Klebsiella pneumoniae (Kp) has gained prominence in the last two decades due to its global spread as a multi-drug resistant (MDR) pathogen. Further, Carbapenem-Resistant Kp are emerging at an alarming rate. The objective of this study was (1) to evaluate the prevalence of β-lactamases, especially carbapenemases in Kp isolates from India, (2) determine the most prevalent sequence type (ST) & plasmids, and their association with β-lactamases. Clinical samples of K. pneumoniae (n=65) were collected from various pathology lab, drug susceptibility and minimum inhibitory concentrations (MIC) were detected. Whole genome sequencing (WGS) was done for (n=22) resistant isolates and WGS analysis was performed using various bioinformatics tools. Additional Indian MDR Kp genomes (n=187) were retrieved using Pathosystems Resource Integration Center (PATRIC) database. Detection of β-lactamase genes, location, plasmid replicons, and ST type of genomes were carried out using CARD, mlplasmids, PlasmidFinder, and PubMLST respectively. All data were analyzed and summarized using iTOL tool. ST231 was highest, followed by ST147, ST2096 & ST14 among Indian isolates. blaAmpH was detected as the most prevalent gene followed by blaCTX-M-15, blaTEM-1. Among carbapenemase genes, blaOXA-232 was prevalent and associated with ST231, ST2096 and ST14, which was followed by blaNDM-5 which was observed to prevalent in ST147, ST395 &ST437. ST231 genomes were most commonly found to carry Col440I and ColKP3 plasmids. ST16 carried mainly ColKP3, and Col (BS512) was abundantly present in ST147 genomes. One Kp isolate with novel MLST profile was identified, which carried blaCTX-M-15, blaOXA-1 and blaTEM-1. ST16 &ST14 from this study, which is mostly dual producer of carbapenem and ESBL genes, could be emerging high-risk clones in India.

Dynamical system tools offer a complementary approach to detailed biophysical seizure modeling, with a high potential for clinical applications. This review describes the theoretical framework that provides a basis for theorizing certain properties of seizures and for their classification according to their dynamical properties at onset and offset. We describe various modeling approaches spanning different scales, from single neurons to large-scale networks. This narrative review provides an accessible overview of this field, including non-exhaustive examples of key recent works.

During the last decades West Nile Virus (WNV) outbreaks have continuously occurred in the Mediterranean area. In August 2020 a new WNV outbreak affected 71 people with meningoencephalitis in Andalusia and 6 more cases in Extremadura (south-west of Spain), causing a total of eight deaths. The whole genomes of four viral isolates were obtained and phylogenetically analyzed in the context of recent outbreaks. The Andalusian viral samples belonged to the lineage 1 and were relatively similar to previous outbreaks occurred in the Mediterranean region. Here we present a detailed analysis of the outbreak, including an extensive phylogenetic study.

Whole genome pooled sequence data of 12 Pakistani Teddy goats is analyzed for positive selection signatures as their breed defining characteristics. Selection imprints left in the Teddy genome are unveiled by genomic differentiation after the successful paired-end alignment of 635,357,043 reads with (ARS1) reference genome assembly. Pooled-heterozygosity ( ) and Tajima’s D (TD) are applied for validation and getting better hits of selection signals, while pairwise F_ST statistics is conducted on Teddy vs. Bezoar (wild goat ancestor) for genomic differentiation. Annotation of regions under positive selection reveals 59 genes underlying production and adaptive traits. score ≥ 5 detected six windows having highest scores on Chr. 29, 9, 25, 15 and 14 that harbor HRASLS5, LACE1 and AXIN1 genes which are candidate for embryonic development, lactation and body height. Secondly, TD value of ≤ -2.2 showed 4 windows with very strong hits on Chr.5 & 9 harbor STIM1 and ADM genes related to body mass and weight. Lastly, F_ST analysis generated three strong signals with threshold ≤ 0.42 on Chr.12 & 5 harbor ITGB1 gene associated with milk production & lactation traits. Other significant selection signatures encompass genes associated with wool production, prolificacy, immunity and coat colors. In brief, this study identified the genes under selection in this Pakistani goat breed that will be helpful to refining future breeding policies and converging required productive traits within and across other goat breeds and to explore full genetic potential of this valued livestock species.

Chickens have extensive phenotypic variation. The Wuhua yellow chicken (WHYC) is an important traditional yellow-feathered chicken in China, characterized by white tail feathers, white flight feathers, and strong disease resistance. However, the genomic basis of traits associated with WHYC is still poorly understood. In this study, whole genome resequencing was performed with an average coverage of 20.77-fold to investigate heritable variation and identify selection signals in WHYC. Reads were mapped onto the chicken reference genome (Galgal5) with a coverage of 85.95%. After quality control, 11,953,471 SNPs and 1,069,574 InDels were obtained. In addition, 41,408 structural variants and 33,278 copy number variants were found. A comparative genomic analysis of WHYC and other yellow-feathered chicken showed that selected regions were enriched in genes involved in transport and catabolism, immune system, infectious diseases, signal transduction, and signaling molecules and interaction. Several genes associated with disease resistance were identified, including IFNA, IFNB, CD86, IL18, IL11RA, VEGFC, and ATG10. Furthermore, PMEL and TYRP1 may contribute to the coloring of white feathers in WHYC. These findings improve our understanding of the genetic characteristics of WHYC and may contribute to future breed improvement.

Beta-lactam resistant bacteria, commonly resident in tertiary hospitals, have emerged as a worldwide health problem because of ready-to-eat vegetable intake. We aimed to characterize the genes providing resistance to beta-lactam antibiotics in Enterobacteriaceae, isolated from five commercial salad brands for human consumption in Mexico City. 25 samples were collected, grow in blood agar plates, the bacteria were biochemistry identified and antimicrobial susceptibility testing was done, the carried family genes were identified by endpoint PCR and the specific genes were confirmed with WGS by NGS. 12 positive cultures were identified and their microbiological distribution was as follows, 8.3% for Enterobacter aerogene (n=1), 8.3% for Serratia fonricola (n=1), 16.7% for Serratia marcesens (n=2), 16.7% for Klebsiella pneumoniae (n=2), and 50% (n=6) for Enterobacter cloacae. The endpoint PCR results showed 11 colonies positive for blaBIL (91.7%), 11 for blaSHV (91.7%), 11 for blaCTX (97.7%), 12 for blaDHA (100%),4 for blaVIM (33.3%), 2 for blaOXA (16.7%), 2 for blaIMP (16.7%), 1 for blaKPC (8.3%) and 1 for blaTEM (8.3%) gene, all samples were negative blaROB, blaCMY, blaP, blaCFX and blaLAP gene. The sequencing analysis revels a specific genotypes for Enterobacter cloacae (blaSHV-12, blaCTX-M-15, blaDHA-1, blaKPC-2); Serratia marcescens (blaSHV-1, blaCTX-M-3, blaDHA-1, blaVIM-2); Klebsiella pneumoniae (blaSHV-12, blaCTX-M-15, blaDHA-1); Serratia fonticola (blaSHV-12, blaVIM-1, blaDHA-1) and Enterobacter aerogene (blaSHV-1, blaCTX-M-1, blaDHA-1, blaVIM-2, blaOXA-9). Our results indicate that beta-lactam resistant bacteria have acquired integrons with a different number of genes that providing panresistance to beta-lactam antibiotics, including penicillins, oxacillins, cefalosporins, monobactams, carbapenems and imipenems.

