Submitted:
14 May 2024
Posted:
15 May 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Material and Methods
2.1. Experimental Diets
2.2. Feeding Trial, Sampling and Growth Evaluation
2.3. Chemical Composition Analysis
2.4. Analysis of Biochemical Parameters in the Hepatopancreas
2.5. Analysis of Gene Expression
| Primers name | Sequences(5’ - 3’) | Product length |
|---|---|---|
| β-actin F | TGGGTATGGAATCCGTTGGC | 101 bp |
| β-actin R | AGACAGAACGTTGTTGGCGA | |
| GAPDH F | CACCGTGCATGCTGTTACTG | 108 bp |
| GAPDH R | ACCAGTGGAGGATGGGATGA | |
| tgl F | CCCTGTGGCGTACTTGGATT | 169 bp |
| tgl R | GGCGTAGGTGCTGTTGTCGT | |
| srebp-1 F | TCTTCACACCCTCTGGACGC | 162 bp |
| srebp-1 R | CCAAGGTTGTAATGGCACGC | |
| fabp3 F | CCACCGAGGTCAAGTTCAAGC | 195 bp |
| fabp3 R | TCACACCATCACACTCCGACAC | |
| fatp4 F | GACGGCAGACACGGAAAGAGA | 101 bp |
| fatp4 R | CAGGTGGAGGCAAGCAAACTC | |
| fabp10 F | TGCTGATTGGCTCAGTGCTGTG | 115 bp |
| fabp10 R | CGTGGTCTTGATGACGATGTCG | |
| elovl6 F | TGAGAAGCGGCAATGGATGAAG | 164 bp |
| elovl6 R | TGGAGAAGAGGGCCAGGAAGAC | |
| Δ9 fad F | TGGCACAACTACCACCACGTCT | 160 bp |
| Δ9 fad R | TCCTCTTCTCGATCATCTCCGG | |
| cpt-1a F | CATCTGGACACCCACCTCCA | 183 bp |
| cpt-1a R | ATCTCCTCACCCGGCACTCT | |
| cpt-1b F | GGCATTCTCCTTTGCCATCAC | 138 bp |
| cpt-1b R | ACACCACACCGCACATTGTTC | |
| cpt-2 F | AGCAGGCAGTGGCTCAGTTTA | 169 bp |
| cpt-2 R | AAGGCAAGGAAGGGGTTGTAG | |
| caat F | CATCAAGAGCCAGGAGCCCA | 172 bp |
| caat R | CTTCAACAGCAGCCCGCAAA | |
| mttp F | TAGGACAAGCAGGACTTTCCTCA | 138 bp |
| mttp R | CCACATCCACAAACACATCAACA |
2.6. Statistical Analysis
3. Results
3.1. Growth Performance

3.2. Biochemical Parameters in the Hepatopancreas
| Parameters | ||||
|---|---|---|---|---|
| Diets | NEFA (µmol/gprot) |
LPS (U/gprot) |
TC (mmol/gprot) |
TG (mmol/gprot) |
| NF-0 | 36.56±16.49a | 1.49±0.74 | 3.98±0.42* | 34.13±2.26a |
| NF-0.004 | 20.75±7.75b | 1.83±0.38 | 4.01±0.29 | 30.29±2.13b* |
| NF-0.008 | 17.47±9.50b | 2.13±0.35 | 4.01±0.74 | 26.80±3.53c* |
| HF-0 | 26.42±6.00A | 2.44±0.65 | 3.15±0.36* | 33.61±4.66 |
| HF-0.004 | 22.65±3.48A | 1.70±0.59 | 3.46±0.55 | 38.03±3.75* |
| HF-0.008 | 21.16±9.12B | 2.73±0.88 | 3.70±0.54 | 33.31±2.61* |
| Two-way ANOVA (P value) | ||||
| Lipid level | <0.01 | NS | <0.01 | <0.01 |
| SIF | <0.01 | NS | NS | <0.01 |
| Lipid level × SIF | <0.01 | NS | NS | <0.01 |
3.3. The mRNA Expressions of Genes Related to Lipid Synthesis in the Hepatopancreas

3.4. the mRNA Expressions of Lipolysis Related Genes in the Hepatopancreas

4. Discussion
5. Conclusions
Acknowledgments
References
- Sacks, F.M.; Lichtenstein, A.; Horn, D.; Kris-Etherton, P.; Winston, M. Soy protein isoflavones and cardiovascular health. Circulation 2006, 113, 1689–1692. [Google Scholar] [CrossRef]
