Submitted:
25 December 2023
Posted:
26 December 2023
You are already at the latest version
Abstract
Coilia nasus is a typical anadromous migratory fish in the lower reaches of the Yangtze River. Every year, C. nasus cluster offshore and swim upstream along the Yangtze River into the tributaries and lakes in the middle and lower reaches of the Yangtze River to breed. In this study, female C. nasus collected as the subjects from Chongming section in Shanghai, Taizhou section in Jiangsu and Anqing section in Anhui. The ovaries were used for examining in tissue sections and researching of gene expression including follicle stimulating hormone receptor (fshr), luteinizing hormone receptors (lr), kisspeptin-1 (kiss1) and forkhead box l2 (foxl2) related to the reproductive development, and the estrogen (estradiol, E2) and progesterone (17α,20β-dihydroxy-4-pregenen-3-one, 17α,20β-DHP) were also analyzed in serum levels. The results showed that, first, the growth period of oocytes was small in stage II of ovarian development, in which both E2, 17α,20β-DHP levels and gene expression were low. Then, in stage Ⅲ, the growth period of oocytes were become large, as well as the yolk granules and oil droplets began to appear. Simultaneously, E2 and expression of kiss1 and foxl2 were significantly elevated. Finally, stage Ⅳ was the period of large accumulation of nutrients in oocytes, and 17α,20β-DHP level and expression of fshr and lhr were significantly elevated. The results have enriched the theoretical study of ovarian development in the natural population of C. nasus, supplemented the biological basis of C. nasus reproduction, and scientifically supported the study of C. nasus population ecology and resource conservation.
Keywords:
Coilia nasus
; ovarian development
; organizational observation
; sex steroid hormones
; gene expression
1. Introduction
Ovarian development is mainly regulated by the endocrine system in fish. Estrogens and progestins, including estradiol (E2), 17α,20β-dihydroxy-4-pregenen-3-one (17α,20β-DHP), play essential roles in the regulation of ovarian maturation and development [1,2]. Studies have shown that E2 is produced in the follicular layer, and stimulates the hepatocytes to synthesize vitellogenin through estrogen receptor signaling and then release into bloodstream. During the maturation stage of the ovary, E2 makes the synthesis of 17α,20β-DHP in steroidogenic pathway, which induces the final maturation of the oocyte [3,4]. Oocyte maturates by 17α,20β-DHP through stimulation of maturation-promoting factor formation in oocytes [5]. A similar important role is played by genes in the regulation of ovarian development. Follicle stimulating hormone receptor (fshr) primarily mediates follicle stimulating hormone (fsh) functions in response to stimulation of ovarian follicle development and ovulation in female animals [6]. A member of the glycoprotein subfamily of the G-protein-coupled receptor superfamily, luteinizing hormone receptors (lhr) regulates reproduction in animals upon binding to luteinizing hormone (lh) [7]. In female fish, fsh is mainly involved in oocyte differentiation, development and yolk accumulation, while lh is involved in oocyte maturation and ovulation [8]. Kisspeptin-1(Kiss1) is a key regulator of the reproductive regulatory cascade with roles in regulating gonadotropin release and follicular maturation [9]. Kisspeptin is a peptide encoded by kiss1. It stimulates the release of follicle stimulating hormone and luteinizing hormone [10]. Part of the forkhead transcription factor family, forkhead box l2 (foxl2) is an upstream regulator of the P450 aromatase promoter and specific to the ovary. The main role of foxl2 is to activate the expression of cyp19a in an effort to regulate estrogen levels and modulate ovarian development [11]. In vertebrates, the foxl2 gene which encodes a highly conserved amino acid sequence is the initiating gene for ovarian development [12].
Coilia nasus (Clupeiformes: Engraulidae) is a small- moderate sized fish [13,14]. Reproductive migratory groups of C. nasus gather at the Yangtze River estuary in spring, and the clusters migrate anadromously into tributaries and lakes of the middle and lower reaches of the Yangtze River to finish reproduction [15,16]. Within the passage of migration time, the water temperature gradually increases, and the ovaries rapidly develop and mature. The spawning season of C. nasus is from June to October every year under natural conditions [17]. Xu et al. [18] showed that the oocytes in the ovaries of C. nasus at all developmental stages had obvious synchronization and belonged to the type of one- time spawning, and the ovaries could be divided into six developmental states from I-Ⅵ. Presently, more studies have been conducted on metabolic mechanisms [19], immunity [20,21], energy utilization [22,23,24], and key regulatory pathways in the liver and brain [25] during the reproductive migration of C. nasus, while relatively few studies have been conducted on factors related to ovarian development. In this study, , and investigating the changes of the factors related to the reproductive development of C. nasus at the hormone and gene levels. In order to understand the spatial and temporal characteristics of ovarian development, and investigate the changes of reproductive development at the hormone and gene levels, female C. nasus from Chongming section of Shanghai (CM), Taizhou section of Jiangsu Province (TZ) and Anqing section of Anhui Province (AQ) were chosen during the C. nasus migratory season in this study, futher observation of the ovaries at different developmental stages, levels of serum sex steroid hormones, expression patterns of genes related to the reproductive development of the ovaries were analysied. All of these enrich the study of C. nasus reproduction biology and support the conservation of C. nasus germplasm resources.
2. Materials and Methods
2.1. Survey Sample Areas and Methods
During the 2021 C. nasus migration season, three survey sample areas were set up in CM section (31° 29′ 52 ″ N, 121° 36′ 36″ E), TZ section (32° 12′ 14″ N, 119° 53′ 40″ E) and AQ section (30° 29′ 11″ N, 116° 59′ 39″ E), Figure 1. The specifications of the nets used in each segment of the river are shown in Table 1. During the survey period, except for bad weather such as typhoons, C. nasus surveys were carried out daily in TZ and AQ sections, while in CM section they were carried out at the right time according to the tidal conditions and synchronized with the measurement of water temperature data.
