Submitted:
17 March 2025
Posted:
18 March 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Design and Optimization of a New Molecular Method for Detection and Quantification of HAZV Genomic Material
2.2. Cell Lines
2.2.1. Tick Cells
2.2.2. Mammalian Cells
2.3. HAZV Virus
2.3.1. Production
2.3.2. Quantification
2.4. Infection of Tick Cell Lines
2.5. Cell Viability Assay Using Trypan Blue
2.6. RNA Extraction
2.7. DNA Extraction
2.8. Reverse Transcription Quantitative PCR (RT-qPCR)
2.9. Conventional PCR for the Detection of vDNAs
2.10. Electrophoresis
2.11. Treatment of Tick Cells with AZT
2.12. Data Analysis
3. Results
3.1. Optimization of the Molecular Method to Detect and Quantify HAZV
3.2. Tick Cell Lines (HLE/LULS42, HAE/CTVM9 and ISE6) Infection with HAZV
3.3. The Development of a Persistent HAZV Infection in HLE/LULS42
3.4. Detection of HAZV-Derived DNA Forms in HLE/LULS42 Cells
3.4.1. Cellular Localization of vDNAs in the Nucleus and Cytoplasm
3.5. The Effect of vDNAs on the Establishment of Persistent Infections in HLE/LULS42
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgements
Conflicts of Interest
Abbreviations
| RT-qPCR | Quantitative reverse transcription polymerase chain reaction |
| DNA | Deoxyribonucleic acid |
| RNA | Ribonucleic acid |
| MOI | Multiplicity of infection |
References
- Hawman, D.W.; Feldmann, H. Crimean–Congo haemorrhagic fever virus. Nat. Rev. Microbiol. 2023, 21, 463–477. [Google Scholar] [CrossRef] [PubMed]
- Power, G.M.; Vaughan, A.M.; Qiao, L.; Clemente, N.S.; Pescarini, J.M.; Paixão, E.S.; et al. Socioeconomic risk markers of arthropod-borne virus (arbovirus) infections: A systematic literature review and meta-analysis. BMJ Glob. Health 2022, 7. [Google Scholar] [CrossRef] [PubMed]
- Esser, H.J.; Mögling, R.; Cleton, N.B.; Van Der Jeugd, H.; Sprong, H.; Stroo, A.; et al. Risk factors associated with sustained circulation of six zoonotic arboviruses: A systematic review for selection of surveillance sites in non-endemic areas. Parasit. Vectors 2019, 12. [Google Scholar] [CrossRef] [PubMed]
- Fuller, J.; Surtees, R.A.; Shaw, A.B.; Álvarez-Rodríguez, B.; Slack, G.S.; Bell-Sakyi, L.; et al. Hazara nairovirus elicits differential induction of apoptosis and nucleocapsid protein cleavage in mammalian and tick cells. J. Gen. Virol. 2019, 100, 392–402. [Google Scholar] [CrossRef]
- Monteil, V.; Salata, C.; Appelberg, S.; Mirazimi, A. Hazara virus and Crimean-Congo Hemorrhagic Fever Virus show a different pattern of entry in fully-polarized Caco-2 cell line. PLoS Negl. Trop. Dis. 2020, 14, e0008863. [Google Scholar] [CrossRef]
- Fuller, J.; Surtees, R.A.; Slack, G.S.; Mankouri, J.; Hewson, R.; Barr, J.N. Rescue of Infectious Recombinant Hazara Nairovirus from cDNA Reveals the Nucleocapsid Protein DQVD Caspase Cleavage Motif Performs an Essential Role other than Cleavage. J. Virol. 2019, 93. [Google Scholar] [CrossRef]
- Carter, S.D.; Surtees, R.; Walter, C.T.; Ariza, A.; Bergeron, É.; Nichol, S.T.; et al. Structure, Function, and Evolution of the Crimean-Congo Hemorrhagic Fever Virus Nucleocapsid Protein. J. Virol. 2012, 86, 10914–10923. [Google Scholar] [CrossRef]
- Surtees, R.; Dowall, S.D.; Shaw, A.; Armstrong, S.; Hewson, R.; Carroll, M.W.; et al. Heat Shock Protein 70 Family Members Interact with Crimean-Congo Hemorrhagic Fever Virus and Hazara Virus Nucleocapsid Proteins and Perform a Functional Role in the Nairovirus Replication Cycle. J. Virol. 2016, 90, 9305–9316. [Google Scholar] [CrossRef]
- Matsumoto, Y.; Nouchi, T.; Ohta, K.; Nishio, M. Regulation of Hazara virus growth through apoptosis inhibition by viral nucleoprotein. Arch. Virol. 2019, 164, 1597–1607. [Google Scholar] [CrossRef]
