Submitted:
07 February 2025
Posted:
10 February 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Study Design and Experimental Groups
2.3. Implantation of Electrodes and Determination of After-Discharge Threshold
2.4. Kindling Protocol
2.5. Drug Preparation
2.6. Osmotic Pump Implantation
2.7. Brain Tissue Preparation
2.8. Western Blot
2.9. Real Time PCR
2.10. Data Analysis
3. Results
3.1. Anti-Epileptogenic Effect of Reparixin in Kindling Process
3.2. Anti-Seizure Effect of Reparixin in Kindled Rat
3.3. Analysis of CXCL1-CXCR1/2 Signaling in a Rodent Model of Acquired Epilepsy
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Stafstrom, C.E.; Carmant, L. Seizures and epilepsy: an overview for neuroscientists. Cold Spring Harb Perspect Med 2015, 5. [Google Scholar] [CrossRef]
- Motovilov, K.; Maguire, C.; Briggs, D.; Melamed, E. Altered Cytokine Profile in Clinically Suspected Seronegative Autoimmune Associated Epilepsy. medRxiv, 2009; 2024.2009.2013.24310337. [Google Scholar] [CrossRef]
- Jauhari, P.; Kaur, P.; Gulati, S.; Meena, A.K.; Pandey, T.; Upadhyay, A. Diagnostic and prognostic significance of serum interleukins in epileptic encephalopathy with spike wave activation in sleep (EE-SWAS) syndrome. Eur J Paediatr Neurol 2024, 53, 33–38. [Google Scholar] [CrossRef]
- Kaczorowska, M.; Czekuć-Kryśkiewicz, E.; Dądalski, M.; Kotulska, K. Immunological markers of drug resistant epilepsy and its response to immunomodulatory therapy with ACTH in children. Folia Neuropathol 2023, 61, 360–370. [Google Scholar] [CrossRef]
- Milano, C.; Montali, M.; Barachini, S.; Burzi, I.S.; Pratesi, F.; Petrozzi, L.; Chico, L.; Morganti, R.; Gambino, G.; Rossi, L.; et al. Increased production of inflammatory cytokines by circulating monocytes in mesial temporal lobe epilepsy: A possible role in drug resistance. J Neuroimmunol 2024, 386, 578272. [Google Scholar] [CrossRef] [PubMed]
- Tsai, C.; Wilson, S.E.; Rubinos, C. SARS-CoV-2 infection and seizures: the perfect storm. J Integr Neurosci 2022, 21, 115. [Google Scholar] [CrossRef]
- Česká, K.; Papež, J.; Ošlejšková, H.; Slabý, O.; Radová, L.; Loja, T.; Libá, Z.; Svěráková, A.; Brázdil, M.; Aulická, Š. CCL2/MCP-1, interleukin-8, and fractalkine/CXC3CL1: Potential biomarkers of epileptogenesis and pharmacoresistance in childhood epilepsy. Eur J Paediatr Neurol 2023, 46, 48–54. [Google Scholar] [CrossRef]
- Di Sapia, R.; Zimmer, T.S.; Kebede, V.; Balosso, S.; Ravizza, T.; Sorrentino, D.; Castillo, M.A.M.; Porcu, L.; Cattani, F.; Ruocco, A.; et al. CXCL1-CXCR1/2 signaling is induced in human temporal lobe epilepsy and contributes to seizures in a murine model of acquired epilepsy. Neurobiol Dis 2021, 158, 105468. [Google Scholar] [CrossRef]
- McNamara, J.O. Kindling model of epilepsy. Adv Neurol 1986, 44, 303–318. [Google Scholar]
- Löscher, W.; Hönack, D.; Rundfeldt, C. Antiepileptogenic effects of the novel anticonvulsant levetiracetam (ucb L059) in the kindling model of temporal lobe epilepsy. J Pharmacol Exp Ther 1998, 284, 474–479. [Google Scholar] [CrossRef] [PubMed]
- Klitgaard, H.; Matagne, A.; Gobert, J.; Wülfert, E. Evidence for a unique profile of levetiracetam in rodent models of seizures and epilepsy. Eur J Pharmacol 1998, 353, 191–206. [Google Scholar] [CrossRef] [PubMed]
- George Paxinos, C.W. The Rat Brain in Stereotaxic Coordinates., 4 ed.; Academic Press: Sydney, 1998. [Google Scholar]
