Submitted:
29 February 2024
Posted:
29 February 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. The preparation of SWT extract
2.2. Cell culture and treatment
2.3. Cell viability MTT assay
2.4. Reverse transcription-quantitative polymerase chain reaction assay
2.5. Statistical analysis
3. Results
3.1. SWT promoted cell viability during osteoblast differentiation
3.2. SWT altered the expression of essential bone formation genes in the differentiating osteoblast
3.3. SWT decreased cell number during osteoclast differentiation
3.4. The expression of critical bone resorptive genes were disrupted by SWT in differentiating osteoclasts
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Guo, Y.; Jiang, Q.; Gui, D.; et al. Chinese Herbal Formulas Si-Wu-Tang and Er-Miao-San Synergistically Ameliorated Hyperuricemia and Renal Impairment in Rats Induced by Adenine and Potassium Oxonate. Cell Physiol Biochem 2015, 37, 1491–1502. [Google Scholar] [CrossRef] [PubMed]
- Liang, Q.D.; Lu, X.Q.; Ma, Z.C.; et al. Preliminary study on hematopoietic constituents of Si-Wu-Tang. Zhongguo Zhong Yao Za Zhi 2004, 29, 546–549. [Google Scholar] [PubMed]
- Xie, M. Modern Study of the Medical Formulae in Traditional Chinese Medicine; Xue Yue Press: Beijing, 1997; pp. 591–602. [Google Scholar]
- Dai, Y.; But, P.P.; Chan, Y.P.; et al. Antipruritic and anti-inflammatory effects of aqueous extract from Si-Wu-Tang. Biol Pharm Bull 2002, 25, 1175–78. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Ravula, R.; Wang, Z.; et al. Traditional Chinese medicinal formula Si-Wu-Tang prevents oxidative damage by activating Nrf2-mediated detoxifying/antioxidant genes. Cell & Bioscience 2014, 4, 8. [Google Scholar] [CrossRef]
- Ohta, H.; Ni, J.W.; Matsumoto, K.; et al. Peony and its major constituent, paeoniflorin, improved radial maze performance impaired by scopolamine in rats. Pharmacology Biochemistry and Behavior 1993, 45, 719–23. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.C.; Tsai, Y.Z.; Lee, C.J.; et al. Elucidation of the effects of Si-Wu Tang on menstrual disorder patterns through activation of aromatase and antioxidation. Evidence-Based Complementary and Alternative Medicine 2019, Article ID 4761651. [Google Scholar] [CrossRef]
- Zhang, B.; Zheng, R.; Wang, Y. Study on the anti-breast cancer mechanism and bioactive components of Si-Wu-Tang by cell type-specific molecular network. Evidence-Based Complementary and Alternative Medicine 2020, Article ID 2345970. [Google Scholar] [CrossRef]
- Chang, P.J.; Lin, C.C.; Chen, Y.C.; et al. Use of herbal dietary supplement Si-Wu-Tang and health-related quality of life in postpartum women: a population-based correlational study. Evidence-Based Complementary and Alternative Medicine 2013, Article ID 790474. [Google Scholar] [CrossRef]
- Liang, Q.D.; Gao, Y.; Tan, H.L.; et al. Effects of four Si-Wu-Tang’s constituents and their combination on irradiated mice. Biological & Pharmaceutical Bulletin 2006, 29, 1378–82. [Google Scholar] [CrossRef]
- Chiu, H.F.; Wu, Y.H.; Shen, Y.C.; et al. Antioxidant and physiological effects of Si-Wu-Tang on skin and liver: a randomized, double-blind, placebo-controlled clinical trial. Chinese Medicine 2016, 11, 30. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.E.; Oh, H.; Yang, J.A.; et al. Radioprotective effects of two traditional Chinese medicine prescriptions: si-wu-tang and si-jun-zi-tang. Am J Chin Med 1999, 27, 387–396. [Google Scholar] [CrossRef] [PubMed]
- Hsu, H.Y.; Ho, Y.H.; Lin, C.C. Protection of mouse bone marrow by Si-Wu-Tang against whole body irradiation. J Ethnopharmacol 1996, 52, 113–117. [Google Scholar] [CrossRef]
- Kim, J.L.; Kang, S.W.; Kang, M.K.; et al. Osteoblastogenesis and osteoprotection enhanced by flavonolignan silibinin in osteoblasts and osteoclasts. J Cell Biochem 2012, 113, 247–259. [Google Scholar] [CrossRef]
- Nazrun, A.S.; Norazlina, M.; Norliza, M.; et al. The anti-inflammatory role of vitamin E in prevention of osteoporosis. Adv Pharmacol Sci 2012, 2012, 142702. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.M.; Chen, P.C.; Li, T.M.; et al. Si-Wu-Tang extract stimulates bone formation through PI3K/Akt/NF-κB signaling pathways in osteoblasts. BMC Complement Altern Med 2013, 13, 227. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.Z.; Teng, X.; Zhang, Z.B.; et al. Mangiferin inhibits apoptosis and oxidative stress via BMP2/Smad-1 signaling in dexamethasone-induced MC3T3-E1 cells. Int J Mol Med 2018, 41, 2517–26. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.H.; Peng, S.Y.; Cheng, M.T.; et al. Different susceptibilities of osteoclasts and osteoblasts to glucocorticoid-induced oxidative stress and mitochondrial alterations. Chin J Physiol 2019, 62, 70–79. [Google Scholar] [CrossRef] [PubMed]




| Name | Sequence (5’-3’) |
|---|---|
| Gapdh-Forward Gapdh-Reverse |
GCACAGTCAAGGCCGAGAAT GCCTTCTCCATGGTGGTGAA |
| Alp-forward Alp-reverse Opn-forward Opn-reverse Bmp-2-forward Bmp-2-reverse Ctsk-forward Ctsk-reverse Trap-forward Trap-reverse |
ATCTTTGGTCTGGCTCCCATG TTCCCGTTCACCGTCCAC AGCAAGAAACTCTTCCAAGCAA GTGAGATTCGTCAGATTCATCCG GGGACCCGCTGTCTTCTAGT TCAACTCAAATTCGCTGAGGAC CTTCCAATACGTGCAGCAGA TCTTCAGGGCTTTCTCGTTC GCTGGAAACCATGATCACCT GAGTTGCCACACAGCATCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).