- Anthony, M.S.; Clarkson, T.B.; Koudy, W.J. Effectsof soy isoflavones on atherosclerosis: potential mechanisms. Am. J. of Clin. Nutr. 1998, 68, 1390–1393. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.O.; Renouf, M.; Ye, Z.; Murphy, P.A.; Hendrich, S. Isoflavone glycitein diminished plasma cholesterol in female golden Syrian hamsters. J. Agr. Food Chem. 2007, 55, 11063–11067. [Google Scholar] [CrossRef]
- Ali, A.A.; Velasquez, M.T.; Hansen, C.T.; Mohamed, A.I.; Bhathena, S.J. Effects of soybean isoflavones, probiotics, and their interactions on lipid metabolism and endocrine system in an animal model of obesity and diabetes. J. Nutr. Biochem. 2004, 15, 583–590. [Google Scholar] [CrossRef] [PubMed]
- Yao, J.T. Effects of soy isoflavones on serum FFA and hepatic PPARα mRNA expression in rats with feeding-induced metabolic syndrome. Heilongjiang University of Chinese Medicine, 2011.
- Kalaiselvan, V.; Kalaivani, M.; Vijayakumar, A.; Sureshkumar, K.; Venkateskumar, K. Current knowledge and future direction of research on soy isoflavones as a therapeutic agents. Phcog. Rev. 2010, 4, 111. [Google Scholar] [CrossRef]
- González-Granillo, M.; Steffensen, K.; Granados, O.; Torres, N.; Korach-André, M.; Ortíz, V.; Aguilar-Salinas, C.; Jakobsson, T.; Díaz-Villaseñor, A.; Loza-Valdes, A.J.D. Soy protein isoflavones differentially regulate liver X receptor isoforms to modulate lipid metabolism and cholesterol transport in the liver and intestine in mice. Diabetologia 2012, 55, 2469–2478. [Google Scholar] [CrossRef]
- Mezei, O.; Banz, W.J.; Steger, R.W.; Peluso, M.R.; Winters, T.A.; Shay, N. Soy isoflavones exert antidiabetic and hypolipidemic effects through the PPAR pathways in obese Zucker rats and murine RAW 264.7 cells. J. Nutr. 2003, 133, 1238–1243. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Zhang, W.; Zhi, S.; Zhao, M.; Liu, M.; Qin, C.; Feng, J.; Yan, X.; Nie, G. Evaluation of dietary genistein on the antioxidant capacity, non-specific immune status, and fatty acid composition of common carp (Cyprinus carpio. L). Aquaculture 2022, 550, 737822. [Google Scholar] [CrossRef]
- Grgic, D.; Varga, E.; Novak, B.; Müller, A.; Marko, D. Isoflavones in animals: metabolism and effects in livestock and occurrence in feed. Toxins 2021, 13, 836. [Google Scholar] [CrossRef]
- Cleveland, B.M.; Manor, M.L. Effects of phytoestrogens on growth-related and lipogenic genes in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. 2015, 170, 28–37. [Google Scholar] [CrossRef]
- Deng, J.; Mai, K.; Ai, Q.; Zhang, W.; Wang, X.; Xu, W.; Liufu, Z.; Cai, Y.; Chen, W. Effects of antinutritional factors on plasma lipoprotein levels in Japanese flounder Paralichthys olivaceus. J. Fish Biol. 2012, 80, 286–300. [Google Scholar] [CrossRef]
- Zhang, W. Effects of soybean saponins and soybean isoflavones on growth, physiology and intestinal health of Carassius auratus. Suzhou University, 2010.