- Racine, R.J. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr Clin Neurophysiol 1972, 32, 281–294. [Google Scholar] [CrossRef]
- Brandolini, L.; Benedetti, E.; Ruffini, P.A.; Russo, R.; Cristiano, L.; Antonosante, A.; d'Angelo, M.; Castelli, V.; Giordano, A.; Allegretti, M.; et al. CXCR1/2 pathways in paclitaxel-induced neuropathic pain. Oncotarget 2017, 8, 23188–23201. [Google Scholar] [CrossRef] [PubMed]
- Cavalieri, B.; Mosca, M.; Ramadori, P.; Perrelli, M.G.; De Simone, L.; Colotta, F.; Bertini, R.; Poli, G.; Cutrìn, J.C. Neutrophil recruitment in the reperfused-injured rat liver was effectively attenuated by repertaxin, a novel allosteric noncompetitive inhibitor of CXCL8 receptors: a therapeutic approach for the treatment of post-ischemic hepatic syndromes. Int J Immunopathol Pharmacol 2005, 18, 475–486. [Google Scholar] [CrossRef] [PubMed]
- Löscher, W.; Hönack, D. Profile of ucb L059, a novel anticonvulsant drug, in models of partial and generalized epilepsy in mice and rats. Eur J Pharmacol 1993, 232, 147–158. [Google Scholar] [CrossRef] [PubMed]
- Souza, D.G.; Bertini, R.; Vieira, A.T.; Cunha, F.Q.; Poole, S.; Allegretti, M.; Colotta, F.; Teixeira, M.M. Repertaxin, a novel inhibitor of rat CXCR2 function, inhibits inflammatory responses that follow intestinal ischaemia and reperfusion injury. Br J Pharmacol 2004, 143, 132–142. [Google Scholar] [CrossRef]
- Yuen, E.S.; Trocóniz, I.F. Can pentylenetetrazole and maximal electroshock rodent seizure models quantitatively predict antiepileptic efficacy in humans? Seizure 2015, 24, 21–27. [Google Scholar] [CrossRef]
- Shao, L.L.; Gao, M.M.; Gong, J.X.; Yang, L.Y. DUSP1 regulates hippocampal damage in epilepsy rats via ERK1/2 pathway. J Chem Neuroanat 2021, 118, 102032. [Google Scholar] [CrossRef]
- Nguyen, L.H.; Leiser, S.C.; Song, D.; Brunner, D.; Roberds, S.L.; Wong, M.; Bordey, A. Inhibition of MEK-ERK signaling reduces seizures in two mouse models of tuberous sclerosis complex. Epilepsy Res 2022, 181, 106890. [Google Scholar] [CrossRef]
- Chen, T.; Yang, J.; Zheng, Y.; Zhou, X.; Huang, H.; Zhang, H.; Xu, Z. ERK1/2 Regulates Epileptic Seizures by Modulating the DRP1-Mediated Mitochondrial Dynamic. Synapse 2024, 78, e22309. [Google Scholar] [CrossRef]
- Fu, S.; Chen, X.; Lin, H.J.; Lin, J. Inhibition of interleukin 8/C-X-C chemokine receptor 1,/2 signaling reduces malignant features in human pancreatic cancer cells. Int J Oncol 2018, 53, 349–357. [Google Scholar] [CrossRef]
- Du, H.; Nie, S.; Chen, G.; Ma, K.; Xu, Y.; Zhang, Z.; Papa, S.M.; Cao, X. Levetiracetam Ameliorates L-DOPA-Induced Dyskinesia in Hemiparkinsonian Rats Inducing Critical Molecular Changes in the Striatum. Parkinsons Dis 2015, 2015, 253878. [Google Scholar] [CrossRef] [PubMed]
- Bröer, S.; Pauletti, A. Microglia and infiltrating macrophages in ictogenesis and epileptogenesis. Front Mol Neurosci 2024, 17, 1404022. [Google Scholar] [CrossRef] [PubMed]
- Sanz, P.; Rubio, T.; Garcia-Gimeno, M.A. Neuroinflammation and Epilepsy: From Pathophysiology to Therapies Based on Repurposing Drugs. Int J Mol Sci 2024, 25. [Google Scholar] [CrossRef] [PubMed]





| Gene | Frw primer (5’-3’) | Rev primer (5’-3’) |
|---|---|---|
| CXCL1 | CTCGCTTCTCTGTGCAGC | AGTGTGGCTATGACTTCGGT |
| CXCR1 | ACCGATGTCTACGTGCTGAA | GATGGCCAGGTATCGATCCA |
| CXCR2 | TGTCCCTGCCCATCTTCATT | CGAGGACCACAGCAAAGATG |
| GAPDH | ATGGTGAAGGTCGGTGTGAAC | TGTAGTTGAGGTCAATGAAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).