Submitted:
12 July 2024
Posted:
15 July 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and methods
2.1. Cell Culture and Osteoblast Differentiation Induction
2.2. CCK-8 Assay
2.3. Clonogenic Assay
2.4. Cell Cycle Assay
2.5. Cell Apoptosis Assay
2.6. Alkaline Phosphatase (ALP) Staining and Quantification
2.7. Alizarin Red Staining (ARS)
2.7. Immunofluorescence (IF)
2.8. Quantitative Real-Time PCR Analysis (RT-qPCR)
2.9. Western Blot Analysis
2.10. RNA Sequencing and Bioinformatics Analysis
2.11. Statistical Analysis
3. Results
3.1. The Effect of the Radiation on the Proliferation of the MC3T3-E1 Cells
3.2. The Effect of the Radiation on the Cell Cycle of the MC3T3-E1 Cells
3.3. The Effect of the Radiation on the Cell Apoptosis of the MC3T3-E1 Cells
3.4. The Effect of the Radiation on the Cell Development of the MC3T3-E1 Cells
3.5. Screening of the Potentials Molecules Involved in the Radiation Induced Osteoblast Damage
3.6. Validation of Potentials Molecules Involved in the Radiation Induced Osteoblast Damage
3.7. Confirmation of the DNA Damage of Radiation on MC3T3-E1 Cells
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Alimova, I.; Wang, D.; Danis, E.; Pierce, A.; Donson, A.; Serkova, N.; Madhavan, K.; Lakshmanachetty, S.; Balakrishnan, I.; Foreman, N.K.; Mitra, S.; Venkataraman, S.; Vibhakar, R. Targeting the TP53/MDM2 axis enhances radiation sensitivity in atypical teratoid rhabdoid tumors. Int J Oncol. 2022, 60, 32. [Google Scholar] [CrossRef] [PubMed]
- Baxter NN, Habermann EB, Tepper JE, et al. Risk of pelvic fractures in older women following pelvic irradiation. JAMA, 2005, 294, 2587–2593.
- Bhatia, N.; Khator, R.; Kulkarni, S.; Singh, Y.; Kumar, P.; Thareja, S. Recent Advancements in the Discovery of MDM2/MDM2-p53 Interaction Inhibitors for the Treatment of Cancer. Curr Med Chem. 2023, 30, 3668–3701. [Google Scholar] [CrossRef]
- Cai LH, Chen XY, Qian W, Liu CC, Yuan LJ, Zhang L, Nie C, Liu Z, Li Y, Li T, Liu MH. DDB2 and MDM2 genes are promising markers for radiation diagnosis and estimation of radiation dose independent of trauma and burns. Funct Integr Genomics. 2023, 23, 294. [Google Scholar] [CrossRef] [PubMed]
- Chan, S.; Rowbottom, L.; McDonald, R.; David, E.; Chung, H.; Yee, A.; Turner, A.; Chow, E. Pelvic insufficiency fractures in women following radiation treatment: a case series. Ann Palliat Med. 2016, 5, 233–237. [Google Scholar] [CrossRef] [PubMed]
- Dudziak, M.E.; Saadeh, P.B.; Mehrara, B.J.; Steinbrech, D.S.; Greenwald, J.A.; Gittes, G.K.; Longaker, M.T. The effects of ionizing radiation on osteoblast-like cells in vitro. Plast. Reconstr. Surg. 2000, 106, 1049–1061. [Google Scholar] [CrossRef] [PubMed]
- Fledderus, J.O.; Goldschmeding, R. Nrf2 implicated as a novel therapeutic target for renal regeneration after acute kidney injury. Nephrol Dial Transplant. 2013, 28, 1969–1971. [Google Scholar] [CrossRef] [PubMed]
- Gal, T.J.; Munoz-Antonia, T.; Muro-Cacho, C.A.; Klotch, D.W. Radiation effects on osteoblasts in vitro: a potential role in osteoradionecrosis. Arch. Otolaryngol. Head Neck Surg. 2000, 126, 1124–1128. [Google Scholar] [CrossRef] [PubMed]
- Gannon, H.S.; Donehower, L.A.; Lyle, S.; Jones, S.N. Mdm2-p53 signaling regulates epidermal stem cell senescence and premature aging phenotypes in mouse skin. Dev Biol. 2011, 353, 1–9. [Google Scholar] [CrossRef]