- AOAC. Official methods of analysis of AOAC International. Association of Official Analytical Chemists, Washington DC, USA 2005.
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.L.; Wan, T.T.; Liu, X.X.; Jia, J.L.; Qin, C.B.; Nie, G.X. Regulative effects of Rehmanniae rehmanniae or Yam on growth, serum biochemical indexes and lipid metabolism of common Carp in high fat diet. Chin. Acad. Fish. Sci. 2023, 30, 48–59. [Google Scholar]
- Li, Y.; Jiang, X.; Wei, Z.; Cai, L.; Yin, J.; Li, X. Effects of soybean isoflavones on the growth performance, intestinal morphology and antioxidative properties in pigs. Animal 2020, 14, 2262–2270. [Google Scholar] [CrossRef]
- Jiang, Z.; Jiang, S.; Lin, Y.; Xi, P.; Yu, D.; Wu, T. Effects of soybean isoflavone on growth performance, meat quality, and antioxidation in male broilers. Poult. Sci. 2007, 86, 1356–1362. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.M.; Chen, S.W.; Zhang, L.S.; Feng, X.F. The effects of soy isoflavone on insulin sensitivity and adipocytokines in insulin resistant rats administered with high-fat diet. Nat. Prod. Res. 2008, 22, 1637–1649. [Google Scholar] [CrossRef]
- Payne, R.; Bidner, T.; Southern, L.; Geaghan, J. Effects of dietary soy isoflavones on growth, carcass traits, and meat quality in growing-finishing pigs. J. Anim. Sci. 2001, 79, 1230–1239. [Google Scholar] [CrossRef] [PubMed]
- Mai, K.; Zhang, Y.; Chen, W.; Xu, W.; Ai, Q.; Zhang, W. Effects of dietary soy isoflavones on feed intake, growth performance and digestibility in juvenile Japanese flounder (Paralichthys olivaceus). J. Ocean Univer. Chin. 2012, 11, 511–516. [Google Scholar] [CrossRef]
- Nestel, P.J.; Yamashita, T.; Sasahara, T.; Pomeroy, S.; Dart, A.; Komesaroff, P.; Owen, A.; Abbey, M. Soy isoflavones improve systemic arterial compliance but not plasma lipids in menopausal and perimenopausal women. Arteriosclerosis, Thrombosis, and Vasc. Bio. 1997, 17, 3392–3398. [Google Scholar] [CrossRef]
- Ørgaard, A.; Jensen, L. The effects of soy isoflavones on obesity. Exp. Bio. Med. 2008, 233, 1066–1080. [Google Scholar] [CrossRef]
- Wan, H.M. Effects of soy isoflavones on lipid metabolism and inflammatory factors in type 2 diabetic mice. Shanxi Medical University, 2021.
