.; Schwartz, S.M.; Giachelli, C.M.; Rosenfeld, M.E. Calcification of Advanced Atherosclerotic Lesions in the Innominate Arteries of ApoE-Deficient Mice: Potential Role of Chondrocyte-Like Cells. ATVB 2005, 25, 1420–1425. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; Lee, I.-K.; Jeon, J.-H. Vascular Calcification-New Insights Into Its Mechanism. Int J Mol Sci 2020, 21, 2685. [Google Scholar] [CrossRef]
- Speer, M.Y.; Yang, H.-Y.; Brabb, T.; Leaf, E.; Look, A.; Lin, W.-L.; Frutkin, A.; Dichek, D.; Giachelli, C.M. Smooth Muscle Cells Give Rise to Osteochondrogenic Precursors and Chondrocytes in Calcifying Arteries. Circulation Research 2009, 104, 733–741. [Google Scholar] [CrossRef]







| Gene | Primer sequence (5’ – 3’) |
|---|---|
| GAPDH | FWD: ACATCGCTCAGACACCATGG REV: GACGGTGCCATGGAATTTGC |
| RUNX2 | FWD: GATTCTTAACCAACCAGCCTTACC REV: AGTGATGTCATTCTGCTCCTCTAA |
| α-SMA | FWD: AGAGTTACGAGTTGCCTGATG REV: GATGAAGGATGGCTGGAACA |
| Galectin-3 | FWD: GCCACTGATTGTGCCTTATT REV: CCGTGCCCAGAATTGTTAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).