Submitted:
23 May 2024
Posted:
28 May 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Participants and Sample
2.2. DNA Extraction
2.3. Library Preparation
2.4. Next-Generation Sequencing (NGS) and Data Analysis
3. Results
3.1. Angiotensin Converting Enzyme (ACE) polymorphisms
3.2. Angiotensin Converting Enzyme II (ACEII) Polymorphisms
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Martinez-Gomez, L.E.; Herrera-Lopez, B.; Martinez-Armenta, C.; Ortega-Pena, S.; Camacho-Rea, M.D.C.; Suarez-Ahedo, C.; Vazquez-Cardenas, P.; Vargas-Alarcon, G.; Rojas-Velasco, G.; Fragoso, J.M.; et al. ACE and ACE2 Gene Variants Are Associated With Severe Outcomes of COVID-19 in Men. Front Immunol 2022, 13, 812940. [Google Scholar] [CrossRef]
- Osuchowski, M.F.; Winkler, M.S.; Skirecki, T.; Cajander, S.; Shankar-Hari, M.; Lachmann, G.; Monneret, G.; Venet, F.; Bauer, M.; Brunkhorst, F.M.; et al. The COVID-19 puzzle: deciphering pathophysiology and phenotypes of a new disease entity. Lancet Respir Med 2021, 9, 622–642. [Google Scholar] [CrossRef] [PubMed]
- Rigat, B.; Hubert, C.; Alhenc-Gelas, F.; Cambien, F.; Corvol, P.; Soubrier, F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990, 86, 1343–1346. [Google Scholar] [CrossRef]
- Delanghe, J.R.; Speeckaert, M.M.; De Buyzere, M.L. COVID-19 infections are also affected by human ACE1 D/I polymorphism. Clin Chem Lab Med 2020, 58, 1125–1126. [Google Scholar] [CrossRef] [PubMed]
- Gallo Marin, B.; Aghagoli, G.; Lavine, K.; Yang, L.; Siff, E.J.; Chiang, S.S.; Salazar-Mather, T.P.; Dumenco, L.; Savaria, M.C.; Aung, S.N.; et al. Predictors of COVID-19 severity: A literature review. Rev Med Virol 2021, 31, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Iba, T.; Levy, J.H.; Levi, M.; Thachil, J. Coagulopathy in COVID-19. J Thromb Haemost 2020, 18, 2103–2109. [Google Scholar] [CrossRef]
- Pati, A.; Mahto, H.; Padhi, S.; Panda, A.K. ACE deletion allele is associated with susceptibility to SARS-CoV-2 infection and mortality rate: An epidemiological study in the Asian population. Clin Chim Acta 2020, 510, 455–458. [Google Scholar] [CrossRef] [PubMed]
- Adamzik, M.; Frey, U.; Sixt, S.; Knemeyer, L.; Beiderlinden, M.; Peters, J.; Siffert, W. ACE I/D but not AGT (-6)A/G polymorphism is a risk factor for mortality in ARDS. Eur Respir J 2007, 29, 482–488. [Google Scholar] [CrossRef] [PubMed]
- Zheng, H.; Cao, J.J. Angiotensin-Converting Enzyme Gene Polymorphism and Severe Lung Injury in Patients with Coronavirus Disease 2019. Am J Pathol 2020, 190, 2013–2017. [Google Scholar] [CrossRef] [PubMed]
- Gomez, J.; Albaiceta, G.M.; Garcia-Clemente, M.; Lopez-Larrea, C.; Amado-Rodriguez, L.; Lopez-Alonso, I.; Hermida, T.; Enriquez, A.I.; Herrero, P.; Melon, S.; et al. Angiotensin-converting enzymes (ACE, ACE2) gene variants and COVID-19 outcome. Gene 2020, 762, 145102. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, N.; Ariumi, Y.; Nishida, N.; Yamamoto, R.; Bauer, G.; Gojobori, T.; Shimotohno, K.; Mizokami, M. SARS-CoV-2 infections and COVID-19 mortalities strongly correlate with ACE1 I/D genotype. Gene 2020, 758, 144944. [Google Scholar] [CrossRef] [PubMed]
- Boraey, N.F.; Bebars, M.A.; Wahba, A.A.; Abd El Lateef, H.M.; Attia, M.A.; Elsayed, A.H.; Rashed, K.A.; Sorour, E.I.; Ahmed, M.F.; Abd-Elrehim, G.A.B.; et al. Association of ACE1 I/D polymorphism and susceptibility to COVID-19 in Egyptian children and adolescents. Pediatr Res 2024. [Google Scholar] [CrossRef] [PubMed]
- Beyerstedt, S.; Casaro, E.B.; Rangel, E.B. COVID-19: angiotensin-converting enzyme 2 (ACE2) expression and tissue susceptibility to SARS-CoV-2 infection. Eur J Clin Microbiol Infect Dis 2021, 40, 905–919. [Google Scholar] [CrossRef] [PubMed]