2.2. Sample Collection and Processing
C. nasus samples were placed on ice trays to measure body length (accurate to 0.01 mm), body mass (accurate to 0.1 g) and other growth traits. The dissected male C. nasus was used for other experiments, while the females were visually identified according to the shape, size and color of the dissected ovaries, and the ovaries were weighed (accurate to 0.1 g) [18]. On the one hand, there was no obvious difference in appearance and morphology between the spermatogonial stages Ⅲ and Ⅳ. On the other hand, the sample size of ovary stage Ⅴ was relatively small due to the limitation of body length control conditions. Therefore, stage Ⅱ, Ⅲ and Ⅳ female C. nasus were selected for the study. One side of the ovary was preserved in 10% paraformaldehyde fixative for sectioning and observation, and the other side of the ovary was put into a freezing tube and preserved in liquid nitrogen, and then transferred to a refrigerator at -80℃ for the determination of gene expression. Meanwhile, the supernatant was collected after centrifugation of their corresponding blood samples and stored in liquid nitrogen, then transferred to -80℃ refrigerator for the determination of sex steroid hormones in serum. A total of 30 female C. nasus in stages Ⅱ, Ⅲ and Ⅳ in AQ section were selected for characterization of different developmental stages, and a total of 30 female C. nasus in stage Ⅳ in CM, TZ and AQ sections were selected for spatial characteristics analysis.
Ovarian tissue section preparation The paraformaldehyde-impregnated ovaries were dehydrated using an automatic dehydrator, and after dehydration, they were prepared into wax blocks by xylene transparency and paraffin embedding, after which they were subjected to paraffin sectioning with a slice thickness of 4 μm. Hematoxylin-eosin staining(HE) was performed on paraffin tissue sections, and the sections were sealed with neutral resin. The ovarian condition of development was observed under the microscope (Olympus BX51) and photographed. The following indicators were counted according to the HE section diagrams: size of oocytes and nucleus in stage Ⅱ, Ⅲ, Ⅳ. Additionally, number and percentage of oil droplets and yolk granules in stage Ⅲ and Ⅳ.
Sex Steroid Hormone Measurement An enzyme-linked immunoassay (ELISA) was used to detect hormone levels in the serum of C. nasus. The basic principle of ELISA is to let the antibody bind to the enzyme complex, and then quantitatively detect it by color display. Serum E2 and 17α,20β-DHP indicator assay kit was purchased from Nanjing Sembega Biological Company, and all operations were carried out in strict accordance with the instructions of the kit.
Gene expression assays Primer sequences were designed using Primer Premier 5.0 software based on the sequence information of fshr, lhr, kiss1 and foxl2 genes from NCBI database (Table 2). Relative expression of the genes involved in development in the ovary using quantitative real-time PCR. The C. nasus β-actin gene was used as an internal reference, and the multiplicative relationship of the difference in expression between samples was obtained by a 2-(∆∆Ct) mathematical operation between the Ct value of the internal reference gene and the Ct value of the gene to be examined. RNA was extracted using UNIQ-10 column Trizol total RNA extraction kit, the concentration and purity of RNA were detected by multifunctional enzyme labeling instrument, the electrophoresis results of RNA were detected by electrophoresis buffer, and reverse transcription was carried out on PCR instrument, and the reaction was prepared into 10 μl reaction mixture by mixing 5 μl of SybrGreen qPCR Master Mix, 0.2 μl of Primer F (10 μm), 0.2 μl of 5 μl SybrGreen qPCR Master Mix, 0.2 μl primer F (10 μm), 0.2 μl primer R (10 μm), 3.6 μl ddH2O and 1 μl cDNA were prepared into a 10 μl reaction mixture, and added into a 96-well plate. The reaction conditions were as follows: 94 ℃ predenaturation for 3 min, amplification for 45 cycles (95 ℃ denaturation for 15 s, 60℃ annealing for 30 s), and then put into the fluorescence quantitative PCR instrument (LightCycler480 II) for detection.
2.3. Data processing and analysis
Gonadosomatic index (GSI) (%) = weight of ovary (g) / weight of fish body (g) × 100%
The experimental data were analyzed statistically using SPSS26.0 software, and significant differences were analyzed by one-way ANOVA (P < 0.05 means significant difference), and the results were expressed as "mean ± standard deviation", and the data graphs were created by GraphPad Prism8.0 software.
3. Results
3.1. Biological Characteristics of C. nasus
The GSI of stage I- V was 0.79%, 1.24%, 1.80%, 5.58% and 8.22% respectively from March to Julyn. In March, CM and TZ section were dominated by stage I and Ⅱ, accounting for 97.06% and 99.34% respectively. In April, still for stage I and Ⅱ, accounting for 89.61% and 92.21% respectively, while the AQ section were stage Ⅱ and Ⅲ, accounted for 49.01% and 45.26%. In May, in CM section was dominated in stage Ⅳ, accounting for 46.37%, and stage Ⅱ and Ⅲ in TZ and AQ sections, the accounte reached for 77.04% and 90.82% respectively. In June, CM and TZ section were mainly in stage Ⅳ and Ⅴ, accounting for 75.79% and 83.87% respectively. Meanwhile, stage Ⅱ and Ⅲ in AQ section accounted for 91.94%. In July, stage Ⅲ and Ⅳ in AQ section accounted for 51.31% and 47.38%, respectively (Figure 2). The average water temperatures from March to July showed an increasing trend, which were 15.47℃, 17.08℃, 21.87℃, 24.63℃ and 27.69℃, respectively.