- Hagemann, J.H.; Thomasova, D.; Mulay, S.R.; Anders, H.J. Nrf2 signalling promotes ex vivo tubular epithelial cell survival and regeneration via murine double minute (MDM)-2. Nephrol Dial Transplant. 2013, 28, 2028–37. [Google Scholar] [CrossRef]
- Hopewell, J.W. Radiation-therapy effects on bone density. Med Pediatr Oncol, 2003, 41, 208–211. [Google Scholar] [CrossRef]
- Karali, A.; Dall'Ara, E.; Zekonyte, J.; Kao, A.P.; Blunn, G.; Tozzi, G. Effect of radiation-induced damage of trabecular bone tissue evaluated using indentation and digital volume correlation. J Mech Behav Biomed Mater. 2023, 138, 105636. [Google Scholar] [CrossRef]
- Kim, H.S.; Cho, H.J.; Cho, H.J.; Park, S.J.; Park, K.W.; Chae, I.H.; Oh, B.H.; Park, Y.B.; Lee, M.M. The essential role of p21 in radiation-induced cell cycle arrest of vascular smooth muscle cell. J Mol Cell Cardiol. 2004, 37, 871–80. [Google Scholar] [CrossRef] [PubMed]
- Lagadec, C.; Vlashi, E.; Alhiyari, Y.; Phillips, T.M.; Bochkur Dratver, M.; Pajonk, F. Radiation-induced notch signaling in breast cancer stem cells. Int. J. Radiat. Oncol. Biol. Phys. 2013, 87, 609–618. [Google Scholar] [CrossRef] [PubMed]
- Lee SH, Cho WJ, Najy AJ, Saliganan AD, Pham T, Rakowski J, Loughery B, Ji CH, Sakr W, Kim S, Kato I, Chung WK, Kim HE, Kwon YT, Kim HC. p62/SQSTM1-induced caspase-8 aggresomes are essential for ionizing radiation-mediated apoptosis. Cell Death Dis. 2021, 12, 997. [Google Scholar] [CrossRef] [PubMed]
- Matsumura, S.; Jikko, A.; Hiranuma, H.; Deguchi, A.; Fuchihata, H. Effect of x-ray irradiation on proliferation and differentiation of osteoblast. Calcif. Tissue Int. 1996, 59, 307–308. [Google Scholar] [CrossRef]
- Molitoris BA, Dagher PC, Sandoval RM, Campos SB, Ashush H, Fridman E, Brafman A, Faerman A, Atkinson SJ, Thompson JD, Kalinski H, Skaliter R, Erlich S, Feinstein E. siRNA targeted to p53 attenuates ischemic and cisplatin-induced acute kidney injury. J Am Soc Nephrol. 2009, 20, 1754–1764. [Google Scholar] [CrossRef]
- Nayak SK, Khatik GL, Narang R, Monga V, Chopra HK. p53-Mdm2 Interaction Inhibitors as Novel Nongenotoxic Anticancer Agents. Curr Cancer Drug Targets. 2018, 18, 749–772. [Google Scholar] [CrossRef]
- Perry, M.E. Mdm2 in the response to radiation. Mol Cancer Res. 2004, 2, 9–19. [Google Scholar] [CrossRef]
- Santivasi, W.L.; Xia, F. Ionizing radiation-induced DNA damage, response, and repair. Antioxid Redox Signal. 2014, 21, 251–9. [Google Scholar] [CrossRef]
- Soriano JL, Calpena AC, Souto EB, et al. Therapy for prevention and treatment of skin ionizing radiation damage: a review. Int J Radiat Biol, 2019, 95, 537–553. [Google Scholar] [CrossRef]
- Shim, M.S.; Xia, Y. A reactive oxygen species (ROS)-responsive polymer for safe, efficient, and targeted gene delivery in cancer cells. Angew Chem Int Ed Eng, 2013, 52, 6926–6929. [Google Scholar] [CrossRef]
- Szymczyk, K.H.; Shapiro, I.M.; Adams, C.S. Ionizing radiation sensitizes bone cells to apoptosis. Bone. 2004, 34, 148–156. [Google Scholar] [CrossRef]
- Uezono, H.; Tsujino, K.; Moriki, K.; Nagano, F.; Ota, Y.; Sasaki, R.; Soejima, T. Pelvic insufficiency fracture after definitive radiotherapy for uterine cervical cancer: retrospective analysis of risk factors. J. Radiat. Res. 2013, 54, 1102–1109. [Google Scholar] [CrossRef]