This study analyses the case study of a deconstruction project called the ‘Whole House Reuse’ (WHR) which aimed, firstly, to harvest materials from a residential house, secondly, to produce new products using the recovered materials, and thirdly, to organize exhibition for the local public to promote awareness on resource conservation and sustainable deconstruction practices. The study applies characterization of recovered materials through deconstruction. In addition to the material recovery, the study assesses the embodied energy saving and greenhouse gas emission abatement of the deconstruction project. Around twelve tonnes of various construction materials were harvested through a systematic deconstruction approach, most which would otherwise be disposed to landfill in the traditional demolition approach. The study estimates that the recovered materials could potentially save around 502,158MJ of embodied energy and prevent carbon emission of around 27,029kg (CO2e). Deconstruction could eventually contribute to New Zealand’s national emission reduction targets. In addition, the project successfully engages local communities and designers to produce 400 new products using the recovered materials and exhibited to the local people. The study concludes that there is a huge prospect in regard to resource recovery, emission reduction, employment and small business opportunities using deconstruction of the old house. The socio-cultural importance of the WHR project is definitely immense; however, the greater benefits of such projects are often ignored and remain unreported to wider audiences as most of the external and environmental costs have not been considered in the traditional linear economy. It is acknowledged that under a favourable market condition and with appropriate support from local communities and authorities, deconstruction could contribute significantly to resource conservation and environmental protection despite its requirement of labour intensive efforts.

RNA transcripts play a crucial role as witnesses of gene expression health. Identifying disruptive short sequences in RNA transcription and regulation is essential for potentially treating diseases. Let’s delve into the mathematical intricacies of these sequences. We’ve previously devised a mathematical approach for defining a “healthy” sequence (10.14218/GE.2023.00079). This sequence is characterized by having at most four distinct nucleotides (denoted as nt≤4). It serves as the generator of a group denoted as fp. The desired properties of this sequence are as follows: fp should be close to a free group of rank nt−1, it must be aperiodic, fp should not have isolated singularities within its SL2(C) character variety (specifically within the corresponding Groebner basis). Now, let’s explore the concept of singularities. There are cubic surfaces associated with the character variety of a four-punctured sphere denoted as S24. When we encounter these singularities, we find ourselves dealing with some algebraic solutions of a dynamical second-order differential (and transcendental) equation known as the Painlevé VI equation (10.3390/dynamics4010001). In certain cases, S24 degenerates, in the sense that two punctures collapse, resulting in a “wild” dynamics governed by the Painlevé equations of an index lower than VI. In our paper, we provide examples of these fascinating mathematical structures within the context of miRNAs. Specifically, we find a clear relationship between decorated character varieties of Painlevé equations and the character variety calculated from the seed of oncomirs. These findings should find applications in cancer research.

Flax seed is one of the richest plant sources of linolenic acid (LIN) and also contains unsaturated linoleic acid (LIO) and oleic acid (OLE). Stearoyl-ACP desaturases (SAD) and fatty acid desaturases (FAD) play a key role in the synthesis of flax fatty acids (FA). We sequenced flax seed transcriptomes at the 3, 7, 14, 21, and 28 day after flowering (DAF) for ten flax varieties with different oil FA compositions grown under three temperature/watering conditions. Expression levels of 25 genes of SAD, FAD2, and FAD3 families were evaluated. FAD3b, FAD3a, FAD2b-2, SAD3-1, SAD2-1, SAD2-2, SAD3-2, FAD2a-1, and FAD2a-2 had the highest expression levels, which changed significantly during seed development. These genes probably play a key role in the FA synthesis in flax seeds. High temperature and insufficient watering shifted the maximum expression levels of the FAD and SAD genes to earlier development stages, while the opposite trend was observed for low temperature and excessive watering. Differences in FAD and SAD expression profiles under different growth conditions could contribute to the FA composition of linseed oil. Stop codons in the FAD3a gene, resulting in reduced LIN content, decreased the level of the FAD3a transcript. Some difference in reaching the maximum expression level during seed development was observed between 1) SAD3-1, SAD3-2, and FAD2b-2 and 2) SAD2-1, SAD2-2, FAD2a-1, FAD2a-2, FAD3a, and FAD3b. These groups possibly contribute somewhat differently to the synthesis of FA at different development stages.

Colorectal cancer is a high-incidence tumor that has a high mortality rate due to its frequent metastasis to the liver. The difference in genes, proteins, and immune microenvironment between the primary and metastatic sites causes them to show different responses to treatment. Colorectal cancer liver metastasis patients also tend to show poorer treatment response and prognosis. Therefore, in this paper, we summarize the heterogeneity exhibited after colorectal cancer liver metastasis from five aspects (gene, transcriptome, protein, metabolism, and immunity), and we found that except for the genetic heterogeneity, the other four aspects exhibite significant heterogeneity, which might serve as a new therapeutic direction and a prognostic marker for patients with liver metastasis. Finally, the therapeutic modalities regarding tumors are rapidly evolving, and we have also summarize the new clinical therapeutic modalities currently proposed based on these heterogeneities, aiming to provide new therapeutic ideas for the clinical treatment of patients with colorectal cancer liver metastases.

Pigs are susceptible to cold stress due to the absence of brown fat caused by the partial deletion of uncoupling protein 1 during their evolution. Some local pig breeds in China, exhibit potential cold adaptability, but research has primarily focused on fat and intestinal tissues. Skeletal muscle plays a key role in adaptive thermogenesis in mammals, yet the molecular mechanism of cold adaptation in porcine skeletal muscle remains poorly understood. This study investigated the cold adaptability of two pig breeds, Mashen pigs (MS) and Large White pigs (LW), in a 4-day cold (4°C) or room temperature (25°C) environment. We recorded phenotypic changes and collected blood, and longissimus dorsi muscle for transcriptome sequencing. Finally, a candidate gene was randomly selected for functional exploration in porcine skeletal muscle satellite cells. A decrease in body temperature and body weight in both LW and MS pigs under cold stress, accompanied by increased shivering frequency and respiratory frequency. However, MS pigs demonstrated stable physiological homeostasis, indicating a certain level of cold adaptability. LW pigs primarily responded to cold stress by regulating heat production and Glycolipid energy metabolism. MS pigs exhibited a distinct response to cold stress, involving regulation of heat production, energy metabolism pathways, robust fatty acid oxidation ability, and stronger immune response. Furthermore, the functional exploration of PRSS8 in porcine skeletal muscle satellite cells revealed it affected cellular energy metabolism and thermogenesis by regulating ERK phosphorylation. These findings shed light on the diverse transcriptional responses of skeletal muscle in LW and MS pigs under cold stress, offering valuable insights into the molecular mechanisms underlying cold adaptation in pigs.

In recent years, many studies have reported that several distinct families of transcription factor (TF) genes play crucial roles in the response of plants to abiotic stress. Although some of these families got systematically studied in many species, little knowledge exists about these genes in oil palm (Elaeis guineensis Jacq.). In this study, 20 genes differentially expressed in the leaves of oil palm plants subjected to salinity or drought stress and encoding TFs belonging to four families of TFs - MYB, HD-ZIP, NF-Y, and HSFF - got selected for further characterization. The genes underwent a structural and functional annotation, besides having their RNA-Seq expression profile validated by the qPCR technique, and a correlation analysis of their response under both stresses got performed. The annotation analysis of the promoter region showed the presence of seven cis-acting elements, all already reported to be involved in plants' response to abiotic stress. The structural and functional characterization of the proteins encoded by the selected genes showed that some groups present patterns of conserved regions and are orthologs to genes already linked to salinity or drought resistance in other plant species. It was possible to confirm the RNA-Seq expression profile of 19 genes, only gene 4 showed the opposite response when using qPCR. Through correlation analysis, it was possible to observe a high level of similarity in the behavior of the 20 genes in response to drought or salinity stress, a behavior already reported in other species. The results presented here shed light on the role of 20 TFs in the leaves of young oil palm plants under severe levels of soil salinity or water deprivation. The high level of similarity in the molecular response to both stresses allowed the identification of genes that might grant strategies aiming to develop oil palm plants with a tolerance to both salinity and drought at once.

