Submitted:
05 August 2024
Posted:
05 August 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Glucose Uptake Test
2.3. The Expression of mtDNA Encoded Genes
3. Discussion
4. Materials and Methods
4.1. Study Reagetns
4.2. The 3T3-L1 Cell Line Culturing and Differentiation
4.3. Insulin Resistance Induction and the Effect of Phospholipid Derivatives
4.4. Glucose Uptake Test
4.5. DNA and RNA Extraction from Experimental and Control Cells
4.6. Mitochindrial DNA Copy Number Quantification
4.7. cDNA Synthesis and Quantification of Gene Expression
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lebovitz, H.E. Insulin Resistance: Definition and Consequences. Exp Clin Endocrinol Diabetes 2001, 109 Suppl 2, S135-148. [CrossRef]
- Lankarani, M.; Valizadeh, N.; Heshmat, R.; Peimani, M.; Sohrabvand, F. Evaluation of Insulin Resistance and Metabolic Syndrome in Patients with Polycystic Ovary Syndrome. Gynecol Endocrinol 2009, 25, 504–507. [CrossRef]
- Petersen, M.C.; Shulman, G.I. Mechanisms of Insulin Action and Insulin Resistance. Physiol Rev 2018, 98, 2133–2223. [CrossRef]
- Asmann, Y.W.; Stump, C.S.; Short, K.R.; Coenen-Schimke, J.M.; Guo, Z.; Bigelow, M.L.; Nair, K.S. Skeletal Muscle Mitochondrial Functions, Mitochondrial DNA Copy Numbers, and Gene Transcript Profiles in Type 2 Diabetic and Nondiabetic Subjects at Equal Levels of Low or High Insulin and Euglycemia. Diabetes 2006, 55, 3309–3319. [CrossRef]
- Stump, C.S.; Short, K.R.; Bigelow, M.L.; Schimke, J.M.; Nair, K.S. Effect of Insulin on Human Skeletal Muscle Mitochondrial ATP Production, Protein Synthesis, and mRNA Transcripts. Proc Natl Acad Sci U S A 2003, 100, 7996–8001. [CrossRef]
- Tirosh, A.; Potashnik, R.; Bashan, N.; Rudich, A. Oxidative Stress Disrupts Insulin-Induced Cellular Redistribution of Insulin Receptor Substrate-1 and Phosphatidylinositol 3-Kinase in 3T3-L1 Adipocytes. A Putative Cellular Mechanism for Impaired Protein Kinase B Activation and GLUT4 Translocation. J Biol Chem 1999, 274, 10595–10602. [CrossRef]
- Huang, D.-W.; Shen, S.-C. Caffeic Acid and Cinnamic Acid Ameliorate Glucose Metabolism via Modulating Glycogenesis and Gluconeogenesis in Insulin-Resistant Mouse Hepatocytes. Journal of Functional Foods 2012, 4, 358–366. [CrossRef]
- Nair, A.; Preetha Rani, M.R.; Salin Raj, P.; Ranjit, S.; Rajankutty, K.; Raghu, K.G. Cinnamic Acid Is Beneficial to Diabetic Cardiomyopathy via Its Cardioprotective, Anti-Inflammatory, Anti-Dyslipidemia, and Antidiabetic Properties. J Biochem Mol Toxicol 2022, 36, e23215. [CrossRef]
- Hafizur, R.M.; Hameed, A.; Shukrana, M.; Raza, S.A.; Chishti, S.; Kabir, N.; Siddiqui, R.A. Cinnamic Acid Exerts Anti-Diabetic Activity by Improving Glucose Tolerance in Vivo and by Stimulating Insulin Secretion in Vitro. Phytomedicine 2015, 22, 297–300. [CrossRef]
- Huang, D.-W.; Shen, S.-C.; Wu, J.S.-B. Effects of Caffeic Acid and Cinnamic Acid on Glucose Uptake in Insulin-Resistant Mouse Hepatocytes. J Agric Food Chem 2009, 57, 7687–7692. [CrossRef]
- Małodobra-Mazur, M.; Lewoń, D.; Cierzniak, A.; Okulus, M.; Gliszczyńska, A. Phospholipid Derivatives of Cinnamic Acid Restore Insulin Sensitivity in Insulin Resistance in 3T3-L1 Adipocytes. Nutrients 2021, 13, 3619. [CrossRef]
- Furukawa, S.; Fujita, T.; Shimabukuro, M.; Iwaki, M.; Yamada, Y.; Nakajima, Y.; Nakayama, O.; Makishima, M.; Matsuda, M.; Shimomura, I. Increased Oxidative Stress in Obesity and Its Impact on Metabolic Syndrome. J Clin Invest 2004, 114, 1752–1761. [CrossRef]
- Henriksen, E.J.; Diamond-Stanic, M.K.; Marchionne, E.M. Oxidative Stress and the Etiology of Insulin Resistance and Type 2 Diabetes. Free Radic Biol Med 2011, 51, 993–999. [CrossRef]
- Bhatti, J.S.; Bhatti, G.K.; Reddy, P.H. Mitochondrial Dysfunction and Oxidative Stress in Metabolic Disorders - A Step towards Mitochondria Based Therapeutic Strategies. Biochim Biophys Acta Mol Basis Dis 2017, 1863, 1066–1077. [CrossRef]