- Wang, C.; Liu, S.; Li, J.; Cheng, Y.; Wang, Z.; Feng, T.; Lu, G.; Wang, S.; Song, J.; Xia, P.; Hao, L. Biological Functions of Let-7e-5p in Promoting the Differentiation of MC3T3-E1 Cells. Front Cell Dev Biol. 2021; 9, 671170. [Google Scholar]
- Wang W, Albadari N, Du Y, Fowler JF, Sang HT, Xian W, McKeon F, Li W, Zhou J, Zhang R. MDM2 Inhibitors for Cancer Therapy: The Past, Present, and Future. Pharmacol Rev. 2024, 76, 414–453. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Tang, Q.; Post, J.; Zhou, H.; Huang, X.B.; Zhang, X.D.; Wang, Q.; Sun, Y.M.; Fan, F.Y. Effect of radiation on the Notch signaling pathway in osteoblasts. Int J Mol Med. 2013, 31, 698–706. [Google Scholar] [CrossRef]
- You GR, Chang JT, Li YL, Huang CW, Tsai YL, Fan KH, Kang CJ, Huang SF, Chang PH, Cheng AJ. MYH9 Facilitates Cell Invasion and Radioresistance in Head and Neck Cancer via Modulation of Cellular ROS Levels by Activating the MAPK-Nrf2-GCLC Pathway. Cells. 2022, 11, 2855. [Google Scholar] [CrossRef]
- Zhang J, Qiu X, Xi K, et al. Therapeutic ionizing radiation induced bone loss: a review of in vivo and in vitro findings. Connect Tissue Res. 2018, 59, 509–522. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Jiang, T.; Ni, S.; Liu, W.; Luo, P.; Hao, S.; Wang, P.; Guo, L. Effects of Estrogen on Proliferation and Apoptosis of Osteoblasts through Regulating GPER/AKT Pathway. Cell Mol Biol (Noisy-le-grand). 2022, 68, 124–129. [Google Scholar] [CrossRef] [PubMed]








| Primers | GenBank accession NO. | Sequences(5´→3´) | Positions in Gene* |
Annealing temperature (°C) | PCR product (bp) |
| Cyclin B | NM_172301.3 | F: CTCAGGGTCACTAGGAACACGA | 91-112 | 59 | 156 |
| R: TTCGCTGACTTTATTACCAATGTC | 223-246 | ||||
| BAX | NM_001411994 | F: ATTGGAGATGAACTGGACAGCA | 293-314 | 59 | 54 |
| R: CACGTCAGCAATCATCCTCTG | 326-346 | ||||
| BCL2 | NM_009741 | F: CTGTGGATGACTGAGTACCTGAAC | 1924-1947 | 59 | 134 |
| R: GTCTTCAGAGACAGCCAGGAGA | 2036-2057 | ||||
| OPN | NM_001204201 | F: ACACTTTCACTCCAATCGTCC | 541-561 | 59 | 240 |
| R: TGCCCTTTCCGTTGTTGTCC | 761-780 | ||||
| RUNX2 | NM_009820.6 | F: GAGGGACTATGGCGTCAAACA | 201-221 | 59 | 70 |
| R: GGATCCCAAAAGAAGCTTTGC | 250-270 | ||||
| ALP | NM_001287172 | F: TGTGCCAGAGAAAGAGAGAGACC | 333-355 | 59 | 112 |
| R: GATGACATTCTTGGCTACATTGGT | 421-444 | ||||
| CDKN1A | NM_001111099.2 | F: TGGTGGAGACCTGATGATACC | 10-30 | 59 | 145 |
| R: ACATCACCAGGATTGGACATG | 134-154 | ||||
| GCLC | NM_010295.2 | F: ATGTCTGAGTTCAACACTGTGGA | 615-637 | 59 | 143 |
| R: CTGTGTTCTGGCAGTGTGAATC | 736-757 | ||||
| MDM2 | NM_010786.5 | F: CAGCAGCACATTGTGTATTGTTC | 437-459 | 59 | 134 |
| R: GAGTCTTGCTGACTTACAGCCAC | 548-570 | ||||
| NOTCH1 | NM_008714.3 | F: CCTGCTCACTCTCACAGAGTACA | 618-640 | 59 | 144 |
| R: CAGCGACAGATGTATGAAGACTC | 739-761 | ||||
| CCNG1 | NM_009831.3 | F: TGTGAATTTACTGGACAGATTCTTGT | 442-467 | 59 | 163 |
| R: CGTGAACCTATACTGACTTATTCGG | 580-604 | ||||
| STAG1 | NM_009282.5 | F: GAATAGCTTCTCCAGCAATGATTAC | 241-265 | 59 | 84 |
| R: CAGCATCAGAGTGGGCAGTAGT | 303-324 | ||||
| Asic1 | NM_009597.2 | F: TGATTGTGAAACCCGTTACCT | 1464-1484 | 59 | 171 |
| R: AGGTTGCAGGGCATCTCAC | 1616-1634 | ||||
| β-actin | NM_007393.5 | F: TTCCAGCCTTCCTTCTTGG | 893-911 | 59 | 104 |
| R: TTGGCATAGAGGTCTTTACGG | 976-996 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).