Rapeseed (Brassica napus L.) is a globally important oilseed crop with various uses, including consumption of its succulent stems as a seasonal vegetable, but its uniaxial branching habit limits the stem yield. Therefore, developing a multi-stem rapeseed variety has become increasingly crucial. In this study, a nature mutant of wild type from germplasm resources with stable inheritance of the multi-stem trait (MS) was obtained and showed abnormal shoot apical meristem (SAM) development and increased main stem number compared to WT. Histological and scanning electron microscopy analyses revealed multiple SAMs in the MS mutant, while only a single SAM was found in WT. Compared to WT, the mutant exhibited increased accumulation of cytokinins (CKs), transcriptome and RT-qPCR analyses showed the expression of genes involved in CK biosynthesis and metabolism pathways were altered in MS mutant. These findings provide insight into the mechanism of multiple main stems formation in Brassica napus L. and lay a theoretical foundation for breeding multi-main stem rapeseed vegetable varieties.

In the last couple of years, the implementation of long-read sequencing (LRS) technologies for transcriptome profiling has uncovered an extreme complexity of viral gene expression. In this study, we carried out a systematic analysis on the pseudorabies virus transcriptome by combining our current data obtained by using Pacific Biosciences Sequel and Oxford Nanopore Technologies MinION sequencings with our earlier data generated by other LRS and short-read sequencing techniques. As a result, we identified a number of novel genes, transcripts, and transcript isoforms, including splice and length variants, and also confirmed earlier annotated RNA molecules. One of the major findings of this study is the discovery of a large number of 5’-truncated putative mRNAs embedded into larger host mRNAs. A large fraction of these RNA molecules contain in-frame ORFs, which may encode N-terminally truncated polypeptides. These study demonstrates that the PRV transcriptome is much more complex than previously appreciated.

Plants grown under fluctuating light impact plant developments compared with those grown under non-fluctuating light conditions. However, our knowledge on the underlying regulatory mechanisms is still quite limited, particularly from the transcriptional perspective. In order to investigate the influence of different light intensity distributions on tomato plant development, we designed three fluctuating light intensity distributions with the non-fluctuating light intensity as control and compared the transcriptional differences after five weeks of treatment. We found plant height and aerial/root weight were significantly reduced under all fluctuating light treatments. Transcriptome analysis revealed that the number of up and down regulated genes had a distinct distribution pattern between different treatments and control. The largest difference between the numbers of down and up regulated genes was found between treatment 1 and 3, reaching to a total of 416 genes. The number and type of the top 20 enriched pathways differed between treatments and control. The largest number of genes enriched was involved in the biosynthesis of secondary metabolites. These results provide insights into the transcriptional regulations of tomato under different light intensity distributions.

Whole-body electromyostimulation (WB-EMS) can be considered as a time-efficient, joint-friendly and highly customizable training technology that attracts a wide range of users. The present evidence map aimed to provide an overview of different non-athletic cohorts addressed by WB-EMS research. Based on a comprehensive systematic search according to PRISMA, eighty-six eligible longitudinal trials were identified that correspond with our eligibility criteria. In summary, WB-EMS research sufficiently covers all adult age categories in males and females. Most cohorts addressed (58%) were predominately or exclusively overweight/obese and in about 60% of them, diseases or conditions were inclusion criteria for the trials. Cohorts specifically addressed by WB-EMS trials suffer from cancer/neoplasm (n=7), obesity (n=6), diabetes mellitus (n=5), the metabolic syndrome (n=2), nervous system diseases (n=2), chronic heart failure (n=4), stroke (n=1), peripheral arterial diseases (n=2), knee arthrosis (n=1), sarcopenia (n=3), chronic unspecific low back pain (n=4), and osteopenia (n=3). Chronic kidney disease was an eligibility criterion in five WB-EMS trials. Finally, three studies included only critically ill patients, two further studies considered frailty as an inclusion criterion. Of importance, no adverse effects of the WB-EMS intervention were reported. In summary, evidence gaps of WB-EMS research were particular evident for cohorts with diseases of the nervous and cerebrovascular system.

Functional neurological disorders (FND) are relatively frequent disabling conditions. Given their complexity, multidisciplinary rehabilitation is envisaged. Whole-body cryostimulation (WBC) represents a promising adjuvant treatment, mainly because of its anti-inflammatory and exercise-mimicking effects. Here, we propose a novel use of WBC in a wheelchair-ridden 61-year-old woman diagnosed with FND and other comorbidities, who, after several therapeutic and rehabilitation failures, underwent a multidisciplinary rehabilitation program including WBC. The 4-week program included physiotherapy, nutritional intervention, psychological support, and WBC. Questionnaires to assess disease impact, pain level, perceived fatigue and sleep quality were administered. At discharge, improvements in body composition, haematological biomarkers, physical performance, and questionnaire scores were observed. The patient was able to walk with a walker for medium distances, even outdoors. We observed unprecedented improvements, particularly in functional parameters and questionnaire scores. Although we cannot ascertain to which extent WBC per se contributed to the improvements measured, subjective reporting and our clinical observation were that WBC, the only intervention not previously experienced by the patient, acted as a booster for the rehabilitation interventions. Further research will be necessary to rule out any possible placebo effect and to assess the effects of WBC on FND.

The genome sequencing technologies reveal the molecular mechanisms of differentiated thyroid cancer (DTC). Unlike somatic mutation analysis from thyroidectomy samples, germline mutations showing genetic susceptibility to DTC are less understood. The study aimed to assess the prevalence of germline mutations predisposing to DTC in a cohort of Polish individuals based on their whole genome sequencing (WGS) data. We analyzed sequencing data from 1076 unrelated individuals, released openly for academic and clinical research as The Thousand Polish Genomes database (https://1000polishgenomes.com). The list of genes chosen for further analysis was based on the review of previous studies. The cohort contained 104 variants located within the coding and noncoding DNA sequences of 90 genes selected by ClinVar classification as pathogenic and potentially pathogenic. The frequency of variants in the Polish cohort (our study) was compared to the frequency estimated for the non-Finnish European population, obtained from the gnomAD database (gnomad.broadinstitute.org). Statistically significant variants included 23 genes. Even though the Polish population is genetically similar to other European populations, there are significant differences in variant frequencies contributing to the disease development and progression, such as RET, CHECK2, BRCA1, SLC26A4 or TERT. Further studies are needed to identify genomic variants associated directly with DTC.

In the last decades, technological advances related to RNA manipulation enabled and expanded its application in vaccine development. This approach comprises synthetic single-stranded mRNA molecules that direct the translation of the antigen responsible for activating the desired immune response. The success of RNA vaccines depends on the delivery vehicle employed. Among the systems, yeasts emerge as a new approach to a natural delivery platform. The presence of β-glucans and mannans in its wall is responsible for the adjuvant action of this system. Yeasts are already employed to deliver protein antigens, with success and efficacy demonstrated through pre-clinical and clinical trials. Yeast β-glucan capsules, microparticles, and nanoparticles are capable of modulating host immune responses and have a high capacity to carry RNA and small molecules, with bioavailability upon oral immunization and with targeting to receptors present in anti-gen-presenting cells (APCs). Besides, yeasts are interesting vehicles for the protection and specific delivery of therapeutic vaccines based on shRNA or dsRNA. In this review, we present an overview of the attributes of yeast or its derivatives for the delivery of RNA-based vaccines, discussing their current challenges and prospects for using this promising strategy.