- Park, S.A.; Choi, M.S.; Cho, S.Y.; Seo, J.S.; Jung, U.J.; Kim, M.J.; Sung, M.K.; Park, Y.B.; Lee, M.K. Genistein and daidzein modulate hepatic glucose and lipid regulating enzyme activities in C57BL/KsJ-db/db mice. Life Sci. 2006, 79, 1207–1213. [Google Scholar] [CrossRef] [PubMed]
- Kawakami, Y.; Tsurugasaki, W.; Nakamura, S.; Osada, K. Comparison of regulative functions between dietary soy isoflavones aglycone and glucoside on lipid metabolism in rats fed cholesterol. J. Nutr. Biochem. 2005, 16, 205–212. [Google Scholar] [CrossRef]
- Mezei, O.; Li, Y.; Mullen, E.; Ross-Viola, J.S.; Shay, N.F. Dietary isoflavone supplementation modulates lipid metabolism via PPARα-dependent and-independent mechanisms. Physiol. Genomics 2006, 26, 8–14. [Google Scholar] [CrossRef]
- Lee, Y.M.; Choi, J.S.; Kim, M.H.; Jung, M.H.; Lee, Y.S.; Song, J. Effects of dietary genistein on hepatic lipid metabolism and mitochondrial function in mice fed high-fat diets. Nutrition 2006, 22, 956–964. [Google Scholar] [CrossRef]
- Storch, J.; Thumser, A.E. Tissue-specific functions in the fatty acid-binding protein family. J. Biol. Chem. 2010, 285, 32679–32683. [Google Scholar] [CrossRef] [PubMed]
- Xiao, C.W.; Wood, C.M.; Weber, D.; Aziz, S.A.; Mehta, R.; Griffin, P.; Cockell, K.A. Dietary supplementation with soy isoflavones or replacement with soy proteins prevents hepatic lipid droplet accumulation and alters expression of genes involved in lipid metabolism in rats. Genes Nutr. 2014, 9, 1–12. [Google Scholar] [CrossRef]
- Nguyen, P.; Leray, V.; Diez, M.; Serisier, S.; Bloc’h, J.L.; Siliart, B.; Dumon, H. Liver lipid metabolism. J. Anim. Physiol. Anim. Nutr. 2008, 92, 272–283. [Google Scholar] [CrossRef]
- Greene, D.H.; Selivonchick, D.P. Lipid metabolism in fish. Progress in Lipid Research 1987, 26, 53–85. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Long, X.; Deng, D.; Cheng, Y.; Wu, X.; Loor, J.J. Molecular characterization and tissue distribution of carnitine palmitoyltransferases in Chinese mitten crab (Eriocheir sinensis) and the effect of dietary fish oil replacement on their expression in the hepatopancreas. Plos One 2018, 13, e0201324. [Google Scholar] [CrossRef]
| Normal Fat | High Fat | |||||
|---|---|---|---|---|---|---|
| 0% SIF | 0.004% SIF | 0.008% SIF | 0% SIF | 0.004% SIF | 0.008% SIF | |
| Ingredients | NF-0 | NF-0.004 | NF-0.008 | HF-0 | HF-0.004 | HF-0.008 |
| Fish meal | 20 | 20 | 20 | 20 | 20 | 20 |
| Casein | 21 | 21 | 21 | 21 | 21 | 21 |
| Gelatin | 7 | 7 | 7 | 7 | 7 | 7 |
| Corn starch | 23 | 23 | 23 | 23 | 23 | 23 |
| Soybean lecithin | 2 | 2 | 2 | 2 | 2 | 2 |
| Cholesterol | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Choline chloride a | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Fish oil | 3 | 3 | 3 | 7 | 7 | 7 |
| Soybean oil | 3 | 3 | 3 | 7 | 7 | 7 |
| Arginine | 1.8 | 1.8 | 1.8 | 1.8 | 1.8 | 1.8 |
| Methionine | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Lysine | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 | 0.5 |
| Vitamin premix a | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 |
| Mineral premix b | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 | 1.5 |
| Sodium carboxymethyl cellulose | 2 | 2 | 2 | 2 | 2 | 2 |
| Attractant | 3 | 3 | 3 | 3 | 3 | 3 |
| Butylated hydroxytoluene | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
| SIF | 0 | 0.004 | 0.008 | 0 | 0.004 | 0.008 |
| Microcrystalline Cellulose | 9.1 | 9.096 | 9.092 | 1.1 | 1.096 | 1.092 |
| Proximate analysis(%)d | ||||||
| Crude protein | 45.18 | 45.52 | 44.63 | 43.68 | 43.97 | 45.71 |
| Crude lipid | 9.76 | 9.28 | 9.57 | 15.80 | 16.15 | 16.55 |
| Moisture | 9.13 | 10.32 | 10.80 | 9.63 | 9.97 | 10.25 |
| Ash | 7.56 | 7.59 | 7.59 | 7.55 | 7.48 | 7.49 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).