3.2. Morphologic and Histologic Sections of the Ovary
The phases of the ovary are differentiated on the basis of the morphological and physiological characteristics of the oocytes during ovarian development, as well as the histological composition of the ovary itself [26], defined by the temporal phases of the germ cells that occupy more than half of the area in the ovarian tissue section or that are in the highest proportions [18].
3.2.1. Developmental Stage Characteristics of Ovarian Tissue Sections
The ovaries in stage Ⅱ were finely columnar, with inconspicuous blood vessels in the ovarian membrane and a slightly transparent light flesh-red to flesh-yellow appearance, with no oocytes visible to the naked eye. Histological observation showed that the oocytes were closely arranged, in the small growth phase of primary oocytes, dominated by the cells of the 2nd temporal phase, the oocytes of the 2nd temporal phase were round, oval or irregular polygonal, the cells had a long diameter of 78.90- 170.20 μm and a short diameter of 40.50- 120.30 μm, the cell nucleus had a diameter of 30.00- 70.10 μm, and the cytoplasm was strongly alkaline, stained with a The nucleus was 30.00- 70.10 μm in diameter, the cytoplasm was strongly basic and stained dark purple, the chromatin in the nucleus was finely linear, and the cytosol was surrounded by a single layer of follicular membrane (Figure 3 A1- A3).
The ovaries in stage Ⅲ were enlarged in the middle and smaller at both ends, with blood vessels distributed on the ovarian membrane, had a flesh-colored to light greenish appearance, and the oocytes were macroscopical. Histological observation showed that the cells were in the large growth phase of primary oocytes, dominated by the cells of the 3rd temporal phase, with a cell diameter of 168.43- 338.69 μm and a nuclear diameter of 60.62- 110.50 μm. The cell volume increased, and oil droplets of different sizes appeared in the form of 10-43 droplets, which accounted for 2.05%- 5.44% of the area of the oocyte, and the yolk began to be deposited in the form of small granules, with a number of 130- 305 granules, accounting for 21.39%- 53.68%, and radial bands appeared in the periphery (Figure 3 B1- B3).
The ovary in stage Ⅳ was enlarged in size, with enlarged oocytes visible to the naked eye, greenish to grayish in appearance, with a thin and hyaline ovarian membrane and densely vascularized. Histological observation showed that yolk granules and oil droplets filled the cells, mainly the cells in the 4th temporal phase, with a cell diameter of 278.45- 525.33 μm and a nuclear diameter of 80.00- 140.58 μm. As the yolk granules accumulated, they accounted for more than 40.20% of the cell volume, and the number of oil droplets increased, and their size became larger, and they began to merge to form large oil droplets, which accounted for about 50.50% of the cell volume. At the later stage, it filled the cell, the nucleus was gradually invisible, and the nucleolus was distributed around the nuclear membrane (Figure 3 C1- C3).
3.2.2. Spatial Characteristics of Ovarian Tissue Sections
The yolk material of C. nasus was mainly yolk granules and oil droplets. The oocytes of stage Ⅳ in TZ section (342.41±56.43 μm) were significantly smaller than those in CM section (469.63±49.02 μm) and AQ section (413.15±53.40 μm), and oil droplets accounted for a larger proportion than yolk granules in the oocytes of the CM section and the AQ section, while yolk granules dominated in TZ section (Figure 4).
3.3. Serum Neutral Steroid Hormone Levels
3.3.1. Characterization of the Developmental Phase of Sex Steroid Hormones
The levels of sex steroid hormones in C. nasus changed significantly throughout the process of ovarian development. E2 level in serum was significantly higher in stage Ⅲ [(46.22±4.32) ng/l] than in stage Ⅱ [(38.12±4.03)ng/l], and significantly lower in stage Ⅳ [(33.91±4.72)ng/l]. 17α,20β-DHP level was significantly higher in stage Ⅳ [(31.79±4.11)ng/l] than stage Ⅱ [(24.48±1.25)ng/l] and stage Ⅲ [(23.27±1.41)ng/l] (Figure 5).
3.3.2. Spatial Characterization of Sex Steroid Hormones
Both estrogen and progesterone showed significant differences during the anadromous migration of C. nasus. The E2 level was significantly higher in TZ section than in CM section and the AQ section during stage Ⅳ, and the 17α,20β-DHP level was significantly lower in TZ section than in CM section and the AQ section.
Figure 6.
Serum sex steroid levels at different sampling points of C. nasus. E2 level(A); 17α,20β-DHP level(B).
Figure 6.
Serum sex steroid levels at different sampling points of C. nasus. E2 level(A); 17α,20β-DHP level(B).

3.4. Expression Patterns of Ovarian Development-Related Genes
3.4.1. Characterization of Developmental Stages of Gene Expression
The expression of fshr, lhr, kiss1, foxl2 genes all changed significantly during the development of ovaries in C. nasus. There was no significant change in the expression of fshr and lhr in stages Ⅱ and Ⅲ, and it was significantly higher in stage Ⅳ. The expression of kiss1 gene was significantly higher in stage Ⅲ than in stages Ⅱ and Ⅳ. The expression of foxl2 showed an increasing change with the maturation of the ovary development, with the lowest expression level in stage Ⅱ, and a significant increase in the expression of stage Ⅲ and Ⅳ (Figure 7).
3.4.2. Spatial Characterization of Gene Expression
The expression of fshr was significantly higher in TZ section than CM and AQ section, and the expression of lhr was significantly higher in TZ section than CM section. There was no significant difference in the expression of kiss1 and foxl2 (Figure 8).
