Submitted:
24 January 2025
Posted:
27 January 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Samples
- a)
- Anonymized blood samples (n = 230) from returning travelers or immigrants coming from endemic malaria areas were sent to the Parasitology Reference and Research Laboratory at the National Microbiology Centre-Instituto de Salud Carlos III, for the testing of malaria and other tropical diseases. These samples were part of the repository of the Spanish National Biobanks (Registry number: C.0001392) which include the samples used in this study from three research projects for the study of imported malaria in Spain approved by the Ethics Committee of the Instituto de Salud Carlos III and the Research Ethics Committee of the 12 de Octubre University Hospital in Madrid (ISCIII CEI PI 74_2020 Date: 30/09/2020; ISCIII CEI PI 100_2022 Date: 26/01/2022 and H12O CEtm:.18/021 Date: 08/02/2022). They consisted of 119 Plasmodium-positive samples, including P. falciparum (n = 81), P. vivax (n = 13), P. ovale (n = 8), P. malariae (n = 8) and mixed infections by two Plasmodium species (n = 9). In addition, 33 samples for Filariae (Loa loa, n = 24; Mansonella perstans, n =7; mixed infections by L. loa + M perstans, n = 2), nine samples for Trypanosomatidae (Trypanosoma brucei, n = 4; Leishmania infantum, n =3; Trypanosoma cruzi, n = 2), and 69 negative samples were also available for the survey.
- b)
- Faecal samples (n = 58) from wild chimpanzees (Pan troglodytes) collected in the Dindéfélo National Park (Kedougou, Senegal). These samples were a subset of the initial panel (n = 234) originally used to screen for the presence of intestinal and hematic parasites [14]. The animal study protocol was approved by the by the Research Ethics committee of the Instituto de Salud Carlos III (protocol code CEI PI 90_2018-v2) and the study was conducted in strict accordance with the Code of Best Practices for Field Primatology of the International Primatological Society [16,17]. They included two Plasmodium-positive samples (P. malariae, n = 1; Plasmodium spp., n = 1), 16 Trypanosomatidae-positive samples (T. brucei sp., n =1; Phytomonas sp., n =8; Trypanosomatidae spp., n = 5; Bodo sp., n = 1; Neobodo sp., n =1), nine Filariae-positive samples (M. perstans, n = 8; Mansonella spp., n = 1), and 31 negative samples.
2.2. DNA Extraction and Purification
2.3. Primers and Probes Design
2.4. Real Time PCR for Blood Parasite (RT-PCR-bp) Groups
2.5. Validation
2.6. Analytical Sensitivity and Specificity
2.7. Intra-Assay Precision
2.8. Inter-Assay Precision
2.9. Performance Parameters
2.10. Operational Features
3. Results
3.1. Validation
3.2. Analytical Sensitivity and Specificity
3.3. Intra-Assay Precision
3.4. Inter-Assay Precision
3.5. Diagnostic Performance of the RT-PCR-Bp assay
3.6. Operational Features
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization; 2023. World Malaria Report 2023. Geneva:. Licence: CC BY-NC-SA 3.0 IGO.
- World Health Organization; 2024. Global Report on Neglected Tropical Diseases 2024. Geneva: Licence: CC BY-NC-SA 3.0 IGO.
- Tidman, R.; Abela-Ridder, B.; de Castañeda, R.R. The impact of climate change on neglected tropical diseases: a systematic review. Trans R Soc Trop Med Hyg. 2021, 115: 147–168. [CrossRef]
- Hotez, P.J.; Remme, J.H.F.; Buss, P.; Alleyne, G.; Morel, C.; Breman, J.G. Combating tropical infectious diseases: Report of the Disease Control Priorities in Developing Countries Project. Clin Infect Dis. 2004, 38, 871–878. [CrossRef]
- Short, E.E.; Caminade, C.; Thomas, B.N. Climate change contribution to the emergence or re-emergence of parasitic diseases. Infect Dis. 2017, 10, 1178633617732296. [CrossRef]
- World Health Organization Control and surveillance of human African trypanosomiasis. WHO Tech Rep Series, 2013, ;984:1–237.