- Dowall, S.D.; Findlay-Wilson, S.; Rayner, E.; Pearson, G.; Pickersgill, J.; Rule, A.; et al. Hazara virus infection is lethal for adult type I interferon receptor-knockout mice and may act as a surrogate for infection with the human-pathogenic Crimean–Congo hemorrhagic fever virus. J. Gen. Virol. 2012, 93, 560–564. [Google Scholar] [CrossRef]
- Young, P.R.; Ng, L.F.; Hall, R.A.; Smith, D.W.; Johansen, C.A. Arbovirus infections. In Manson’s Tropical Diseases, 2nd ed.; Farrar, J., Hotez, P.J., Junghanss, T., Kang, G., Lalloo, D., White, N.J., Eds.; Elsevier: London, UK, 2014; pp. 129–161. [Google Scholar]
- Adelman, Z.N.; Miller, D.M.; Myles, K.M. Bed Bugs and Infectious Disease: A Case for the Arboviruses. PLoS Pathog. 2013, 9, e1003478. [Google Scholar] [CrossRef] [PubMed]
- Weaver, S.C.; Brault, A.C.; Kang, W.; Holland, J.J. Genetic and Fitness Changes Accompanying Adaptation of an Arbovirus to Vertebrate and Invertebrate Cells. J. Virol. 1999, 73, 4316–4326. [Google Scholar] [CrossRef]
- Kuno, G.; Chang, G.J.J. Biological transmission of arboviruses: Reexamination of and new insights into components, mechanisms, and unique traits as well as their evolutionary trends. Clin. Microbiol. Rev. 2005, 18, 608–637. [Google Scholar] [CrossRef] [PubMed]
- Conway, M.J.; Colpitts, T.M.; Fikrig, E. Role of the vector in arbovirus transmission. Annu. Rev. Virol. 2014, 1, 71–88. [Google Scholar] [CrossRef] [PubMed]
- Salvati, M.V.; Salaris, C.; Monteil, V.; Del Vecchio, C.; Palù, G.; Parolin, C.; et al. Virus-Derived DNA Forms Mediate the Persistent Infection of Tick Cells by Hazara Virus and Crimean-Congo Hemorrhagic Fever Virus. J. Virol. 2021, 95. [Google Scholar] [CrossRef]
- Uddin, M.M.; Suzuki, Y.; Reyes, J.I.L.; Watanabe, K. In vitro characterization of cell-fusing agent virus DNA forms in Aedes aegypti mosquitoes. Emerg. Microbes Infect. 2023, 12, 1234–1241. [Google Scholar] [CrossRef]
- Houé, V.; Bonizzoni, M.; Failloux, A.B. Endogenous non-retroviral elements in genomes of Aedes mosquitoes and vector competence. Emerg. Microbes Infect. 2019, 8, 542–555. [Google Scholar] [CrossRef]
- Papa, A.; Tsergouli, K.; Tsioka, K.; Mirazimi, A. Crimean-Congo hemorrhagic fever: Tick-host-virus interactions. Front. Cell. Infect. Microbiol. 2017, 7. [Google Scholar] [CrossRef]
- Holmes, E.C. The Evolution of Endogenous Viral Elements. Cell Host Microbe 2011, 10, 368–377. [Google Scholar] [CrossRef]
- Poirier, E.Z.; Goic, B.; Tomé-Poderti, L.; Frangeul, L.; Boussier, J.; Gausson, V.; et al. Dicer-2-Dependent Generation of Viral DNA from Defective Genomes of RNA Viruses Modulates Antiviral Immunity in Insects. Cell Host Microbe 2018, 23, 353–365.e8. [Google Scholar] [CrossRef]
- Nag, D.K.; Brecher, M.; Kramer, L.D. DNA forms of arboviral RNA genomes are generated following infection in mosquito cell cultures. Virology 2016, 498, 164–171. [Google Scholar] [CrossRef] [PubMed]
- Goic, B.; Vodovar, N.; Mondotte, J.A.; Monot, C.; Frangeul, L.; Blanc, H.; et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nat. Immunol. 2013, 14, 396–403. [Google Scholar] [CrossRef]
- Tassetto, M.; Kunitomi, M.; Whitfield, Z.J.; Dolan, P.T.; Sánchez-Vargas, I.; Garcia-Knight, M.; et al. Control of RNA viruses in mosquito cells through the acquisition of vDNA and endogenous viral elements. eLife 2019, 8. [Google Scholar]
- Bell-Sakyi, L.; Attoui, H. Article Commentary: Virus Discovery Using Tick Cell Lines. Evol. Bioinform. 2016, 12, EBO.S39675. [Google Scholar] [CrossRef]
- Olson, K.E.; Bonizzoni, M. Nonretroviral integrated RNA viruses in arthropod vectors: an occasional event or something more? Curr. Opin. Insect Sci. 2017, 22, 45–53. [Google Scholar] [CrossRef]