4. Discussion
4.1. Characterization of Ovarian Development in C. nasus
As a typical river-sea migratory fish, the anadromous migration of C. nasus is a seasonal reproductive activity [19]. C. nasus mostly lives in coastal and nearby waters, aggregates in the offshore waters of the Yangtze River estuary during spawning migration [15,23]. The increase of water temperature induces the pre-spawning migratory behavior of C. nasus and promotes its gonadal development and maturation [27,28]. The study analyzed the C. nasus in April-July 2018 of AQ sectionshowed that the main developmental stage of the ovaries was stage Ⅲ, and the ovaries began to appear in June to stage Ⅴ of C. nasus [29]. He et al. [30] investigated and studied C. nasus in AQ section from April to August 2005, found that the maturity coefficient of ovaries in stage Ⅱ and Ⅲ in April was 1.36% on average, in June, the maturity coefficient of ovaries developing to stages Ⅳ and V reached 6.66%. In this study, in the early stage of migration from March to April, the ovarian development of C. nasus was dominated by stage I and Ⅱ, the proportion of stage Ⅲ and Ⅳ increased in May. The number of C. nasus individuals in stage Ⅳ and Ⅴ increased in June and July. Overall, the proportion of ovarian mature individuals and the coefficient of ovarian maturity increased with the passage of time and the increase of water temperature in all water segments. This was consistent with the results of historical studies. Yolk, as an energy-supplying substance for ovarian development in fish, has also attracted much attention in terms of changes in its content. Observation of tissue sections showed that the ovary in stage Ⅱ was dominated by the 2nd time-phase oocytes, which were smaller, and no yolk material was produced, which was consistent with the histological characteristics in stage Ⅱ of Rhinobio ventralis [31]. In addition, the ovary in stage Ⅲ was dominated by oocytes in the 3rd temporal phase, which enlarged about onefold and began to show nutrients such as yolk granules and oil droplets, which was consistent with the findings of Girella leonina [32], and Xenocypris microlepis [33]. Moreover, ovaries in stage Ⅳ were dominated by time-phase 4 oocytes, which were almost full of nutrients such as yolk granules and oil droplets, with yolk granules becoming fuller and the area of oil droplets fused and becoming larger. Similarly, a large number of oil droplets synthesized into oil globules occurred in stage Ⅳ of Girella leonina [32]. The results of ovarian development and ovarian maturity coefficients in the present study were consistent with those of previous studies on C. nasus [17,34], reflecting the typical ecological characteristics of C. nasus in fattening and long-distance reproductive migration in different waters.
In this study, the observation of ovarian tissue sections of stage Ⅳ in CM, TZ and AQ sections revealed no significant difference in oocyte size. However, the proportion of yolk material composition of oocytes was different. Concretely, the ovarian tissue sections of the CM and AQ sections showed that oil droplets occupied about half of the cell area, and yolk granules were slightly smaller than the proportion of oil droplets, which was consistent with the results of stage Ⅳ ovarian tissue of the pond culture of C. nasus, Parabramis pekinensis, and Hippocampus erectus [18,35,36]. In contrast, ovarian tissue sections from the TZ section showed that yolk granules accounted for a larger proportion of oocytes and fewer oil droplets. This suggests that the maturity level of C. nasus collected in TZ section was lower than that in CM and AQ sections. Further development and maturation of C. nasus collected in TZ section were needed, probably because the target spawning grounds had not been reached yet, and it was necessary to continue migrating upstream to complete the reproduction of spawning [18,37].
4.2. Characterization of Changes in Serum Neutral Steroid Hormones
Sex steroid hormone levels can reflect the level of ovarian development in fish, among which E2 and 17α,20β-DHP are the main endogenous sex steroid hormones in fish, which play an important role in regulating the ovarian development process.
E2 was at a low level in stage Ⅱ, consistent with the results of Oreochromis niloticus [38], Epinephelus fuscoguttatus [39], and Schizothorax labrosus [40]. Upon ovarian development to stage Ⅲ, gonadotropins stimulate follicular and granulosa cells to co-synthesize E2, which acts through nuclear estrogen receptor signaling to induce hepatic synthesis of yolk proteins, and thus promotes ovarian vitellogenesis and accumulation [39], exhibiting a significant stage Ⅲ elevation. Existing studies have shown that high concentrations of E2 inhibit oocyte development and ovulation [41], and decrease significantly in E2 concentration when the C. nasus ovary enters stage Ⅳ in order to ensure the normal process of oogenesis may be closely related to the high expression of maturation-inducing hormones (MIHs, e.g., 17α,20β-DHP), which induces the final maturation of the oocyte [3]. The findings in fish such as Danio rerio [42], Epinephelus fasciatus [43], and Oncorhynchus keta [44] were the same as those of C. nasus in the present study, in which 17α,20β-DHP was significantly elevated in stage Ⅳ. Also these factors have a roles in inducing ovarian cell maturation and is the dominant final maturation of the ovarian hormones. Sex steroid hormones are involved in the regulation of ovarian maturation and play a role in the completion of reproductive migration.
For different river sections, the E2 level in TZ section was significantly higher than that in CM and AQ sections, and the 17α,20β-DHP level was significantly lower inTZ section than in CM and AQ sections, which indicated that the level of maturation of C. nasus in TZ section was lower than that in CM and AQ sections. Some scholars have hypothesized that C. nasus migrates at the same speed and the developmental speed of C. nasus with similar body length is also similar, so the target spawning sites of C. nasus differ from each other due to the different starting points of C. nasus migration [30,45]. In this study, the stage Ⅳ C. nasus migrating to CM section were more mature, and it was hypothesized that they might have come from waters farther away from the entrance of the Yangtze River, and their target spawning grounds might have been located near CM section [28]. Similarly, the stage Ⅳ ovaries of C. nasus migrating to AQ section were also more mature, suggests that this population may have come from waters closer to the entrance of the Yangtze River, and that the target spawning grounds may be in AQ section and further waters after the same distance of migration [29]. The stage Ⅳ ovaries of C. nasus in TZ section were less mature, and it was hypothesized that there might not be any suitable target spawning grounds in TZ section and neighboring waters. As a result, the TZ section mainly functions as a migration corridor during migration [46].
