Submitted:
02 June 2026
Posted:
03 June 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Clinical Presentation and Diagnostic Odyssey
2.2. In Silico and Structural Analysis of the BTD p.(Thr459Met) Variant
2.3. In Vitro Functional Characterization: Protein Expression and Enzymatic Activity
2.4. In Vivo Validation and Variant Reclassification
3. Discussion
4. Materials and Methods
4.1. Patient and Family Recruitment
4.2. Computational Studies and Pathogenicity Prediction
4.3. DNA Extraction and Variant Confirmation
4.4. Plasmid Constructs and Site-Directed Mutagenesis
4.5. Cell Culture and Transient Transfection
4.6. Protein Detection by Western Blot
4.7. In Vitro BTD Enzymatic Assay
4.8. In Vivo BTD Enzymatic Assay
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| NGS | Next-generation sequencing |
| BTD | Biotinidase |
| VUS | Variant of uncertain significance |
| LOF | Loss of function |
References
- Secor McVoy, J.R.; Levy, H.L.; Lawler, M.; Schmidt, M.A.; Ebers, D.D.; Hart, P.S.; et al. Partial biotinidase deficiency: Clinical and biochemical features. J. Pediatr. 1990, 116(1), 78–83. [Google Scholar] [CrossRef]
- Wolf, B.; Heard, G.S.; Weissbecker, K.A.; McVoy, J.R.S.; Grier, R.E.; Leshner, R.T. Biotinidase deficiency: Initial clinical features and rapid diagnosis. Ann. Neurol. 1985, 18(5), 614–7. [Google Scholar] [CrossRef] [PubMed]
- Devanapalli, B.; Sze Hui Wong, R.; Lim, N.; Ian Andrews, P.; Vijayan, K.; Kim, W.T.; et al. Biotinidase deficiency: A treatable neurometabolic disorder. Brain Dev. Case Rep. 2024, 2(2), 100021. [Google Scholar] [CrossRef]
- Akgun, A.; Sen, A.; Onal, H. Clinical, biochemical and genotypical characteristics in biotinidase deficiency. J. Pediatr. Endocrinol. Metab. 2021, 34(11), 1425–33. [Google Scholar] [CrossRef] [PubMed]
- Wiltink, R.C.; Kruijshaar, M.E.; Van Minkelen, R.; Onkenhout, W.; Verheijen, F.W.; Kemper, E.A.; et al. Neonatal screening for profound biotinidase deficiency in the Netherlands: consequences and considerations. Eur. J. Hum. Genet. 2016, 24(10), 1424–9. [Google Scholar] [CrossRef]
- Wolf, B.; Grier, R.E.; Allen, R.J.; Goodman, S.I.; Kien, C.L. Biotinidase deficiency: the enzymatic defect in late-onset multiple carboxylase deficiency. Clin. Chim. Acta 1983, 131(3), 273–81. [Google Scholar] [CrossRef]
- Wolf, B. Biotinidase deficiency should be considered in individuals thought to have multiple sclerosis and related disorders. Mult. Scler. Relat. Disord. 2019, 28, 26–30. [Google Scholar] [CrossRef]
- Sivri, H.S.K.; Genç, G.A.; Tokatli, A.; Dursun, A.; Coşkun, T.; Aydin, H.I.; et al. Hearing loss in biotinidase deficiency: genotype-phenotype correlation. J. Pediatr. 2007, 150(4), 439–42. [Google Scholar] [CrossRef]
- Swango, K.L.; Demirkol, M.; Hüner, G.; Pronicka, E.; Sykut-Cegielska, J.; Schulze, A.; et al. Partial biotinidase deficiency is usually due to the D444H mutation in the biotinidase gene. Hum. Genet. 1998, 102(5), 571–5. [Google Scholar] [CrossRef] [PubMed]
- Norrgard, K.J.; Pomponio, R.J.; Hymes, J.; Wolf, B. Mutations Causing Profound Biotinidase Deficiency in Children Ascertained by Newborn Screening in the United States Occur at Different Frequencies than in Symptomatic Children. Pediatr. Res. 1999, 46(1), 20–7. [Google Scholar] [CrossRef]
- Karaca, M.; Özgül, R.K.; Ünal, Ö.; Yücel-Yılmaz, D.; Kılıç, M.; Hişmi, B.; et al. Detection of biotinidase gene mutations in Turkish patients ascertained by newborn and family screening. Eur. J. Pediatr. 2015, 174(8), 1077–84. [Google Scholar] [CrossRef]
- Procter, M.; Wolf, B.; Mao, R. Forty-eight novel mutations causing biotinidase deficiency. Mol. Genet Metab. 2016, 117(3), 369–72. [Google Scholar] [CrossRef] [PubMed]
- Sarafoglou, K.; Bentler, K.; Gaviglio, A.; Redlinger-Grosse, K.; Anderson, C.; McCann, M.; et al. High incidence of profound biotinidase deficiency detected in newborn screening blood spots in the Somalian population in Minnesota. J. Inherit. Metab. Dis. 2009, 32(S1), 169–73. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Yang, J.Y.; Chen, X.J. Biotinidase deficiency characterized by skin and hair findings. Clin. Dermatol. 2020, 38(4), 477–83. [Google Scholar] [CrossRef]
- Funghini, S.; Tonin, R.; Malvagia, S.; Caciotti, A.; Donati, M.A.; Morrone, A.; et al. High frequency of biotinidase deficiency in Italian population identified by newborn screening. Mol. Genet Metab. Rep. 2020, 25, 100689. [Google Scholar] [CrossRef]
- Hsu, R.H.; Chien, Y.H.; Hwu, W.L.; Chang, I.F.; Ho, H.C.; Chou, S.P.; et al. Genotypic and phenotypic correlations of biotinidase deficiency in the Chinese population. Orphanet J Rare Dis [Internet]. Available online: https://ojrd.biomedcentral.com/articles/10.1186/s13023-018-0992-2.
