Submitted:
25 July 2023
Posted:
28 July 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Material and Methods
3. Results
4. Discussion
5. Conclusions
References
- Torres-Duran M, López-Campos JL, Barrecheguren M, Miravitlles M, Martínez-Delgado B, Castillo S, et al. Alpha-1 antitrypsin deficiency: outstanding questions and future directions. Orphanet J Rare Dis 2018; 13: 114. [CrossRef]
- Figueira Gonçalves JM, Martínez Bugallo F, García-Talavera I, and Rodríguez González J. Alpha1-Antitrypsin deficiency associated with null alleles. Arch Bronconeumol 2017; 53: 700-2.
- Irving JA, Haq I, Dickens JA, Faull SV, and Lomas DA. Altered native stability is the dominant basis for susceptibility of α1-antitrypsin mutants to polymerization. Biochem J 2014; 460: 103-15. [CrossRef]
- Lomas D, and Parfrey H. Alpha 1-antitrypsin deficiency, Molecular Pathophysiology. Thorax 2004; 59: 529-35.
- Beatriz de Rienzo Modelo, Alberto M. González Chávez, Juan I. Monjarás Guerra, Nicolás González Jáuregui López, Adrián Méndez Cedillo, Ramón I. Lemus Ramírez, et al. La importancia de la deficiencia de Alfa-1 antitripsina en el desarrollo de la enfermedad pulmonar obstructiva crónica y otras patologías pulmonares. Medigraphic Neumología y Cirugía de Tórax 2008; 67: 16-23.
- Vidal R, Blanco I, Casas F, Jardí R, and Miravitlles M; Committee on the National Registry of Individuals with Alpha-1 Antitrypsin Deficiency. Guidelines for the diagnosis and management of alpha-1 antitrypsin deficiency. Arch Bronconeumol 2006; 42: 645-59.
- American Thoracic Society/European respiratory Society Statement. Standards for the diagnosis an management of individuals with alpha 1- antitrypsin deficiency. Am J Resp Clin Care Med. 2003; 168: 818-900.
- Snyder MR, Katzmann JA, Butz ML, Wiley C, Yang P, Dawson DB, et al. Diagnosis of alpha-1-antitrypsin deficiency: an algorithm of quantification, genotyping, and phenotyping. Clin Chem 2006; 52: 2236–42.
- Silverman EK, and Sandhaus RA. Alpha1-Antitrypsin Deficiency. N Engl J Med 2009; 360: 2749-57.
- Reilly JJ Silverman EK, and Shapiro SD. Chronic Obstructive Pulmonary Disease. In: Harrison´s Principles of Internal Medicine 2015 (19th Edition). McGraw-Hill Editors. ISBN: 978-0-07-1 8021 6- 1.
- Jardi R, Rodríguez-Frias F, Casas F, Cotrina M, Vidal R, Miravitlles M, et al. Molecular characterization of two variants of alpha-1-antitrypsin deficiency: Pi Mpalermo and Pi Plovel. Med Clin (Barc) 1997; 109: 463-6.
- Jardi R, Rodríguez-Frias F, López-Talavera JC, Miravitlles M, Cortina M, Costa X, et al. Characterization of the new alpha-1-antitrypsin-deficient PI M-type allele, PI M (vall d’hebron) (Pro(369)-->Ser). Hum Hered 2000; 50: 320-1. [CrossRef]
- Jardi R, Rodríguez F, Miravitlles M, Vidal R, Cotrina M, Quer J, et al. Identification and molecular characterization of the new alpha-1-antitrypsin deficient allele PI Y barcelona (Asp256-->Val and Pro391-->His). Mutations in brief no. 174. Online. Hum Mutat 1998; 12: 213.
- Lara B, Blanco I, Martínez MT, Rodríguez E, Bustamante A, Casas F, et al. Spanish Registry of Patients With Alpha-1 Antitrypsin Deficiency: Database Evaluation and Population Analysis. Arch Bronconeumol. 2017; 53: 13-8. [CrossRef]
- Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015; 17: 405-24. [CrossRef]
- The Alpha-1 antitrypsin deficiency Registry study group. Survival and FEV1 decline in individuals with severe deficiency of alpha-1 antitrypsin. Am J Respir Crit Care Med 1998; 158: 49-59.
- Wencker M, Furhmann B, and Banik N. For the Wissenschafliche Arbeitsgemeinschaft zur Therapie von Lungenerkrankunger. Longitudinal follow-up of patients with alpha-1-protease inhibitor deficiency before and during therapy with alpha-1-protease inhibitor. Chest 2001; 119: 373-44. [CrossRef]
- Stoller JK, Fallat R, Schluchter MD, O’Brien RG, Connor JT, Gross N, et al. Augmentation therapy with alpha-1 antitrypsin: patterns of use and adverse events. Chest. 2003; 123: 1425-34.
- Gotzsche PC, and Johansen HK. Intravenous alpha-1 antitrypsin augmentation therapy for treating patients with alpha-1 antitrypsine deficiency and lung disease. Cochrane Database Syst Rev 2016; 9: CD007851.