- Büscher, P.; Bart, J.M.; Boelaert, M.; Bucheton, B.;, Cecchi, G.; Chitnis, N.; Courtin, D.; Figueiredo, L.M.; Franco, J.R.; Grébaut, P.; Hasker, E.; Ilboudo, H.; Jamonneau, V.; Koffi, M.; Lejon, V.; MacLeod, A.; Masumu, J.; Matovu, E.; Mattioli, R.; Noyes, H.; Picado, A.; Rock, K.S.; Rotureau, B.; Simo, G.; Thévenon, S.; Trindade, S.; Truc, P.; Van Reet, N. Do cryptic reservoirs threaten Gambiense-sleeping sickness elimination? Trends Parasitol. 2018, 34:197–207. [CrossRef]
- González-Macea, O.; Martínez-Ávila, M.C.; Pérez, M.; Tibocha Gordon, I.; Arroyo Salgado, B. Concurrent dengue-malaria infection: The importance of acute febrile illness in endemic zones. Clin Med Insights Case Rep. 2023, 16, 11795476221144585. [CrossRef]
- Dacal, E.; Köster, P.C.; Carmena, D. Diagnóstico molecular de parasitosis intestinales. Enferm Infecc Microbiol Clin. 2020, 38 Suppl 1:24–31. [CrossRef]
- Rougemont, M.; Van Saanen, M.; Sahli, R.; Hinrikson, H.P.; Bille, J.; Jaton, K. Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays. J Clin Microbiol. 2004, 42:5636–5643. [CrossRef]
- Putaporntip, C.; Buppan, P.; Jongwutiwes, S. Improved performance with saliva and urine as alternative DNA sources for malaria diagnosis by mitochondrial DNA-based PCR assays. Clin Microbiol Infect. 2011, 17:1484–1491. [CrossRef]
- Ta, T.H.; Hisam, S.; Lanza, M.; Jiram, A.I.; Ismail, N.; Rubio, J.M. First case of a naturally acquired human infection with Plasmodium cynomolgi. Malaria J. 2014, 13:68. [CrossRef]
- Tang, T.H.; López-Vélez, R.; Lanza, M.; Shelley, A.J.; Rubio, J.M.; Luz, S.L. Nested PCR to detect and distinguish the sympatric filarial species Onchocerca volvulus, Mansonella ozzardi and Mansonella perstans in the Amazon Region. Mem Inst Oswaldo Cruz. 2010, 105, :823–828. [CrossRef]
- Köster, P.C.; Renelies-Hamilton, J.; Dotras, L.; Llana, M.; Vinagre-Izquierdo, C.; Prakas, P.; Sneideris, D.; Dashti, A.; Bailo, B.; Lanza, M.; Jiménez-Mejías, A.; Muñoz-García, C.; Muadica, A.S.; González-Barrio, D.; Rubio, J.M.; Fuentes, I.; Ponce-Gordo, F.; Calero-Bernal, R.; Carmena, D. Molecular detection and characterization of intestinal and blood parasites in wild chimpanzees (Pan troglodytes verus) in Senegal. Animals (Basel). 2021, 11, 3291. [CrossRef]
- García-Fernández, S.; Vergara-Gómez, A.; Sánchez-Díaz, A.M.; Albert Vicent, E. 2022. 76. Estudios de evaluación del rendimiento analítico y clínico de productos sanitarios para diagnóstico in vitro. García-Fernández, S. (coordinador). Procedimientos en Microbiología Clínica. Cercenado Mansilla, E.; Cantón Moreno, R. (editores). Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica (SEIMC). 2022.
- Gilardi, K.V.; Gillespie, T.R.; Leendertz, F.H.; Macfie, E.J.; Travis, D.A.; Whittier, C.A.; Williamson, E.A. Best practice guidelines for health monitoring and disease control in great ape populations. Retrieved December 2, 2024, from Iucn.org website: https://portals.iucn.org/library/sites/library/files/documents/ssc-op-056.pdf.
- MacKinnon, K.; Riley, E.; Garber, P.; Setchell, J.; Fernandez-Duque, E. Code of Best Practices for Field Primatology. 2014. [CrossRef]
- Ebertz, A. (2022, September 5). Primer design guide – The top 5 factors to consider for optimum performance. Retrieved December 12, 2024, from The DNA Universe BLOG website: https://the-dna-universe.com/2022/09/05/primer-design-guide-the-top-5-factors-to-consider-for-optimum-performance.
- World Health Organization. Basic malaria microscopy. Geneva; 2010.Part I. Learner’s guide. Second edition. License: CC BY-NC-SA 3.0 IGO.ISBN 978 92 4 154782 6.
- World Health Organization, 1997. Bench aids for the diagnosis of filarial infections. ISBN 92 41544899.
- World Health Organization; 1991. Basic laboratory methods in medical parasitology. https://iris.who.int/handle/10665/40793.