- Wolf, B.; Jensen, K.P.; Barshop, B.; Blitzer, M.; Carlson, M.; Goudie, D.R.; et al. Biotinidase deficiency: Novel mutations and their biochemical and clinical correlates. Hum. Mutat. 2005, 25(4), 413–413. [Google Scholar] [CrossRef]
- Kannan, B.; Navamani, H.K.; Jayaseelan, V.P.; Arumugam, P. A Rare Biotinidase Deficiency in the Pediatrics Population: Genotype-Phenotype Analysis. J. Pediatr. Genet. 2023, 12(1), 1–15. [Google Scholar] [CrossRef]
- Borsatto, T.; Sperb-Ludwig, F.; Blom, H.J.; Schwartz, I.V.D. Effect of BTD gene variants on in vitro biotinidase activity. Mol. Genet Metab. 2019, 127(4), 361–7. [Google Scholar] [CrossRef]
- Azizinejad, F.; Aminzadeh, M.; Tahmasebi-Birgani, M.; Heidari, S.; Ghandil, P. Identification of the mutations in BTD gene in Iranian patients with biotinidase deficiency and evaluating their genotype-phenotype correlations. Gene 2025, 935, 149020. [Google Scholar] [CrossRef] [PubMed]
- Sharma, R.; Kucera, C.R.; Nery, C.R.; Lacbawan, F.L.; Salazar, D.; Tanpaiboon, P. Biotinidase biochemical and molecular analyses: Experience at a large reference laboratory. Pediatr. Int. Off. J. Jpn. Pediatr. Soc. 2024, 66(1), e15726. [Google Scholar] [CrossRef]
- Sürücü Kara, İ.; Köse, E.; Koç Yekedüz, M.; Eminoğlu, F.T. A different approach to the evaluation of the genotype-phenotype relationship in biotinidase deficiency: repeated measurement of biotinidase enzyme activity. J Pediatr. Endocrinol. Metab JPEM 2023, 36(11), 1061–71. [Google Scholar] [CrossRef] [PubMed]
- Canda, E.; Kalkan Uçar, S.; Çoker, M. Biotinidase Deficiency: Prevalence, Impact And Management Strategies. Pediatr. Health Med. Ther. 2020, 11, 127–33. [Google Scholar]
- Canda, E.; Yazici, H.; Er, E.; Kose, M.; Basol, G.; Onay, H.; et al. Single center experience of biotinidase deficiency: 259 patients and six novel mutations. J. Pediatr. Endocrinol. Metab. 2018, 31(8), 917–26. [Google Scholar] [CrossRef]
- Henderson, M.P.A.; McIntosh, N.; Chambers, A.; Desormeaux, E.; Kowalski, M.; Milburn, J.; et al. Biotinidase activity is affected by both seasonal temperature and filter collection cards. Clin. Biochem. 2023, 115, 129–36. [Google Scholar] [CrossRef]
- Strovel, E.T.; Cowan, T.M.; Scott, A.I.; Wolf, B. Laboratory diagnosis of biotinidase deficiency, 2017 update: a technical standard and guideline of the American College of Medical Genetics and Genomics. Genet Med. 2017, 19(10), 1–10. [Google Scholar] [CrossRef]
- Tankeu, A.T.; Van Winckel, G.; Elmers, J.; Jaccard, E.; Superti-Furga, A.; Wolf, B.; et al. Biotinidase deficiency: What have we learned in forty years? Mol. Genet Metab. 2023, 138(4), 107560. [Google Scholar] [CrossRef]
- Wolf, B.; Norrgard, K.; Pomponio, R.J.; Mock, D.M.; McVoy, J.R.; Fleischhauer, K.; et al. Profound biotinidase deficiency in two asymptomatic adults. Am. J. Med. Genet. 1997, 73(1), 5–9. [Google Scholar] [CrossRef]
- González, E.C.; Diaz, L.; Frómeta, A.; Herrera, D.; Montenegro, A. Ensayo cuantitativo para la determinación de la actividad hidrolítica de la enzima biotinidasa. Biomédica 2001, 21(4), 360. [Google Scholar] [CrossRef]






| Name | Primer (5’→3’ sense) |
| BTD-P371S-UP | CAAGTGGAACGTGAATGCTTCTCCCACATTTCACTCTG |
| BTD-P371S-DW | CAGAGTGAAATGTGGGAGAAGCATTCACGTTCCACTTG |
| BTD-D424H-UP | GCCCTGGGGGTCTTTCATGGGCTTCACACAG |
| BTD-D424H-DW | CTGTGTGAAGCCCATGAAAGACCCCCAGGGC |
| BTD-Q436H-UP | GGCACTTACTACATCCACGTGTGTGCCCTGGTC |
| BTD-Q436H-DW | GACCAGGGCACACACGTGGATGTGTAAGTGCC |
| BTD-A458T-UP | GGACAGGAAATCACAGAGACCACGGGGATATTTGAGT |
| BTD-A458T-DW | ACTCAAATATCCCCGTGGTCTCTGTGATTTCCTTGTCC |
| BTD-T459M-UP | CAGGAAATCACAGAGGCCATGGGGATATTTGAGTTTCAC |
| BTD-T459M-DW | GTGAAACTCAAATATCCCCATGGCCTCTGTGATTTCCTG |
| BTD-R518S-UP | GGCGGCTCTCTATGGGTGCTTGTATGAGAGGG |
| BTD-R518S-DW | CCCTCTCATACAAGCACCCATAGAGAGCCGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).