The efficacy of predicting geochemical parameters with a 2-chain workflow using spectral data as the initial input is evaluated. Spectral measurements spanning the approximate 400-25000nm spectral range are used to train a workflow consisting of a non-negative matrix function (NMF) step, for data reduction, and a random forest regression (RFR) to predict 8 geochemical parameters. Approximately 175000 spectra with their corresponding chemical analysis were available for training, testing and validation purposes. The samples and their spectral and chemical parameters represent 9399 drillcore. Of those, approximately 20000 spectra and their accompanying analysis were used for training and 5000 for model validation. The remaining pairwise data (150000 samples) were used for testing of the method. The data are distributed over 2 large spatial extents (980 km2 and 3025 km2 respectively) and allowed the proposed method to be tested against samples that are spatially distant from the initial training points. Global R2 scores and wt.% RMSE on the 150000 validation samples are Fe(0.95/3.01), SiO2(0.96/3.77), Al2O3(0.92/1.27), TiO(0.68/0.13), CaO(0.89/0.41), MgO(0.87/0.35), K2O(0.65/0.21) and LOI(0.90/1.14), given as Parameter(R2/RMSE), and demonstrate that the proposed method is capable of predicting the 8 parameters and is stable enough, in the environment tested, to extend beyond the training sets initial spatial location.

Young women with breast cancer represent 15% of cancer cases in Latin America. Genomic studies have found that early-onset breast-cancer cases exhibit a higher genetic susceptibility and a specific genomic signature as compared to their older counterparts. The aim of this study was to describe clinically relevant germline mutations in a cohort of young women with breast cancer. To achieve this, we analyzed hereditary-cancer genes from whole-exome sequencing data in 108 unrelated women with an extreme phenotype of breast cancer (≤40 years of age), diagnosed and treated at the National Cancer Institute of Mexico; 11% of the patients carried a pathogenic variant. BRCA2 comprised 46% of the mutations, followed by BRCA1 with 23%; PALB2 with 15%; and TP53 and RAD51C with 8 % each. This article describes a novel pathogenic mutation in RAD51C c.519dupT. The median age at diagnosis was 35 years overall; however, it was six years younger in patients with mutations. Age at diagnosis (OR=0.82, CI 95% 0.71-0.94; P= 0.008) and first-degree family history of cancer (OR=8.26, CI95% 1.35-50; P= 0.022) were the only epidemiological variables associated with mutational status. We found no differences in disease-free survival (p=0.403) or overall survival (p=0.735) among mutational status subgroups.

Plant transcriptomes are an extremely dynamic entities shaped spatially and temporally by many intracellular and environmental cues. In this review, we first summarize the complexity and diversity of plant genomes and transcriptomes as a start point for the multitude of transcriptomic responses. Numerous alterations within various tissue and organ-specific transcriptomes as well as the most relevant transcriptomic responses associated with plant acclimation to selected abiotic and biotic stress conditions, from the current studies employing high-throughput transcriptomic analysis are widely discussed. Understanding changes within plant transcriptomes, revealed by in silico functional analysis, allows for the characterization of stress-affected genes and stress acclimatory mechanisms, as well as allows to perform plant metabolic engineering. The latter allow cultivars to produce more secondary metabolites in the future, which are often desirable substances in the biomedical industry. Accordingly, in this review special attention was also paid to characterize the potential of transcriptomic analyses of medicinal species, particularly to search for new cultivars. Extensive characterization of transcriptomic responses in stress would also result in the development of new cultivars that display physiological and molecular mechanisms that allow them to cope with adverse environmental conditions more adequately.

Apple red flesh coloration is a result of the performance of biochemical pathway involved in the biosynthesis of anthocyanins and anthocyanidins. Based on apple genome analysis, high number of regulatory genes, mainly transcription factors such as MYB, which are components of regulatory complex MYB-bHLH-WD40, and several structural genes (PAL, 4CL, CHS, CHI, F3H, DFR, ANS, UFGT) involved in anthocyanin biosynthesis have been identified so far. In this study, we investigated previously unrecognized genes involved in the constitution of red-flesh apple phenotype. These genes could be concerned as molecular markers for early selection of new apple cultivars. Based on comparative transcriptome analysis of apples with different fruit flesh coloration, we successfully identified and characterized ten genes from plant hormone transduction pathway of: auxin (GH3); cytokinins (B-ARR); gibberellins (DELLA); abscisic acid (SnRK2 and ABF); brassinosteroids (BRI1, BZR1 and TCH4); jasmonic acid (MYC2); and salicylic acid (NPR1). In presented studies an analysis of their expression profiles was performed in immature and ripe fruits of red-fleshed cultivars. Generally, we have uncovered, the set of the novel genes, mediating regulation of the abscisic acid, salicylic acid, cytokinins and jasmonic acid signaling and preliminarily described their role in anthocyanin biosynthesis, accumulation and degradation. Their expression was not characterized in apple fruits so far. Presented study, allowed to underline the relationship of genes from hormone signal transduction pathway with UFGT gene, directly responsible for anthocyanin color transformation as well as confirmed their crucial role of plant hormone regulation and anthocyanin accumulation during apple fruit ripening.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Neurodegenerative diseases, such as Alzheimer’s disease and Parkinson’s disease, are caused by a combination of multiple events that damage neuronal function. A well-characterized biomarker of neurodegeneration is proteinaceous aggregates accumulation in the brain. However, the gradually worsening symptoms of neurodegenerative diseases are unlikely to be solely due to the result of a mutation in a single gene, but rather a multi-step process involving epigenetic changes. Multiple epigenetic studies have revealed that modification of histones accompanied by both the local and global remodeling of the chromatin structure and alternations in transcriptional patterns are closely associated with the pathogenesis of neurodegenerative diseases. Unlike DNA mutations, epigenetic alterations are reversible, and therefore raise the possibilities for therapeutic intervention including dietary modifications. Additionally, reactive oxygen species may contribute to the pathogenesis of Alzheimer’s disease and Parkinson’s disease. Given that the antioxidant properties of plant-derived phytochemicals are likely to exhibit pleiotropic effects against ROS-mediated epigenetic alternation, dietary intervention may be promising for the management of neurodegeneration in these diseases. In this review, the state-of-the-art applications using single-cell multi-modal omics approaches including genetics, and epigenetics, and dietary approaches for the identification of novel biomarkers and therapeutic approaches for the treatment of neurodegenerative diseases are discussed.

Acanthamoeba keratitis (AK) is a blinding corneal infection caused by the protozoan Acanthamoeba. The long-term course of AK suggests the host immunity could not kill Acanthamoeba rapidly. The immune status is still unclear in the late stage of AK. The comparative transcriptome analysis was made based on the bulk RNA sequencing of cornea tissues from AK patients and donors. Differentially expressed genes and enriched signaling pathways were calculated. CIBERSORT algorithm was used for Immune infiltration analysis of cornea tissue between AK and normal controls. A total of 2668 differentially expressed genes, including 1477 upregulated genes and 1191 downregulated genes, were detected. Gene Ontology analysis revealed that the pathways were significantly enriched in leukocyte migration, regulation of T cell activation, the external side of plasma membrane, collagen-containing extracellular matrix, immune receptor activity and cytokine binding. KEGG pathway analysis showed that the pathways were significantly enriched in the cytokine-cytokine receptor interaction, hematopoietic cell lineage and Staphylococcus aureus infection pathway. The immune infiltration profiles varied little between AK and normal controls. Compared with normal tissue, cornea tissue of AK contained a higher proportion of M0 macrophages and CD8 T cells, while resting memory CD4 T cells contributed to a relatively lower portion (P < 0.05). Finally, the expression levels of cell markers and SLAMF7/STAT6 pathway were confirmed by histopathology examinations, RT-qPCR and western blot.