4.3. Characterization of Gene Expression Related to Ovarian Development
Fshr, lhr, kiss1, and foxl2 genes regulate the process of ovarian development and maturation by participating in physiological activities such as the synthesis of sex steroid hormones and accumulation of yolk material in oocytes. In female fish, fshr is mainly expressed in sphingocytes and granulosa cells, and lhr is mainly expressed in granulosa cells [47]. The traditional theory of animal reproduction suggests that the target organ of gonadotropin receptors (fshr and lhr) is the gonad, which indirectly affects the development and function of the reproductive organs through the regulation of gonadotropin secretion [48]. In Oncorhynchus mykiss [49] and Ctenopharyngodon idella [50] , the expression of fshr mRNA and lhr mRNA gradually increased with oocyte development. Similarly, in this study, fshr promoted yolk production and accumulation [50], and lhr was highly expressed in stage Ⅳ of C. nasus, which could promote the secretion of 17α,20β-DHP from the ovary. Thus, lhr and 17α,20β-DHP were the main factors regulating reproduction during oocyte maturation. Kiss1 was significantly higher in stage Ⅲ than in stage Ⅱ and Ⅳ, and it mainly promoted yolk formation. The expression of foxl2 was significantly higher in stage Ⅲ and Ⅳ than in stage Ⅱ. Foxl2 indirectly regulates the synthesis of E2 through the regulation of the transcription gene cyp19, and may play a promotional role in yolk production and deposition [52].
Gene expression levels also varied in C. nasus in different river sections. Fhsr and lhr expression were both higher in TZ section. Migrating from the CM section, where fresh and sea water meet, to the TZ section, which is freshwater, the change in salinity significantly increased the synthesis of sex steroid hormone-related precursors [53], resulting in elevated expression of fhsr and lhr. It also suggests that these genes respond to the effects of osmotic pressure on the gonads by regulating the synthesis of regulatory steroid hormones.
Author Contributions
Conceptualization, Y.Y. and K.L.; Methodology, S.W. and Y.Y.; Software, S.W., Y.D., and F.M.; Validation, Z.H., Y.Y., and K.L.; Formal Analysis, Y.Y.; Investigation, S.W., W.Z. and C.Y.; Resources, Z.H., and K.L.; Data Curation, W.H.; Writing – Original Draft Preparation, S.W.; Writing – Review & Editing, Y.Y., Z.H., and K.L.; Visualization, S.W.; Supervision, Z.H.; Project Administration, K.L; Funding Acquisition, K.L. All authors read and approved the final version of the manuscript.
Funding
This project was financed by the Central Public-interest Scientific Institution Basal Research Fund, CAFS(NO. 2023TD11), the Monitoring of Aquatic Biological Resources in the Jiangsu section of the main stream of the Yangtze River(2021-SJ-110-04), the Study on Resources and Fishing Management of Coilia nasus(CJBYZGL2021-24), the Investigation of Fishery Resources of the Yangtze River Estuary(JC202104).
Institutional Review Board Statement
This study was approved by the key laboratory of freshwater fisheries and germplasm resources utilization of Fishery Sciences. All animal experimental procedures followed the Guideline for the Care and Use of Laboratory Animals in China.
Conflict of Interest
The authors declare no conflict of interest.
References
- Sang, H.; Lam, H.; Hy, L.; Ky, P.; Minh, T. Changes in plasma and ovarian steroid hormone level in wild female blue tang fish Paracanthurus hepatus during a reproductive cycle. Animals 2019, 9, 889. [Google Scholar] [CrossRef] [PubMed]
- Tenugu, S.; Pranoty, A9.; Mamta, S.; Senthilkumaran, B. Development and organisation of gonadal steroidogenesis in bony fishes-a review. Aquaculture and Fisheries 2021, 6, 223–246. [Google Scholar] [CrossRef]
- Moreira, R.; Honji, R.; Melo, R.; Moraes, N.; Amaral, J.; Carvalho, A.; Hilsdorf, A. The involvement of gonadotropins and gonadal steroids in the ovulatory dysfunction of the potamodromous Salminus hilarii (Teleostei: Characidae) in captivity. Fish physiology and biochemistry 2015, 41, 1435–1447. [Google Scholar] [CrossRef]
- Tokumoto T; Tokumoto M; Horiguchi R; Ishikawa K; Nagahama Y. Diethylstilbestrol induces fish oocyte maturation. Proceedings of the National Academy of Sciences 2004, 101, 3686–3690. [Google Scholar] [CrossRef]
- Brzuska, E.; Socha, M.; Chyb, J.; Sokołowska-Mikołajczyk, M.; Inglot, M. The Effect of [(D-Ala6, Pro9NEt) mGnRH-α+ Metoclopramide] (Ovopel) on Propagation Effectiveness of Two Breeding Lines of Common Carp (Cyprinus carpio L.) and on Luteinizing Hormone and 17α, 20β-Dihydroxyprogesterone Levels in Females during Ovulation Induction. Animals 2023, 13, 14–28. [Google Scholar]
- Luo, M. Effects of heat stress on the function and related genes expression in mice ovarian granulosa cells. Nanjing Agricultural University, 2016.