- Saah, A.J.; Hoover, D.R. Sensitivity and specificity reconsidered: the meaning of these terms in analytical and diagnostic settings. Ann Int Med. 1997, 126:91–94. [CrossRef]
- Mitra, A.K.; Mawson, A.R. Neglected tropical diseases: Epidemiology and global burden. Trop Med Infect Dis. 2017, 5:36. [CrossRef]
- Nguyen TK, Jun H, Louis JM, Mazigo E, Lee WJ, Youm HC, Shin J, Lungu DK, Kanyemba C, Ahmed MA, Muh F, Lee SJ, Na S, Chun W, Park WS, No JH, Kim MJ, Han ET, Han JH. Enhancing malaria detection in resource-limited areas: A high-performance colorimetric LAMP assay for Plasmodium falciparum screening. PLoS One. 2024 Feb 9;19(2):e0298087. PMID: 38335219; PMCID: PMC10857711. [CrossRef]
- Ramírez AM, Tang THT, Suárez ML, Fernández AÁ, García CM, Hisam S, Rubio JM. Assessment of Commercial Real-Time PCR Assays for Detection of Malaria Infection in a Non-Endemic Setting. Am J Trop Med Hyg. 2021 Oct 12;105(6):1732-1737. PMID: 34662870; PMCID: PMC8641344. [CrossRef]
- Mangold, K. A., Manson, R. U., Koay, E. S. C., Stephens, L., Regner, M., Thomson, R. B., Jr, … Kaul, K. L. (2005). Real-Time PCR for Detection and Identification of Plasmodium spp. Journal of Clinical Microbiology, 43(5), 2435–2440. [CrossRef]
- Masiga, D.K.; Smyth, A.J.; Hayes, P.; Bromidge, T.J.; Gibson, W.C. Sensitive detection of trypanosomes in tsetse flies by DNA amplification. Int J Parasitol. 1992, 22:909–918. [CrossRef]
- Gummery, L.; Jallow, S.; Raftery, A.G.; Bennet, E.; Rodgers, J.; Sutton, D.GM. Comparison of loop-mediated isothermal amplification (LAMP) and PCR for the diagnosis of infection with Trypanosoma brucei ssp. in equids in The Gambia. PLoS One. 2020, 15:e0237187. [CrossRef]
- Sá, A.R.N.; Kimoto, K.Y.; Steindel, M.; Grisard, E.C.; Gomes, M.L. Limit of detection of PCR/RFLP analysis of cytochrome oxidase II for the identification of genetic groups of Trypanosoma cruzi and Trypanosoma rangeli in biological material from vertebrate hosts. Parasitol Res. 2018, 117:2403–2410. [CrossRef]
- Seiringer, P.; Pritsch, M.; Flores-Chavez, M.; Marchisio, E.; Helfrich, K.; Mengele, C.; Hohnerlein, S.; Bretzel, G.; Löscher, T.; Hoelscher M, Berens-Riha N. Comparison of four PCR methods for efficient detection of Trypanosoma cruzi in routine diagnostics. Diagn Microbiol Infect Dis. 2017, 88:225–232. [CrossRef]
- Schijman, A.G.; Bisio, M.; Orellana, L.; Sued, M.; Duffy, T.; Mejia Jaramillo, A.M.; Cura, C.; Auter, F.; Veron, V.; Qvarnstrom, Y.; Deborggraeve, S.; Hijar, G.; Zulantay, I.; Lucero, R.H.; Velazquez, E.; Tellez, T.; Sanchez Leon, Z.; Galvão, L.; Nolder, D.; Monje Rumi, M.; Levi, J.E.; Ramirez, J.D.; Zorrilla, P.; Flores, M.; Jercic, M.I.; Crisante, G.; Añez, N.; De Castro, A.M.; Gonzalez, C.I.; Acosta Viana, K.; Yachelini, P.; Torrico, F.; Robello, C.; Diosque, P.; Triana Chavez, O.; Aznar, C.; Russomando, G.; Büscher, P.; Assal, A.; Guhl, F.; Sosa Estani, S.; DaSilva, A.; Britto, C.; Luquetti, A.; Ladzins, J. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients. PLoS Negl Trop Dis. 2011, 5:e931. [CrossRef]