Pre-implantation horse conceptuses require nutrients and signals from histotroph, the composition of which is regulated by luteal progesterone and conceptus-secreted factors. To distinguish progesterone and conceptus effects we shortened the period of endometrial progesterone-priming by asynchronous embryo transfer. Day 8 embryos were transferred to synchronous (day 8) or asynchronous (day 3) recipients, and RNA sequencing was performed on endometrium and conceptuses recovered 6 and 11 days later (embryo days 14 and 19). Asynchrony resulted in many more differentially expressed genes (DEGs) in conceptus membranes (3473) than endometrium (715). Gene ontology analysis identified upregulation in biological processes related to organogenesis and preventing apoptosis in synchronous conceptuses on day 14, and in cell adhesion and migration on day 19. Asynchrony also resulted in large numbers of DEGs related to ‘extracellular exosome’. In endometrium, genes involved in immunity, the inflammatory response, and apoptosis regulation were upregulated during synchronous pregnancy and, again, many genes related to extracellular exosome were differentially expressed. Interestingly, only 14 genes were differentially expressed in endometrium recovered 6 days after synchronous versus 11 days after asynchronous transfer (day 14 recipient in both). Among these, KNG1 and IGFBP3 were consistently up-regulated in synchronous endometrium. Furthermore bradykinin, an active peptide cleaved from KNG1, stimulated prostaglandin release by cultured trophectoderm cells. The horse conceptus thus responds to a negatively asynchronous uterus by extensively adjusting its transcriptome, whereas the endometrial transcriptome is modified only subtly by a more advanced conceptus.

Viroids are smallest pathogen that consist of non-capsidated, single-stranded non-coding RNA replicons and exploits host factors for their replication and propagation. The severe stunting disease caused by Citrus bark cracking viroid (CBCVd) is a serious threat, which spread rapidly within hop gardens. In this study, we employed comprehensive transcriptome analyses to dissect host-viroid interactions and identify gene expression changes associated with disease development in hop. Our analysis revealed that CBCVd-infection resulted in the massive modulation of activity of over 2000 genes. Expression of genes associated with plant immune responses (protein kinase and mitogen-activated protein kinase), hypersensitive responses, phytohormone signaling pathways, photosynthesis, pigment metabolism, protein metabolism, sugar metabolism and modification and others were altered, which could be attributed to systemic symptom development upon CBCVd-infection in hop. In addition, genes encoding RNA-dependent RNA polymerase, pathogenesis-related protein, chitinase as well as those related to basal defense responses were up-regulated. The expression levels of several genes identified from RNA sequencing analysis were confirmed by qRT-PCR. Our systematic comprehensive CBCVd-responsive transcriptome analysis provides a better understanding and insights into complex viroid-hop plant interaction. This information will assist further in the development of future measures for the prevention of CBCVd spread in hop fields.

A high intake of carbohydrates, associated with obesity, is one of the major causes of fatty liver disease in humans. This study investigated how high carbohydrate intake induces fatty liver disease in Blunt snout bream (Megalobrama amblycephala). Blunt snout bream were fed a high-carbohydrate diet (HCBD) for 60 days. Their growth indices were evaluated, and the transcriptomes, metabolites, biochemistry, and histology of their blood and livers were analyzed. The final weight, weight gain, specific growth rate, and feed conversion ratio were all higher in the HCBD group than in the control group, but not significantly so (P > 0.05). The hepatosomatic index (HSI) differed significantly in the two groups (P < 0.05), and the metabolomics results showed that a high carbohydrate intake induced significant increases in plasma α/β-glucose, succinate, and tyrosine, which could increase hepatic glycogen and triglyceride. Low levels of betaine were also found in the livers of the HCBD group. The histology and blood biochemistry results suggested abnormal liver, with excessive lipid accumulation and liver damage. A transcriptome analysis and quantitative reverse transcription–PCR (RT–qPCR) indicated that the expression of the factors INSR, IRS, PI3K, PDK, AKT, ACC, IL6, AP1, ChREBP-MLX, PEPCK, and FBP in the insulin signaling pathway was significantly upregulated and that of SOCS3, GSK3β, and AMPK significantly downregulated in the HCBD. This pattern is associated with the nonalcoholic fatty liver disease (NAFLD) pathway. This study extends our understanding of how high carbohydrate causes increased fat deposition in the liver, enhanced glycolysis (α/β-glucose) in the plasma, and reduced betaine in the liver. This leads to activation of hepatocyte insulin resistance and lipogenesis by regulating the expression of genes related to fatty liver disease.

Traditional methods for discovery and development of new drugs can be a very time-consuming and expensive process because it includes several stages such as compound identification, pre-clinical and clinical trials before the drug is approved by the US Food and Drug Administration (FDA). Therefore, drug repurposing, namely using currently FDA-approved drugs as therapeutics for other diseases than what they are originally prescribed for, is emerging to be a faster and more cost-effective alternative to current drug discovery methods. In this paper, we have described a three-step in silico protocol for analyzing transcriptomics data using online databases and bioinformatics tools for identifying potentially repurposable drugs. The efficacy of this protocol was evaluated by comparing its predictions with the findings of two case studies of recently reported repurposed drugs: HIV treating drug Zidovudine for the treatment of Dry Age-Related Macular Degeneration and the antidepressant Imipramine for Small-Cell Lung Carcinoma. The proposed protocol successfully identified the published findings, thus demonstrating the efficacy of this method. In addition, it also yielded several novel predictions that have not yet been published, including the finding that Imipramine could potentially treat Severe Acute Respiratory Syndrome (SARS), a disease that currently does not have any treatment or vaccine. Since this in-silico protocol is simple to use and does not require advanced computer skills, we believe any motivated participant with access to these databases and tools would be able to apply it to large datasets to identify other potentially repurposable drugs in the future.

Probiotics are microorganisms infused in products for health benefits including acceleration of nutrient digestion, however, it is also important to ensure the safety prior to incorporation. Here, we present evidence of the ability of two probiotic isolates,Lacticaseibacillus paracasei BCRC-16100 and Lacticaseibacillus paracasei ZFM54, in the (1) enhancement of carbohydrate digestion, (2) tolerance to stress, and (3) antibiotic resistance. Approaches include whole genome sequence (WGS) analysis and bioactivity assays. WGS revealed genes suggesting the ability of the two isolates to promote carbohydrate digestion, tolerance to stress and antibiotic resistance. Carbohydrate digestive ability was confirmed through a biochemical assay where the two isolates cause glucose release from starch. The two isolates also showed versatility in a range of temperature and alcohol concentration. For antibiotic resistance particularly on vancomycin, there are three mechanisms namely transporter control, transcriptional regulation, and efflux pump. Furthermore, promoter and transposable element analysis showed that some of the active antibiotic resistant (AbR) genes can be laterally transferred. Altogether, we show the potential of two probiotic isolates to be incorporated in products for improved carbohydrate digestion and the need to address the removal of active and mobile antibiotic resistance genes that may compromise safety.

The genetic bases of Alzheimer's disease (AD) and frontotemporal dementia (FTD) have been comprehensively studied, which is not the case for atypical cases not classified into these diagnoses. In the present study, we aim to contribute to the molecular understanding of the development of non-AD and non-FTD dementia by surveying rare pathogenic variants. The analysis was performed on 91 patients, the DNA samples of which were pooled and then subjected to whole exome sequencing. Among detected variants two are rare pathogenic and show significant difference in frequency between the analyzed pool and gnomAD Bulgarian control exomes. The rs373478202, G&gt;T, B9D1 variant, most likely present in heterozygous state; is causative for the autosomal recessive ciliopathy- Joubert syndrome, which involves specific CNS malformation. The rs148918985, C&gt;T, ASS1 variant leads to arginosuccinate enzyme deficiency and in compound heterozygosity with other rare pathogenic variant detected in the same gene causes the late-onset form of citrullinemia type I. This disorder causes high ammonia levels, which can lead to cerebral dysfunction. In conclusion, the detected rare pathogenic variants suggest that, in certain cases, the development of non-AD and non-FTD dementia can be mediated by structural alterations in neuronal cilia or by hyperammoniemia.