- Menon, K.; Munshi, U.; Clouser, C.; Nair, A. Regulation of luteinizing hormone/human chorionic gonadotropin receptor expression: a perspective. Biology of reproduction 2004, 70, 861–866. [Google Scholar] [CrossRef] [PubMed]
- Tan, H.; Li, Y.; Rao, J.; Liu, Z. The expression of three gonadotropin subunits in response to 17α-ethynylestadiol in male pelteobagrus fulvidraco. Acta Hydrobiologica Sinica 2015, 39, 1117–1125. [Google Scholar]
- Nie, Z.; Zhao, N.; Zhao, H.; Fu, Z.; Ma, Z.; Wei, J. Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi. Genes 2023, 14, 862. [Google Scholar] [CrossRef] [PubMed]
- Kuohung, W.; Kaiser, U. GPR54 and KiSS-1: role in the regulation of puberty and reproduction. Reviews in Endocrine and Metabolic Disorders 2006, 7, 257–263. [Google Scholar] [CrossRef]
- Zhao, C.; Jiang, M.; Jiang, D.; Zhang, J.; Hou, X.; Zhu, C. Induction of Premature Reversal in Plectropomus leopardus by Letrozole. Journal of Zhanjiang Ocean University 2023, 43, 19–25. [Google Scholar]
- Fan, Z.; Zou, Y.; Liang, D.; Tan, X.; Jiao, S.; Wu, Z.; Li, J.; Zhang, P.; You, F. Roles of forkhead box protein L2 (foxl2) during gonad differentiation and maintenance in a fish, the olive flounder (Paralichthys olivaceus). Reproduction, Fertility and Development 2019, 31, 1742–1752. [Google Scholar] [CrossRef] [PubMed]
- Zhai, L.; Li, Z.; Hu, Y.; Huang, C.; Tian, S.; Wan, R.; Pauly, D. Assessment of Coilia mystus and C. nasus in the Yangtze River Estuary, China, using a length-based approach. Fishes 2022, 7, 95. [Google Scholar] [CrossRef]
- Liu, K.; Duan, J.; Xu, D.; Zhang, M.; Fang, D.; Shi, W. Present situation of Coilia nasus population features and yield in Yangtze River estuary waters in fishing season. Journal of Ecology 2012, 31, 3138–3143. [Google Scholar]
- Yuan, C. Spawning migration of Coilia nasus. Bulletin of Biology 1987, 12, 1–3. [Google Scholar]
- He, W.; Li, J.; Jiang, Z. Cytological observations on the gonad of Coilia ectenes in the Yangtze River. Journal of Shanghai Fisheries University 2006, 15, 292–295. [Google Scholar]
- He, W.; Li, J. Histological studies of gonadal development of gonad of Coilia ectenes in the Changjiang River. Journal of fisheries of China 2006, 6, 773–777. [Google Scholar]
- Xu, G.; Wan, J.; Gu, R.; Zhang, C.; Xu, P. Morphological and histological studies on ovary development of Coilia nasus under artificial farming conditions. Journal of Fishery Sciences of China 2011, 18, 537–546. [Google Scholar] [CrossRef]
- Yin, D.; Lin, D.; Ying, C.; Ma, F.; Yang, Y.; Wang, Y.; Tan, J.; Liu, K. Metabolic mechanisms of Coilia nasus in the natural food intake state during migration. Genomics 2020, 112, 3294–3305. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Xu, G.; Xu, P. Whole-genome resequencing of three Coilia nasus population reveals genetic variations in genes related to immune, vision, migration, and osmoregulation. BMC genomics 2021, 22, 1–15. [Google Scholar] [CrossRef]
- Liu, K.; Yin, D.; Shu, Y.; Dai, P.; Yang, Y.; Wu, H. Transcriptome and metabolome analyses of Coilia nasus in response to Anisakidae parasite infection. Fish & shellfish immunology 2019, 87, 235–242. [Google Scholar]
- Li, L.; Tang, W.; Zhang, Y. Changes of fatty acid content and its components in different tissues during spawning migration processes of female Coilia nasus in the lower reaches of the Yangtze River. Journal of Fisheries of China 2019, 43, 790–800. [Google Scholar]
- Guo, W. Fatty acid composition and energy utilization of Coilia nasus during spawning migration in Yangtze River. Shanghai Ocean University, 2021.