- Sousa, R.B.N.; Nascimento, L.; Costa, L.H.A.; Leite, V.; Borges, C.L.; Deus, J.M.; Rebelo, A.C.S.; Pinheiro, D.D.S.; Pedrino, G.R. Combinatorial analysis of ACE and ACE2 polymorphisms reveals protection against COVID-19 worsening: A genetic association study in Brazilian patients. Plos One 2023, 18, e0288178. [Google Scholar] [CrossRef] [PubMed]
- Mahmudpour, M.; Roozbeh, J.; Keshavarz, M.; Farrokhi, S.; Nabipour, I. COVID-19 cytokine storm: The anger of inflammation. Cytokine 2020, 133, 155151. [Google Scholar] [CrossRef]
- Mohlendick, B.; Schonfelder, K.; Breuckmann, K.; Elsner, C.; Babel, N.; Balfanz, P.; Dahl, E.; Dreher, M.; Fistera, D.; Herbstreit, F.; et al. ACE2 polymorphism and susceptibility for SARS-CoV-2 infection and severity of COVID-19. Pharmacogenet Genomics 2021, 31, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Sienko, J.; Marczak, I.; Kotowski, M.; Bogacz, A.; Tejchman, K.; Sienko, M.; Kotfis, K. Association of ACE2 Gene Variants with the Severity of COVID-19 Disease-A Prospective Observational Study. Int J Environ Res Public Health 2022, 19. [Google Scholar] [CrossRef]
- Varillas-Delgado, D.; Jimenez-Antona, C.; Lizcano-Alvarez, A.; Cano-de-la-Cuerda, R.; Molero-Sanchez, A.; Laguarta-Val, S. Predictive Factors and ACE-2 Gene Polymorphisms in Susceptibility to Long COVID-19 Syndrome. Int J Mol Sci 2023, 24. [Google Scholar] [CrossRef] [PubMed]
| Characteristics | All participants (N = 6) | Total ACE Polymorphisms | Total ACE II Polymorphisms |
|---|---|---|---|
| Median age (range) - yrs | 62.1 (50.9 – 80.4) | ||
| Male sex – no. (%) | 4 (66.6) | ||
| Mild | 0 | 0 | 0 |
| Moderate | 1 (16.6) | 13 | 0 |
| Severe | 3 (50.0) | 18 | 4 |
| Critical | 2 (33.3) | 4 | 1 |
| Hospitalized no. (%) | 6 (100) |
| Locus | Type | Region | Reference Allele | Found Allele | COVID-19 Severity | Participants | ||
|---|---|---|---|---|---|---|---|---|
| Moderate | Severe | Critical | ||||||
| chr17:61556298 | SNV | Intron | C | G/G | 1 | 1 | 0 | S03; S06 |
| chr17:61557200 | SNV | Exon | C | C/T | 0 | 0 | 1 | S05 |
| chr17:61559923 | SNV | Exon | C | C/T | 1 | 1 | 0 | S03; S06 |
| chr17:61562309 | SNV | Intron | C | C/T; T/T | 1 | 1 | 0 | S03; S06 |
| chr17:61562490 | INDEL | Intron | A | A/AG | 0 | 1 | 0 | S03 |
| chr17:61562553 | SNV | Intron | G | G/A; A/A | 1 | 1 | 0 | S03; S06 |
| chr17:61562774 | SNV | Intron | T | T/C; C/C | 1 | 1 | 0 | S03; S06 |
| chr17:61564052 | SNV | Exon | A | A/G; G/G | 1 | 1 | 0 | S03; S06 |
| chr17:61564522 | SNV | Intron | T | T/C; C/C | 1 | 2 | 0 | S02; S03; S06 |
| chr17:61565990 | SNV | Intron | G | G/C; C/C | 1 | 1 | 0 | S03; S06 |
| chr17:61565998 | SNV | Intron | A | A/C; C/C | 1 | 1 | 0 | S03; S06 |
| chr17:61566031 | SNV | Exon | G | G/A; A/A | 1 | 1 | 0 | S03; S06 |
| chr17:61571516 | INDEL | Intron | AGT | AGT/A | 1 | 3 | 2 | S01; S02; S03; S05; S06; S08 |
| chr17:61573761 | SNV | Exon | T | T/C; C/C | 1 | 1 | 0 | S03; S06 |
| chr17:61574442 | INDEL | Intron | ACCCTTGCCCTGCCCTGCCCA | ACCCTTGCCCTGCCCTGCCCA/ ACCCTTGCCCTGCCCA | 0 | 1 | 0 | S02 |
| chr17:61574446 | INDEL | Intron | TTGCCC | TTGCCC/T | 0 | 0 | 1 | S05 |
| chr17:61574492 | SNV | Intron | G | G/A; A/A | 1 | 1 | 0 | S03; S06 |
| Total Events | 13 | 18 | 4 | |||||
| Locus | Type | Region | Reference Allele | Found Allele | COVID-19 Severity | Participants | ||
|---|---|---|---|---|---|---|---|---|
| Moderate | Severe | Critical | ||||||
| chrX:15582265 | SNV | Exon | G | A/A | 0 | 1 | 0 | S02 |
| chrX:15589725 | SNV | Intron | C | G/G | 0 | 1 | 0 | S02 |
| chrX:15589925 | INDEL | Intron | CAAAAAAAG | CAAAAAAAG/CAAAAAAA | 0 | 1 | 1 | S02; S05 |
| chrX:15610348 | SNV | Intron | C | T/T | 0 | 1 | 0 | S05 |
| Total Events | 0 | 4 | 1 | |||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).