Klebsiella pneumoniae is a leading cause of healthcare acquired infections. The severity of the infections is multifactorial including virulence and antimicrobial resistance properties. The objective of the study was to investigate the virulence determinants of K. pneumoniae strains colonizing patients hospitalized in the intensive care units (ICU) of a tertiary hospital in Uganda. A hospital based cross-sectional study involving 103 patients admitted in the ICU of Mulago National Referral hospital was conducted from January 2022 to April 2022. A total of 31 identified clinical strains of K. pneumoniae isolated from rectal swabs of the same number of patients were characterized. Susceptibility testing of colistin was performed by broth microdilution method, thereafter, 5 colistin resistant K. pneumoniae were purposefully selected for whole genome sequencing. Bioinformatics analysis was performed using established web-based tools to detect virulence genes, sequence type and other genomic features. Numerous virulence factor genes related to pathogenicity of K. pneumoniae were identified. They ranged from those related to colonization to those of persistence and dissemination including capsule genes (wzi), siderophore systems; yersiniabactin (ybt15), aerobactin (iutA), enterobactin (entC, entD, entF, entS, fepB, fepD, fepG, fes), and salmochelin (iroN), secretion systems; type II (T2SS) and type VI (T6SS-1). Furthermore, the isolates harbored outer membrane protein (ompA) gene, biofilm synthesis gene (fimH) and several adhesion genes. The results demonstrate the dual-risk of K. pneumoniae strains combining high level of virulence and colistin resistance which is a great concern as it leads to unmanageable infection outbreaks with high morbidity and mortality.

Whole blood viscosity, a hemorheological factor, is currently used for diagnosis, as it is correlated with various vascular diseases that are difficult to diagnose early with a general blood test. It was determined that it was necessary to set reference intervals for further studies and utilization of whole blood viscosity in cats, a representative companion animal, and this study was conducted. 50 healthy cats were recruited for the study and whole blood viscosity, complete blood count, and serum chemistry tests were performed. The reference intervals of whole blood viscosity were 15.169 to 43.684 cP at a shear rate of 1 s-1 reflecting diastole, and 3.524 to 5.544 cP at a shear rate of 300 s-1 reflecting systole. Red blood cells, hematocrit, hemoglobin, white blood cells, and neutrophils in the complete blood count, and total protein, albumin, globulin, and cholesterol in the serum chemistry were significantly correlated with whole blood viscosity. The results of this study set reference intervals of whole blood viscosity for healthy cats in a wide shear rate range that has not yet been fully established and investigated its correlation with other blood indicators.

Background: Post-Covid condition can reduce activity and quality of life, resulting in a significant socioeconomic and health burden. Understanding its impact on patients' health is important for the development of personalized rehabilitation interventions. An independent association between obesity and post-covid condition was found because of complications and comorbidities. Methods: Sixteen patients with obesity and post-COVID symptoms (i.e., dyspnea, pain, poor sleep quality, muscle fatigue) admitted to the Istituto Auxologico Italiano, Piancavallo (VB), Italy, were recruited for a four-week rehabilitation program including conventional exercise therapy, nutritional intervention, psychological support and whole-body cryostimulation (WBC). Results: All participants attended all sessions of the program. Anthropometric data showed statistically significant changes in weight, waist circumference and body mass index. Biochemical analyses showed significant reductions in lipid and inflammatory profiles. There was a significant improvement in physical performance, reduction in pain and improvement in psychological well-being. Conclusion: A multidisciplinary rehabilitation protocol including WBC designed for patients with obesity and post-covid condition is safe and feasible. The overall improvements demonstrate that multidisciplinary rehabilitation was effective on post COVID patients and suggest that the use of WBC is safe and could play a role as a booster in rehabilitation programs.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

The emergence of new SARSCoV-2 variants can affect vaccine efficacy, laboratory diagnosis and therapies already available, triggering interest in the search for antiviral agents for SARSCoV-2 infections. Ribavirin (RBV) is a broad-spectrum antiviral with demonstrated in vitro activity against multiple viruses, including SARSCoV-2. Methods. This retrospective study evaluated the dynamic and viral clearance of SARSCoV-2 in hospitalized adult participants (PTs) with COVID-19 pneumonia who received RBV aerosol within a compassionate use study. Was also assessed the impact of RBV on the clinical outcome and the mutational profile of SARSCoV-2. Results. The median RNA values measured in nine PTs included in the study de-creased from baseline to discharge (at BL, threshold cycle (Ct)=22.4, IQR 19.84-5.07; at discharge, Ct=27.92, IQR 26.43-36.11). Seven/9 PTs experienced a clinical improvement, while two PTs deceased during hos-pitalization. In PTs with a favorable outcome the virus clearance rate at discharge was 28.6%. The cumulative clearance rate was 71.4% within day 14th from discharge. A mutational pattern after RBV was detected in 3/5 PTs in whom was available whole genome sequencing. Conclusions. RBV may limit SARSCOV-2 replication resulting in a favorable clinical outcome. Ribavirin may also contribute to the mutational spectrum of SARSCoV-2.

Chicken infectious anemia (CIA) poses a significant threat to the chicken industry in China. De-spite its non-specific symptoms, the disease is often overlooked. This study aimed to conduct a comprehensive analysis of the etiology and pathology of CIA in Guangxi Province, China. Three strains of the chicken infectious anemia virus (CIAV) were isolated from liver samples of diseased 20-week-old chickens. The complete genomes of these strains were sequenced, and experiments on specific pathogen-free (SPF) chicks revealed that the GX21121 strain exhibited high virulence. Histopathological examination of the deceased chicks showed liver cell necrosis, fibrous-serous exudation, inflammatory cell infiltration, hemorrhage in liver tissues, as well as congestion in lung and renal tissues. Phylogenetic analysis of the genome revealed that the three strains had a close genetic relationship to the Heilongjiang wild-type (GenBank KY486144). The genetic evolu-tion of their VP1 genes indicated that all three CIAV isolates belonged to genotype IIIc. In sum-mary, this study demonstrated the genomic diversity of three CIAV strains in adult layer hens. The isolation and characterization of the GX21121 strain as a highly virulent isolate provide val-uable information for further investigations into the etiology, molecular epidemiology, and viral evolution of CIAV.

Ultraviolet (UV) radiation is a strong environmental carcinogen responsible for the pathogenesis of most skin cancers, such as malignant melanoma (MM) and non-melanoma (keratinocyte) skin cancers. The carcinogenic role of UV was firmly established based on epidemiological evidence and molecular findings of the characteristic mutation signatures which occur during excision repair of cyclobutane pyrimidine dimers and 6,4-photoproducts. The role of UV in the pathogenesis of mycosis fungoides (MF), the most common primary cutaneous T-cell lymphoma, remains controversial. Here, we performed whole exome sequencing of 61 samples of MF cells microdissected from the cutaneous lesions, and compared their mutational signatures to 340 MM. The vast majority of MM mutations had a typical UV mutational signature (SBS 7, SBS 38, DSB 1) underscoring the key role of ultraviolet as a mutagen. In contrast, the SBS 7 signature in MF comprised &lt;5% of all mutations. SBS 7 was higher in the intraepidermal MF cells (when compared to the dermal cells) and in the cells from tumors as compared to early-stage plaques. In conclusion, our data do not support the pathogenic role of UV in the pathogenesis of MF and suggest that the UV mutations are the result of the cumulative, environmental ultraviolet exposure of cutaneous lesions, rather than an early mutagenic event.