- Ma, F.; Guo, W.; Ying, C.; Yang, Y.; Xu, P.; Liu, K.; Yin, G. Changes of fatty acid components and content of Coilia nasus in the Yangtze River during spawning migration. Acta Hydrobiologica Sinica 2023, 47, 156–167. [Google Scholar]
- Wang, M.; Xu, P.; Zhu, Z. Regulation of signal transduction in Coilia nasus during migration. Genomics 2020, 112, 55–64. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Zhang, X. Study on the development and annual change in the ovary of Pelteobagrus fulvidraco. Jour Nat Scie Hunan Norm Uni 2003, 26, 73–78. [Google Scholar]
- Ma, F.; Yang, Y.; Jiang, M.; Yin, D.; Liu, K. Digestive enzyme activity of the Japanese grenadier anchovy Coilia nasus during spawning migration: influence of the migration distance and the water temperature. Journal of fish biology 2019, 95, 1311–1319. [Google Scholar] [CrossRef]
- Xue, X.; Peng, Y.; Fang, D.; Xu, D.; Wang, X.; Ren, K. Preliminary study of Coilia nasus spawning grouds at Sutong section in the lower reaches of the Yangtze River. Journal of Fisheries of China 2022, 46, 1377–1388. [Google Scholar]
- Dai, P.; Yan, Y.; Zhu, X.; Tian, J.; Ma, F.; Liu, K. Status of Coilia nasus resources in the National Aquatic Germplasm Resources Conservation Area in the Anqing Section of the Yangtze River. Journal of Fishery Sciences of China 2020, 27, 1267–1276. [Google Scholar]
- He, W.; Li, J. Study on the gonadal development pattern of the Coilia nasus in the Yangtze River. China Fisheries 2006, 05, 70–72. [Google Scholar]
- Qu, H.; Liu, Y.; Yang, Y.; Li, S.; Hu, M.; Guan, M.; Lu, X.; Wen, Z.; Guo, W. Histological change in annual development of ovary in gudgeon Rhinogobio ventralis. Fishery Sciences 2015, 34, 32–37. [Google Scholar]
- Zhu, L.; Sun, M.; Zhang, D.; Yuan, J.; Xu, S. Histological study on the ovary development of Girella leonine. Journal of Applied Oceanography 2018, 37, 255–262. [Google Scholar]
- Liu, M.; Xiong, B.; Lv, G. Histological observation of ovary development in Xenocypris microlepis. Fisheries Science 2010, 29, 125–130. [Google Scholar]
- Ma, F.; Yang, Y.; Fang, D.; Ying, C.; Xu, P.; Liu, K.; Yin, G. Characteristics of Coilia nasus resources after fishingban in the Yangtze River. Acta Hydrobiologica Sinica 2022, 46, 1580–1590. [Google Scholar]
- Gu, H.; Feng, Y.; Yang, Z.; Wang, J. Histological observation of gonadal development of white bream Parabramis pekinensis. Journal of Fisheries of China 2022, 35, 44–50. [Google Scholar]
- Chen, L.; Qin, G.; Wang, X.; Liu, Y.; Xiao, W.; Lin, Q. Distinct structures of gonads and germ cell development of lined seahorse, Hippocampus erectus. Journal of tropical oceanography 2020, 39, 93–102. [Google Scholar]
- Zhao, H. Study on long-term sperm storage and sperm energy metabolism of Sebastes schlegelii. University of Chinese Acedemy of Science, 2020.
- Li, Y. Study on the function and regulatory mechanism of transcription factor Sox3 in oogenesis of Nile tilapia(Oreochromis niloticus). Southwest University, 2021.
- Qiu, Y.; Ding, X.; Li, Z.; Duan, P.; Wang, X.; Li, L.; Wang, L.; Liu, Y.; Ma, W.; Pang, Z.; Li, S.; Tian, Y. Comparative analysis of ovarian development and sex steroid hormone levels in hybrid Jinhu grouper (Epinephelus fuscoguttatus ♀ ×Epinephelus tukula ♂) and Epinephelus fuscoguttatus. Journal of Fishery Sciences of China 2023, 30, 457–467. [Google Scholar]
- Zhao, H.; Zhao, N.; Li, L.; Qiang, Z.; Nie, Z.; Wei, J. Gonadal development and changes inconcentration of serum sex hormones in Schizothorax irregularis. Fisheries Science 2023, 42, 233–240. [Google Scholar]
- Liu, C. Effects of photoperiod on fecundity, plasma hormone content and gene expression related to ovarian development in zebrafish. Shanghai Ocean University, 2022.
- Tokumoto, T.; Yamaguchi, T.; Ii, S.; Tokumoto, M. In vivo induction of oocyte maturation and ovulation in zebrafish. PloS one 2011, 6, e25206. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Tang, Y.; Zhang, J.; Soyano, K.; Li, B. Annual ovarian development and changes in the concentration of serum sex hormones in blacktip grouper Epinephelus fasciatus. Journal of Dalian Ocean University 2020, 35, 657–662. [Google Scholar]
- Li, P.; Wang, J.; Lu, W.; Tang, F.; Liu, W. Reproduction related endocrine hormone level and gonadal decelopment of Oncorhynchus ketain pre-growth period. Guizhou Agricultural Sciences 2020, 48, 54–59. [Google Scholar]
- Dai, P.; Ma, F.; Tian, J.; Wang, Y.; Yang, Y.; Liu, K. Community structure and infection characteristics of nematodes in the Coilia nasus Anqing section of the Yangtze River. Acta Hydrobiologica Sinica 2023, 47, 917–923. [Google Scholar]
- Hu, Y.; Jiang, T.; Liu, H.; Chen, X.; Yang, J. Otolith microchemical “fingerprints” of Coilia nasus from the Taizhou section of Changjiang River in Jiangsu Province. Chinese Journal of Ecology 2023, 1–10. [Google Scholar]
- Levavi-Sivan, B.; Bogerd, J.; Mañanós, EL.; Gómez, A.; Lareyre, J. Perspectives on fish gonadotropins and their receptors. General and comparative endocrinology 2010, 165, 412–437. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L. Effects of gonadotropin and receptor on oocytes of Micropterus salmoides. Henan Normal University, 2022.
- Sambroni, E.; Gac, L.; Breton, B.; Lareyre, J. Functional specificity of the rainbow trout (Oncorhynchus mykiss) gonadotropin receptors as assayed in a mammalian cell line. Journal of Endocrinology 2007, 195, 213–228. [Google Scholar] [CrossRef] [PubMed]
- She, D.; Chen, D.; Wang, Y.; Zhou, Y.; Liu, Q.; Li, J. Molecular gene cloning and expression of gonadotropin receptors from Ctenopharyngodon idella. Life Science Research 2015, 19, 39–43. [Google Scholar]
- Lee, E.; Chakravarthi, V.; Wolfe, M.; Rumi, M. ERβ regulation of gonadotropin responses during folliculogenesis. International journal of molecular sciences 2021, 22, 10348. [Google Scholar] [CrossRef]
- Miao, X. Estradiol-induced sexual reversal and its effects on gonadal differentiation and development in mandarin fish (Siniperca chuatsi). Southwest University, 2023.