- Formenti, F.; Tang, T.T.; Tamarozzi, F.; Silva, R.; La Marca, G.; Pajola, B.; Piubelli, C.; Perandin, F.; Rubio, J.M.; Escolar, E.M.; Bisoffi, Z.; Gobbi, F. Preliminary comparison between an in-house real-time PCR vs microscopy for the diagnosis of Loa loa and Mansonella perstans. Acta Trop. 2021, 216:105838. [CrossRef]
- Kaiser, M.; Löwa, A.; Ulrich, M.; Ellerbrok, H.; Goffe, A.S.; Blasse, A.; Zommers, Z.; Couacy-Hymann, E.; Babweteera, F.; Zuberbühler, K.; Metzger, S.; Geidel, S.; Boesch, C.; Gillespie, T.R.; Leendertz, F.H. Wild chimpanzees infected with 5 Plasmodium species. Emerg Infect Dis. 2010, 16:1956–1959. [CrossRef]
- Gaillard, C.M.; Pion, S.D.; Hamou, H.; Sirima, C.; Bizet, C.; Lemarcis, T.; Rodrigues, J.; Esteban, A.; Peeters, M.; Mpoudi Ngole, E.; Mombo, I.; Liégeois, F.; Martin, C.; Boussinesq, M.; Locatelli, S. Detection of DNA of filariae closely related to Mansonella perstans in faecal samples from wild non-human primates from Cameroon and Gabon. Parasit Vectors. 2020, 13:313. [CrossRef]
- Jirků, M.; Votýpka, J.; Petrželková, K.J.; Jirků-Pomajbíková, K.; Kriegová, E.; Vodička, R.; Lankester, F.; Leendertz, S.A.; Wittig, R.M.; Boesch, C.; Modrý, D.; Ayala, F.J.; Leendertz, F.H.; Lukeš, J. Wild chimpanzees are infected by Trypanosoma brucei. Int J Parasitol Parasites Wildl. 2015, 4:277–282. [CrossRef]
- Votýpka, J.; Pafčo, B.; Modrý, D.; Mbohli, D.; Tagg, N.; Petrželková, K.J. An unexpected diversity of trypanosomatids in faecal samples of great apes. Int J Parasitol Parasites Wildl. 2018, 7:322–325. [CrossRef]
| Primer | Sequence (5´–3´) | Specificity | Concentration (µM) |
|---|---|---|---|
| JM-U-0011F | CAAGTCTGGTGCCAGCA | Universal | 0.2 |
| JM-T-349R | CCAACAAAAGECGAAACGGTGGCC | Trypanosomatidae | 0.2 |
| JM-Fi-0015R | CAAGGTAAACTTGCTAGCCAC | Filariae | 0.2 |
| JM-P-COI2F | GGTGTGTACAAGGCAACAATAC | Plasmodium spp. | 0.2 |
| JM-P-COI1R | CATATAACGGTAAGAAGGTTCGC | Plasmodium spp. | 0.2 |
| IC-Forw | GAGCCGCCTGGATACCGC | Mammals | 0.2 |
| IC-Rev | GACGGTATCTGATCGTCTTC | Mammals | 0.2 |
| Tryp 681 | TxRd–GCTGTTGCTGTTAAAGGGTTCGTAG–BHQ2 | Trypanosomatidae | 0.15 |
| Fi 101 | Cy5.5–GGTCCATYCATTGGATGAGAACT–BHQ2 | Filariae | 0.15 |
| MALCOI 2 | Cy5–ATTGGCACCTCCATGTCGTCTCAT–BHQ2 | Plasmodium spp. | 0.15 |
| IC | Hex–TCGCTCTGGTCCGTCTTG–BHQ1 | Mammals | 0.06 |
| Parasite | Initial Parasitemia or Microfilaremia |
LoD |
|---|---|---|
| Plasmodium falciparum | 73,000 parasites/µl | 0.73 parasites/µl |
| Plasmodium vivax | 301 parasites/µl | 3.01 parasites/µl |
| Plasmodium ovale | 6,110 parasites/µl | 0.61 parasites/µl |
| Plasmodium malariae | 107 parasites/µl | 1.07 parasites/µl |
| Trypanosoma brucei | 1,800 parasites/µl | 0.0018 parasites/µl |
| Loa loa | 200 microfilariae/ml | 2 microfilariae/ml |
| Species | Parasitemia | Day 1 | Day 2 | Day 3 | Standard deviation |
Precision (%) |
|---|---|---|---|---|---|---|