Chromosomal rearrangements in N. gonorrhoeae and N. meningitidis were studied with the determination of mobile elements and their role in rearrangements. The results of whole-genome sequencing and de novo genome assembly for 50 N. gonorrhoeae isolates collected in Russia were compared with 96 genomes of N. gonorrhoeae and 138 genomes of N. meningitidis from the databases. Rearrangement events with the determination of the coordinates of syntenic blocks were analyzed using the SibeliaZ software, the minimum number of events that allow one genome to pass into another was calculated using the DCJ-indel model using the UniMoG program. Population-level analysis revealed a stronger correlation between changes in the gene order and phylogenetic proximity for N. meningitidis in contrast to N. gonorrhoeae. Mobile elements were identified, including Correa elements, Spencer-Smith elements (in N. gonorrhoeae), Neisserial intergenic mosaic elements, IS elements of IS5, IS30, IS110, IS1595 groups, Nf1-Nf3 prophages, NgoФ1-NgoФ9 prophages, Mu-like prophages Pnm1, Pnm2, MuMenB (in N. meningitidis). More than 44% of the observed rearrangements most likely occurred with the participation of mobile elements, including prophages. No differences were found between the Russian and global N. gonorrhoeae population both in terms of rearrangement events and in the number of transposable elements in genomes.

Pertussis is a vaccine-preventable disease caused by the bacterium Bordetella pertussis. Over the past years, the incidence and mortality of pertussis increased significantly. A possible cause is the switch from whole cell to acellular pertussis vaccines, although other factors may also contribute. To develop future vaccines and improve current vaccination strategies, it is critical to understand factors influencing the generation of immunological memory. We applied high-dimensional flow cytometry to investigate changes in B cells in individuals of different ages and distinct priming backgrounds upon administration of an acellular pertussis booster vaccine. These findings were correlated to vaccine-specific plasma cells and serum Ig levels. Expansion and maturation of plasma cells 7 days post-vaccination was the most prominent cellular change in all age groups, and was most pronounced for more mature IgG1+ plasma cells. Cellular responses were stronger in individuals primed with whole cell vaccine than in individuals primed with acellular vaccine. Moreover, IgG1+ plasma cell expansion weakly correlated with Prn- and PT- specific serum IgG levels. Our study points at plasma cells as a potential early cellular marker of an immune response and contributes to understanding differences in immune responses between age groups and priming backgrounds.

Komagataeibacter spp. have been used for the bioconversion of industrial wastes and lignocellulosic hydrolysates to bacterial cellulose (BC). Recently studies have demonstrated the capacity of Komagataeibacter spp. in the biotransformation of inhibitors found in lignocellulosic hydrolysates, aromatic lignin-derived monomers (LDMs) and acetate. In general, detoxification and BC synthesis from lignocellulosic inhibitors requires a carbon flow from acetyl-coA towards tricarboxylic acid and gluconeogenesis, respectively. However, the related molecular aspects have not yet been identified in Komagataeibacter spp. In this study, we isolated a cellulose producing bacteria capable of synthesizing BC in a minimal medium containing crude glycerol, a by-product from biodiesel production process. The isolate, affiliated to Komagataeibacter genus, synthesized cellulose in minimal medium containing glucose (3.3±0.3 g/L), pure glycerol (2.2±0.1 g/L) and crude glycerol (2.1±0.1 g/L). Genome assembly and annotation identified four copies of bacterial cellulose synthase operon and genes for redirecting the carbon from central metabolic pathway to gluconeogenesis. According to the genome annotations, a BC production route from acetyl-CoA, a central metabolic intermediate, was hypothesized and was validated using acetate. We identified that when K. rhaeticus ENS9b was grown in minimal medium supplemented with acetate, BC production was not observed. However, in presence of readily utilizable substrate, such as spent yeast hydrolysate, acetate supplementation improved BC synthesis.

Abstract: Infectious bronchitis virus (IBV) induces respiratory and urogenital disease in chickens. Although IBV replicates in the gastrointestinal tract, enteric lesions are uncommon. We have reported a case of runting-stunting syndrome in commercial broilers from which an IBV variant was isolated from the intestines. The isolate, CalEnt, demonstrated an enteric tissue tropism in chicken embryos and SPF chickens experimentally. Here, we determined the full genome of CalEnt and compared it to other IBV strains, in addition to comparing the pathobiology of CalEnt and M41 in commercial broilers. Despite the high whole-genome identity to other IBV strains, CalEnt is rather unique in nucleotide composition. The S gene phylogenetic analyses showed great similarity between CalEnt and Cal 99. Clinically, vent staining was slightly more frequent in CalEnt-infected birds than those challenged with M41. Furthermore, IBV IHC detection was more evident and the viral shedding in feces was overall higher with the CalEnt challenge compared with M41. Despite underlying intestinal lesions caused by coccidiosis and salmonellosis vaccination, microscopic lesions in CalEnt-infected chickens were more severe than in M41-infected chickens or controls, supporting the enteric tropism of CalEnt. Further studies in SPF chickens are needed to determine the pathogenesis of the virus, its molecular mechanisms for the enteric tropism, and its influence in intestinal health.

Germline mutations in predisposition genes account for only 20% of all familial colorectal cancer (CRC) and the remaining genetic burden may be due to rare high-to-moderate-penetrance germline variants that are not explored. With the aim of identifying such potential cancer predisposing variants, we performed whole exome sequencing on three CRC cases and three unaffected members of a Polish family and identified two novel heterozygous variants; a coding variant in APC down-regulated 1 gene (APCDD1, p.R299H) and a non-coding variant in the 5’ untranslated region (UTR) of histone deacetylase 5 gene (HDAC5). Sanger sequencing confirmed the variants segregating with the disease and Taqman assays revealed 8 additional APCDD1 variants in a cohort of 1705 familial CRC patients and no further HDAC5 variants. Proliferation assays indicated an insignificant proliferative impact for the APCDD1 variant. Luciferase reporter assays using the HDAC5 variant resulted in an enhanced promoter activity. Targeting of transcription factor binding sites of SNAI-2 and TCF4 interrupted by HDAC5 variant showed a significant impact of TCF4 on promoter activity of mutated HDAC5. Our findings contribute not only to the identification of unrecognized genetic causes of familial CRC but also underline the importance of 5´UTR variants affecting transcriptional regulation and the pathogenesis of complex disorders.

Astroviruses (AstVs) are occurs globally and are common causes of gastroenteritis in human and animals. The genetic diversity and epidemiology of AstVs in Africa is not well known, hence, we aimed to genetically characterize astroviruses in asymptomatic smallholder piglets in East Africa. Twenty-four samples randomly selected from 446 piglets (<6 months old), initially collected for rotavirus study, was sequenced for metagenomic analysis. Thirteen (13/24) samples had contigs with high identity to genus Mamastrovirus. Analysis of 7 strains with complete (or near complete) genome revealed variable nucleotide and amino acid sequence identities with known PoAstV strains. The U083 and K321 strains had nucleotide sequence similarities ranging from 66.4 to 75.4 % to the known PoAstV2 strains, nucleotide sequence similarity of U460 strain with known PoAstV3 ranged 57.0 to 65.1 % to the, while K062, K366, K451, and K456 strains showed nucleotide sequence similarities of 63.5 to 80 % to the known PoAstV4 strains. The low sequence identities (<90 %) indicate that novel genotypes of PoAstVs are circulating in the study area. Multiple recombination events were detected in our PoAstV4 strains, indicating that the genetic diversity observed in these strains may be due to recombination. Importantly, we identified potential candidate epitopes with conserved peptides in our PoAstV strains that could aid in the design of immune diagnosis tools and subunit vaccines. Our data provide new intuitions into the genetic structure of porcine astroviruses in East African.

The KARS gene encodes the aminoacyl-tRNA synthetase (aaRS) which activates and joins the lysin with its corresponding transfer RNA (tRNA), through the ATP-dependent aminoacylation of the amino acid. The KARS gene mutations have been linked to diverse neurologic phenotypes such as: neurosensorial hearing loss, leukodistrophy, microcephaly, developmental delay or regression, peripheral neuropathy, cardiomyopathy, impairment of the mitochondrial respiratory chain, hyperlactatemia, among others. This article presents the case of a Colombian pediatric patient with two pathological missense variants in a compound heterozygous state in the KARS gene.