- Miravitlles M, Jardi R, Rodríguez-Frías F, Torrella M, Pelegri D, and Vidal R. Usefulness of the quantification of the alpha-1 serous protein band in the screening of alpha-1-antitrypsin deficiency. Arch Bronconeumol 1998; 34: 536-40.
- Jenkins MA. Clinical applications of capillary electrophoresis. Status at the new millennium. Mol Biotechnol 2000; 15: 201–209. [CrossRef]
- González-Sagrado M, López-Hernández S, Martín-Gil FJ, Tasende J, Bañuelos MC, Fernández-García N, et al. Alpha1-antitrypsin deficiencies masked by a clinical capillary electrophoresis system (CZE 2000). Clin Biochem 2000; 33: 79–80. [CrossRef]
- Slev PR, Williams BG, Harville TO, Ashwood ER, Bornhorst JA. Efficacy of the detection of the alpha1-antitrypsin "Z" deficiency variant by routine serum protein electrophoresis. Am J Clin Pathol 2008; 130: 568–572.
- Corda L, Medicina D, La Piana GE, Bertella E, Moretti G, Bianchi L, et al. Population Genetic Screening for alpha1-antitrypsin Deficiency in a High-Prevalence Area. Respiration 2011; 82: 418-25. [CrossRef]
- Ferrarotti I, Poplawska-Wisniewska B, Trevisan MT, Koepke J, Dresel M, Koczulla R, et al. How Can We Improve the Detection of Alpha1-Antitrypsin Deficiency? PLoS One 2015; 10: e0135316.


| EXON | Forward Primer | Reverse Primer |
|---|---|---|
| 2 | AAGGCTCCTTCCTGTCCAAG | CGCTGCTCTACATCCACTCA |
| 3 | CCATCAAGAGGGTGTTTGTGT | CGGATACCCACTCCACAAC |
| 4 | GTACTTGGCACAGGCTGGTT | ATGCATTGCCAAGGAGAGTT |
| 5 | GAGGGATGTGTGTCGTCAAG | TAGCAGTGACCCAGGGATGT |
| 6 | TAGTGTGGGTGGAGGACACA | CAGCCTGGGTCTTCATTTGT |
| 7 | GTGACAGGGAGGGAGAGGAT | CTGTTACCTGGAGCCCACAT |
| Patient | Age | Gender | α1 % | Tobacco exposure | Patient´s symptoms | Symptoms in first-degree relatives |
|---|---|---|---|---|---|---|
| 1 | 90 | F | 2.9 | No | No | Sister and daughter with asthma |
| 2 | 55 | M | 2.7 | No | Psoriasis | No |
| 3 | 36 | M | 2.8 | Yes | Infertility | No |
| 4 | 50 | F | 2.9 | No | Infertility, spondyloarthropathy and celiac disease | No |
| 5 | 62 | F | 2.5 | No | Liver fibrosis | Brother with liver insufficiency |
| 6 | 83 | M | 2.6 | No | No | Brother with lung emphysema |
| 7 | 26 | F | 2.9 | No | No | Maternal grandfather with lung emphysema |
| 8 | 19 | M | 3 | No | Liver fibrosis | Paternal grandfather with lung fibrosis |
| 9 | 50 | M | 2,7 | No | No | No |
| 10 | 50 | M | 2.7 | No | Diabetes, pancreatectomy | No |
| 11 | 61 | M | 2.6 | No | No | Two brothers with COPD |
| Patient | AAT (mg/dL) | Mutated Exon | Mutations | Phenotype |
|---|---|---|---|---|
| 1 | 44.2 | 7 | c.1096G>A (p.Glu366Ly) heterozygous | Pi*MZ |
| 2 | 72.1 | 7 | c.1096G>A (p.Glu366Ly) heterozygous | Pi*MZ |
| 3 | 28.9 | 7 | c.1066G>A (p.Ala356Thr) heterozygous | Pi*MNull |
| 4 | <10 | 5 | c.863A>T (p.Glu288Val) homozygous | Pi*SS |
| 5 | 62.7 | 5 | c.863A>T (p.Glu288Val) heterozygous | Pi*MS |
| 6 | 41.3 | 7 | c.1096G>A (p.Glu366Ly) heterozygous | Pi*MZ |
| 7 | 84.6 | 5 | c.863A>T (p.Glu288Val) heterozygous | Pi*MS |
| 8 | 73.4 | 5 and 7 | c.863A>T (p.Glu288Val) / c.1096G>A (p.Glu366Ly) | Pi*SZ |
| 9 | 63.6 | Undiscovered | Undiscovered | |
| 10 | 79.8 | 4 | c.221-223delTCT (p.Phe76del) | Pi*MM (Malton) |
| 11 | 20.5 | 5 and 7 | c.863A>T (p.Glu288Val) / c.1096G>A (p.Glu366Ly) | Pi*SZ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).