- Russo, A.G.; Kelly, A.G.; Enosi Tuipulotu, D.; Tanaka, M.M.; White, P.A. Novel insights into endogenous RNA viral elements in Ixodes scapularis and other arbovirus vector genomes. Virus Evol. 2019, 5. [Google Scholar] [CrossRef]
- Munderloh, U.G.; Kurtti, T.J. Formulation of Medium for Tick Cell Culture. Exp. Appl. Acarol. 1989, 7, 219–229. [Google Scholar] [CrossRef]
- Uddin, M.M.; Suzuki, Y.; Reyes, J.I.L.; Watanabe, K. In vitro characterization of cell-fusing agent virus DNA forms in Aedes aegypti mosquitoes. Virology 2024, 591. [Google Scholar] [CrossRef]
- Logan, T.M.; Linthicum, K.J.; Bailey, C.L.; Watts, D.M.; Dohm, D.J.; Moulton, J.R. Replication of Crimean-Congo Hemorrhagic Fever Virus in Four Species of Ixodid Ticks (Acari) Infected Experimentally. J. Med. Entomol. 1990, 27, 537–542. [Google Scholar] [CrossRef]
- Salata, C.; Monteil, V.; Karlberg, H.; Celestino, M.; Devignot, S.; Leijon, M.; Mirazimi, A. The DEVD motif of Crimean-Congo hemorrhagic fever virus nucleoprotein is essential for viral replication in tick cells. Emerg. Microbes Infect. 2018, 7, 192. [Google Scholar] [CrossRef]
- Fuller J, Surtees RA, Slack GS, Mankouri J, Hewson R, Barr JN. Rescue of Infectious Recombinant Hazara Nairovirus from cDNA Reveals the Nucleocapsid Protein DQVD Caspase Cleavage Motif Performs an Essential Role other than Cleavage. J Virol. 2019, 93.
- Carter SD, Surtees R, Walter CT, Ariza A, Bergeron É, Nichol ST, et al. Structure, Function, and Evolution of the Crimean-Congo Hemorrhagic Fever Virus Nucleocapsid Protein. J Virol. 2012, 86, 10914–10923. [Google Scholar] [CrossRef]
- Surtees R, Dowall SD, Shaw A, Armstrong S, Hewson R, Carroll MW, et al. Heat Shock Protein 70 Family Members Interact with Crimean-Congo Hemorrhagic Fever Virus and Hazara Virus Nucleocapsid Proteins and Perform a Functional Role in the Nairovirus Replication Cycle. J Virol. 2016, 90, 9305–9316. [Google Scholar] [CrossRef]
- Matsumoto Y, Nouchi T, Ohta K, Nishio M. Regulation of Hazara virus growth through apoptosis inhibition by viral nucleoprotein. Arch Virol. 2019, 164, 1597–1607. [Google Scholar] [CrossRef] [PubMed]
- Bell-Sakyi, L.; Kohl, A.; Bente, D.A.; Fazakerley, J.K. Tick cell lines for study of Crimean-Congo hemorrhagic fever virus and other arboviruses. Vector Borne Zoonotic Dis. 2012, 12, 769–781. [Google Scholar] [CrossRef] [PubMed]
- Goic, B.; Stapleford, K.A.; Frangeul, L.; Doucet, A.J.; Gausson, V.; Blanc, H.; et al. Virus-derived DNA drives mosquito vector tolerance to arboviral infection. Nat. Commun. 2016, 7, 12410. [Google Scholar] [CrossRef]
- Wang, J.; Chai, Y.; Yang, J.; Chen, K.; Liu, G.; Luo, J.; Guan, G.; Ren, Q.; Yin, H. Insight into Hyalomma anatolicum biology by comparative genomics analyses. Nat. Commun. 2023, 14, 1–15. [Google Scholar] [CrossRef]









| Primer/Probe HAZV | Sequence 5’→ 3’ |
|---|---|
| Primer forward | TGCCGAAATTCCTCAGCTCGAC |
| Primer reverse | TGCACACTCCATGATAGGAGCAC |
| Probe | FAM-AGGGACGCCATCTACAGCTCAGCACTCA-BHQ1 |
| Temperature | Time | Cycles | |
|---|---|---|---|
| Initial denaturation | 95ºC | 5 min | 1 |
| Denaturation | 95ºC | 10 sec | |
| Annealing | 60ºC | 30 sec | 40 |
| Extension | 72ºC | 20 sec |
| Temperature | Time | Cycles | |
|---|---|---|---|
| Initial denaturation | 95ºC | 5 min | 1 |
| Denaturation | 95ºC | 15 sec | |
| Annealing | 60ºC | 30 sec | 45 |
| Extension | 72ºC | 20 sec | |
| Final Extension | 72ºC | 5 min | 1 |
| Probe nM | Primer 250nM | Primer 400nM | ||
|---|---|---|---|---|
| Efficiency | R | Efficiency | R | |
| 50 | 82.30% | 0.986 | 71.00% | 0.993 |
| 100 | 78.00% | 0.997 | 83.50% | 0.966 |
| 150 | 81.20% | 0.992 | 76.40% | 1.0 |
| 200 | 74.00% | 0.996 | 81.40% | 1.0 |
| 250 | 82.70% | 0.991 | 94.30% | 0.979 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).