| Plasmodium spp. | High | 6.98E+04 | 7.08E+04 | 7.30E+04 | 1.64E+03 | 97.70 |
| Medium | 7.02E+03 | 7.19E+03 | 7.30E+03 | 1.41E+02 | 98.03 | |
| Low | 4.84E+01 | 4.22E+01 | 5.36E+01 | 5.71E+00 | 88.13 | |
| Trypanosomatidae | High | 1.84E+04 | 1.80E+04 | 1.84E+04 | 2.29E+02 | 98.75 |
| Medium | 1.82E+03 | 1.74E+03 | 1.68E+03 | 7.26E+01 | 95.85 | |
| Low | 6.30E+01 | 8.10E+01 | 6.30E+01 | 1.04E+01 | 84.94 | |
| Filariae | High | 1.19E+05 | 1.27E+05 | 1.19E+05 | 4.85E+03 | 96.00 |
| Medium | 2.00E+02 | 2.03E+02 | 2.15E+02 | 7.94E+00 | 96.15 | |
| Low | 9.20E+01 | 6.60E+01 | 5.40E+01 | 1.94E+01 | 72.51 |
| Species | Parasitemia | M1 | M2 | M3 | Standard deviation |
Precision (%) |
|---|---|---|---|---|---|---|
| Plasmodium spp. | High | 2.59E+03 | 2.31E+03 | 2.01E+03 | 2.90E+02 | 87.41 |
| Medium | 3.83E+02 | 4.30E+02 | 5.24E+02 | 7.18E+01 | 83.89 | |
| Low | 2.90E+00 | 5.01E+00 | 4.62E+00 | 1.12E+00 | 73.12 | |
| Trypanosomatidae | High | 1.38E+04 | 1.37E+04 | 1.24E+04 | 7.81E+02 | 94.13 |
| Medium | 2.52E+03 | 2.61E+03 | 1.38E+03 | 6.86E+02 | 68.40 | |
| Low | 1.41E+02 | 1.44E+02 | 2.54E+02 | 6.43E+01 | 64.16 | |
| Filariae | High | 3.24E+03 | 2.83E+03 | 2.92E+03 | 2.15E+02 | 92.81 |
| Medium | 3.12E+02 | 2.48E+02 | 3.53E+02 | 5.29E+01 | 82.61 | |
| Low | 1.72E+01 | 6.57E+01 | 2.24E+01 | 9.54E+00 | 61.99 |
| Reference PCR methods | RT-PCR-bp | |
|---|---|---|
| Plasmodium spp. | 119 | 119 |
| Plasmodium falciparum | 81 | |
| Plasmodium vivax | 13 | |
| Plasmodium malariae | 8 | |
| Plasmodium ovale | 8 | |
| Mixed Infections | 9 | |
| Trypanosomatidae | 9 | 9 |
| Leishmania infantum | 3 | |
| Trypanosoma brucei | 4 | |
| Trypanosoma cruzi | 2 | |
| Filariae | 33 | 31 |
| Mansonella perstans | 7 | |
| Loa loa | 24 | |
| Mixed Infections | 2 | |
| Negative | 69 | 71 |
| Total | 230 | 230 |
| Plasmodium spp. | Filariae | |||
|---|---|---|---|---|
| Values (%) | 95% CI | Values (%) | 95% CI | |
| Sensibility | 100 | 94.0–100 | 93.9 | 80.4–98.3 |
| Specificity | 100 | 81.6–100 | 100 | 81.6–100 |
| PPV | 100 | 94.0–100 | 100 | 89.0–100 |
| NPV | 100 | 81.6–100 | 89.5 | 68.6–97.1 |
| Kappa index | 1.00 | 1.00–1.00 | 0.91 | 0.80–1.03 |
| Plasmodium spp. | Trypanosomatidae | Filariae | Coinfected | Total infected | |
|---|---|---|---|---|---|
| RT-PCR-bp n (%) | 12 (21) | 17 (29) | 14 (24) | 9 (16) | 34 (58) |
| Reference PCR method n (%) | 2 (3.4) | 16 (27.6) | 9 (15.5) | 3 (5.2) | 27 (46.5) |
| RT-PCR-bp | SnM-PCR | nFil-PCR | RT-PCR-Tryp | |
|---|---|---|---|---|
| Sample Processing | 1h | 1h | 1h | 1h |
| First PCR setup | 30 min | 30 min | 30 min | 30 min |
| First PCR amplification | 1h 30min | 2h | 2h | 1h 30min |
| Second PCR setup | - | 30 min | 30 min | - |
| Second PCR amplification | - | 1h 15min | 1h 15min | - |
| Electrophoresis | - | 30 min | 30 min | - |
| Results analysis | 30 min | 15 min | 15 min | 30 min |
| Total | 3h 30min | 6h | 6h | 3h 30min |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).