- Ritz, P.; Berrut, G. Mitochondrial Function, Energy Expenditure, Aging and Insulin Resistance. Diabetes Metab 2005, 31 Spec No 2, 5S67-65S73. [CrossRef]
- Lee, J.-Y.; Lee, D.-C.; Im, J.-A.; Lee, J.-W. Mitochondrial DNA Copy Number in Peripheral Blood Is Independently Associated with Visceral Fat Accumulation in Healthy Young Adults. Int J Endocrinol 2014, 2014, 586017. [CrossRef]
- Zheng, L.D.; Linarelli, L.E.; Liu, L.; Wall, S.S.; Greenawald, M.H.; Seidel, R.W.; Estabrooks, P.A.; Almeida, F.A.; Cheng, Z. Insulin Resistance Is Associated with Epigenetic and Genetic Regulation of Mitochondrial DNA in Obese Humans. Clin Epigenetics 2015, 7, 60. [CrossRef]
- Gianotti, T.F.; Sookoian, S.; Dieuzeide, G.; García, S.I.; Gemma, C.; González, C.D.; Pirola, C.J. A Decreased Mitochondrial DNA Content Is Related to Insulin Resistance in Adolescents. Obesity (Silver Spring) 2008, 16, 1591–1595. [CrossRef]
- Xu, F.X.; Zhou, X.; Shen, F.; Pang, R.; Liu, S.M. Decreased Peripheral Blood Mitochondrial DNA Content Is Related to HbA1c, Fasting Plasma Glucose Level and Age of Onset in Type 2 Diabetes Mellitus. Diabet Med 2012, 29, e47-54. [CrossRef]
- Kelley, D.E.; He, J.; Menshikova, E.V.; Ritov, V.B. Dysfunction of Mitochondria in Human Skeletal Muscle in Type 2 Diabetes. Diabetes 2002, 51, 2944–2950. [CrossRef]
- Ritov, V.B.; Menshikova, E.V.; He, J.; Ferrell, R.E.; Goodpaster, B.H.; Kelley, D.E. Deficiency of Subsarcolemmal Mitochondria in Obesity and Type 2 Diabetes. Diabetes 2005, 54, 8–14. [CrossRef]
- Hoek, J.B.; Cahill, A.; Pastorino, J.G. Alcohol and Mitochondria: A Dysfunctional Relationship. Gastroenterology 2002, 122, 2049–2063. [CrossRef]
- Jové, M.; Salla, J.; Planavila, A.; Cabrero, A.; Michalik, L.; Wahli, W.; Laguna, J.C.; Vázquez-Carrera, M. Impaired Expression of NADH Dehydrogenase Subunit 1 and PPARgamma Coactivator-1 in Skeletal Muscle of ZDF Rats: Restoration by Troglitazone. J Lipid Res 2004, 45, 113–123. [CrossRef]
- Morino, K.; Petersen, K.F.; Dufour, S.; Befroy, D.; Frattini, J.; Shatzkes, N.; Neschen, S.; White, M.F.; Bilz, S.; Sono, S.; et al. Reduced Mitochondrial Density and Increased IRS-1 Serine Phosphorylation in Muscle of Insulin-Resistant Offspring of Type 2 Diabetic Parents. J Clin Invest 2005, 115, 3587–3593. [CrossRef]
- Czarnecka, M.; Świtalska, M.; Wietrzyk, J.; Maciejewska, G.; Gliszczyńska, A. Synthesis and Biological Evaluation of Phosphatidylcholines with Cinnamic and 3-Methoxycinnamic Acids with Potent Antiproliferative Activity. RSC Adv. 2018, 8, 35744–35752. [CrossRef]
- Czarnecka, M.; Świtalska, M.; Wietrzyk, J.; Maciejewska, G.; Gliszczyńska, A. Synthesis, Characterization, and In Vitro Cancer Cell Growth Inhibition Evaluation of Novel Phosphatidylcholines with Anisic and Veratric Acids. Molecules 2018, 23, E2022. [CrossRef]






| Gene | Official full name of gene | Primer’s sequence (5’→3’) | R2 value |
|---|---|---|---|
| Nd3 | NADH dehydrogenase subunit 3 | F*: TAACCTGTACACTGTTATCTTC | 0,99 |
| R*: GAGTACAGATTTATTTGGGGG | |||
| Nd4 | NADH dehydrogenase subunit 4 | F: TCCTCAGTTAGCCACATAGC | 0,99 |
| R: ATAAGTGGGAAGACCATTTGAA | |||
| Nd5 | NADH dehydrogenase subunit 5 | F: CCCATGACTACCATCAGCAA | 0,99 |
| R: ATAATGTGGTTAGGGCTCCG | |||
| Cytb | Cytochrome b | F: CATACGAAAAACACACCCATTA | 0,99 |
| R: GTAGTGTATGGCTAAGAAAAGA | |||
| Atp6 | ATP synthase 6 | F: TTTACACCTACTACCCAACTAT | 0,99 |
| R: GGAATTAGTGAAATTGGAGTTC | |||
| Atp8 | ATP synthase 8 | F: GCCACAACTAGATACATCAAC | 0,98 |
| R: GAAGGTGCCAGTGGGAATG | |||
| Cox1 | Cytochrome c oxidase 1 | F: TATCTACTATTCGGAGCCTGA | 0,99 |
| R: GCATGGGCAGTTACGATAAC | |||
| Cox2 | Cytochrome c oxidase 2 | F: GAAGACCTATGCTTTGATTCAT | 0,99 |
| R: GGATTGGAAGTTCTATTGGCA | |||
| Actb | Beta-actin | F: CGTTGACATCCGTAAAGACC | 0,99 |
| R: CTAGGAGCCAGAGCAGTAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).