- Wang, S.; Huang, J; Liang, L; Su, B; Zhang, Y.; Liew, HJ.; Sun, B.; Zhang, L.; Chang, Y. Distinctive metabolite profiles in migrating Amur ide (Leuciscus waleckii) reveal changes in osmotic pressure, gonadal development, and energy allocation strategies. Frontiers in Environmental Science 2022, 10, 1–15. [Google Scholar]
Figure 1.
Sampling site of C. nasus in the Yangtze River. CM, Chong Ming; TZ, Tai Zhou; AQ, An Qing.
Figure 1.
Sampling site of C. nasus in the Yangtze River. CM, Chong Ming; TZ, Tai Zhou; AQ, An Qing.

Figure 2.
Spatio-temporal characteristics of ovarian development period in C. nasus breeding population.
Figure 2.
Spatio-temporal characteristics of ovarian development period in C. nasus breeding population.

Figure 3.
Morphological and histological characteristics of ovarian development of C. nasus. A1, B1, and C1 are the morphology of ovaries in stages Ⅱ, Ⅲ, Ⅳ. A2, B2, and C2 are the tissue section observation results of ovaries in stages Ⅱ, Ⅲ, Ⅳ. A3, B3, and C3 are oocytes in phases 2, 3, and 4. N: Nucleus; FT: Follicular membrane; YG: Yolk granule; OD: Oil droplet; ZR: Zona radiata.
Figure 3.
Morphological and histological characteristics of ovarian development of C. nasus. A1, B1, and C1 are the morphology of ovaries in stages Ⅱ, Ⅲ, Ⅳ. A2, B2, and C2 are the tissue section observation results of ovaries in stages Ⅱ, Ⅲ, Ⅳ. A3, B3, and C3 are oocytes in phases 2, 3, and 4. N: Nucleus; FT: Follicular membrane; YG: Yolk granule; OD: Oil droplet; ZR: Zona radiata.

Figure 4.
Morphological and histological characteristics in stage Ⅳ of ovarian development of C. nasus at different sampling points. A1, ovarian morphological characteristics at CM; A2, ovarian morphological characteristics at TZ; A3, ovarian morphological characteristics at AQ; B1, ovarian histological characteristics at CM; B2, ovarian histological characteristics at TZ; B3, ovarian histological characteristics at AQ; YG: Yolk granule; OD: Oil droplet.
Figure 4.
Morphological and histological characteristics in stage Ⅳ of ovarian development of C. nasus at different sampling points. A1, ovarian morphological characteristics at CM; A2, ovarian morphological characteristics at TZ; A3, ovarian morphological characteristics at AQ; B1, ovarian histological characteristics at CM; B2, ovarian histological characteristics at TZ; B3, ovarian histological characteristics at AQ; YG: Yolk granule; OD: Oil droplet.

Figure 5.
Serum sex steroid levels at different developmental stages of C. nasus. E2 level(A); 17α,20β-DHP level(B).
Figure 5.
Serum sex steroid levels at different developmental stages of C. nasus. E2 level(A); 17α,20β-DHP level(B).

Figure 7.
Ovarian gene expression levels at different developmental stages of C. nasus. Fshr mRNA level(A); lhr mRNA level(B); kiss1 mRNA level(C); foxl2 mRNA level(D).
Figure 7.
Ovarian gene expression levels at different developmental stages of C. nasus. Fshr mRNA level(A); lhr mRNA level(B); kiss1 mRNA level(C); foxl2 mRNA level(D).

Figure 8.
Ovarian gene expression at different sampling points of C. nasus. Fshr mRNA level(A); lhr mRNA level(B); kiss1 mRNA level(C); foxl2 mRNA level(D).
Figure 8.
Ovarian gene expression at different sampling points of C. nasus. Fshr mRNA level(A); lhr mRNA level(B); kiss1 mRNA level(C); foxl2 mRNA level(D).

Table 1.
Type and specification of the net used for collection of C. nasus samples.
| Sampling area | Sampling point | Sampling period | Net type | Net secification |
|---|---|---|---|---|
| CM | 31° 29′ 52″ N, 121° 36′ 36″ E | March- June | Throwing gill net | Length 150 m, height 12 m, mesh size 4 cm |
| TZ | 32° 12′ 14″ N, 119° 53′ 40″ E | March- June | Gill net | Length 180 m, height 4 m, mesh size 4 cm |
| AQ | 30° 29′ 11″ N, 116° 59′ 39″ E | April- July | Gill net | Length 180 m, height 4 m, mesh size 4 cm |
Table 2.
Primer sequences used in the experiment.
| Gene | Primers sequence(5’-3’) | Amplicon size(bp) |
|---|---|---|
| Coilia β-actin-F | GAGCCTCCGATCCAGACAGAG | |
| Coilia β-actin-R | CATGAAGTGTGATGTCGACATCC | |
| fshr-F | GATGCCAACCTCACATACCC | 120 |
| fshr-R | GAAGACGGGCTCCTCCAG | |
| lhr-F | ACCTCAGCAGCCTTCCCA | 113 |
| lhr-R | ATTACCGATGACAGCAGACCC | |
| kissr1-F | CTTGTTGGGCTTCTGGGTAA | 228 |
| kissr1-R | TGTCCTGTGGCGGAGTGA | |
| foxl2-F | CCGGCATGGTGAACTCTTAC | 119 |
| foxl2-R | GTTAGCGGAGGGGACAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.