The aim of this study is the characterization and genomic tracing by phylogenetic analyses of 59 new SARS-CoV-2 Italian isolates obtained from patients attending clinical centres in North and Central Italy until the end of April 2020. All but one of the newly characterized genomes belonged to the lineage B.1, the most frequently identified in European countries, including Italy. Only a single sequence was found to belong to lineage B. A mean of 6 nucleotide substitutions per viral genome was observed, without significant differences between synonymous and non-synonymous mutations, indicating genetic drift as a major source for virus evolution. tMRCA estimation confirmed the probable origin of the epidemic between the end of January and the beginning of February with a rapid increase in the number of infections between the end of February and mid-March. Since early February, an effective reproduction number (Re) greater than 1 was estimated, which then increased reaching the peak of 2.3 in early March, confirming the circulation of the virus before the first COVID-19 cases were documented. Continuous use of state-of-the-art methods for molecular surveillance is warranted to trace virus circulation and evolution and inform effective prevention and containment of future SARS-CoV-2 outbreaks.

Whole-genome DNA sequencing of Lactobacillus D75 and D76 strains (Vitaflor, Russia) was performed using the PacBio RS II platform, followed by de novo assembly with SMRT Portal 2.3.0. The average nucleotide identity (ANI) test showed that both strains belong to the Lactobacillus helveticus, but not the L. acidophilus as previously assumed. 31 exopolysaccharide (EPS) production genes (nine of which form a single genetic cluster), 13 adhesion genes, 38 milk protein and 11 milk sugar utilization genes, 13 genes for and against specific antagonistic activity, aight antibiotic resistance genes, and also three CRISPR blocks and eight Cas I-B system genes were identified in the genomes of the both strains. The expression of some genes was confirmed. In fact, the presence of identified genes suggests that L. helveticus D75 and D76 are able to form biofilms on the outer mucin layer, inhibit the growth of pathogens and pathobionts, utilize milk substrates with the formation of digestible milk sugars and bioactive peptides, resist bacteriophages and show some genome-determined resistance to antibiotics, stimulate the host’s immune system. Pathogenicity genes have not been identified. The study results confirm the safety and high probiotic potential of the strains.

Appropriate vaccine selection is crucial in the control of foot-and-mouth disease (FMD). Vaccination can prevent clinical disease and reduces viral shedding, but there is a lack of cross-protection between the seven serotypes and their sublineages, making the selection of an adequately protective vaccine difficult. Since the exact composition of their vaccines is not consistently disclosed by all manufacturers, incompatibility of the strains used for vaccination with regionally circulating strains can cause vaccination campaigns to fail. Here, we present a deep sequencing approach for polyvalent inactivated FMD vaccines that can identify all component strains by their genome sequences. The genomes of all strains of a commercial pentavalent FMD vaccine were de-novo assembled and the vaccine composition determined semi-quantitatively. The genome assembly required high stringency parameters to prevent misassemblies caused by conserved regions of the genome shared by related strains. In contrast, reference-guided assembly is only recommended in cases where the number of strains is previously known and appropriate reference sequences are available. The presented approach can be applied not only to any inactivated whole-virus FMD vaccine, but also to vaccine quality testing in general and allows for better decision-making for vaccines with unknown composition.

Evidence of familial inheritance in non-medullary thyroid cancer (NMTC) has accumulated over the last few decades. However, known variants account for a very small percentage of the genetic burden. Here, we focused on the identification of common pathways and networks enriched in NMTC families to better understand its pathogenesis with the final aim of identifying one novel high/moderate-penetrance germline predisposition variant segregating with the disease in each studied family. We performed whole genome sequencing on 23 affected and 3 unaffected family members from five NMTC-prone families and prioritized the identified variants using our Familial Cancer Variant Prioritization Pipeline (FCVPPv2). In total, 31 coding variants and 39 variants located in upstream, downstream, 5′ or 3′ untranslated regions passed FCVPPv2 filtering. Altogether, 210 genes affected by variants that passed the first three steps of the FCVPPv2 were analyzed using Ingenuity Pathway Analysis software. These genes were enriched in tumorigenic signaling pathways mediated by receptor tyrosine kinases and G-protein coupled receptors, implicating a central role of PI3K/AKT and MAPK/ERK signaling in familial NMTC. Our approach can facilitate the identification and functional validation of causal variants in each family as well as the screening and genetic counseling of other individuals at risk of developing NMTC.

A possible way to valorize citrus peels, which are byproducts of the juice extraction industry, is to use them as natural biopreservatives. In this paper we present early results from a compared Solvent Free Microwave Extraction (SFME) with Hydro-Distillation (HD) and Cold Pressing (CP) of essential oils (EOs) using fresh orange peel (Citrus sinensis L. var. Valencia late), a by-product in the production of orange juice in Algeria. The EOs were analyzed by gas chromatography coupled to mass spectrometry (GC-MS). All extracted C. sinensis EOs were chemotype limonene (94.64 to 95.48%). SFME is performed without added any solvent or water. SFME increases EO yield and eliminate wastewater treatment, resulting in a great progress in terms of time and cost efficiency. In its second part, the present study was conducted to evaluate “in vitro”, the antioxidant activities of Solvent Free Microwave (SFM) extracted orange EO by using the DPPH• (2,2-di-phenyl-1-picrilhydrazyl) free radical scavenging assay. The ability of orange EO to scavenge the free radical DPPH• was high, exceeding 80%. The result of the DPPH assay gives an IC₅₀ range value of 89.25 μg/mL (0.09 mg/mL) for the studied sample. Accordingly to the scientific literature, C. sinensis EO tested in the present study presented strong antioxidant activity, when looking to its values of AAI = 1.12 μg/mL. The feasibility of biopreservation used EOs as an alternative to synthetic techniques for liquid whole egg (LWE) stored under commercial retail conditions was investigated. The orange EO extracted by SFM was screened for its antibacterial and antioxidant activities in LWE at concentrations of 0.1, 0.3 and 0.5%. The TBA-RS results showed that the EO treatments significantly (p < 0.05) reduced the lipid oxidation in LWE. The long term oxidative, microbial and organoleptical stability of the LWE during display was positively influenced by orange EO treatments. Therefore, the results obtained here confirm that EO treatment as a promising technology to extend the commercial shelf-life of liquid egg products during retail/display.

A novel binary toxin-positive non-027, non-078 Clostridium difficile strain designated LC693 whose sequence type was ST201 was isolated from the fecal sample of a patient with severe diarrhea in China. To understand the pathogenesis basis of C. difficile ST201, this recently recovered isolate LC693 was then chosen for whole genome sequencing. The project finally generated an estimated genome size of approximately 4.07 Mbp. The genome sequence was then analyzed together with the other two ST201 strains VL-0104 and VL-0391 and compared to the epidemic 027/ST1 and 078/ST11 strains. Phylogenetic analysis demonstrated that the ST201 strains belonged to clade 3. Genome size of the three ST201 strains ranged from 4.07 Mb~4.16 Mb, with an average GC content between 28.5%~28.9%. The ST201 genomes contained more than 40 antibiotic resistance genes and 15 of them were predicted to be associated with vancomycin-resistance, suggesting that they may have a strong antibiotic resistance. The ST201 strains contained a typical clade 3 specific PaLoc with a Tn6218 element inserted, and those genes harbored on their PaLoc that participated in the toxin expression and regulation were highly homologues to the epidemic 027 and 078 strains, with the exception of tcdC. A truncated TcdC was found in the ST201 strains, which is suggestive to have a contribution to the toxin production of the ST201 strains. In addition, the ST201 strains contained intact binary toxin coding and regulation genes, which is also proposed to contribute to the virulence. Genome comparison of the ST201 strains with the epidemic 027 and 078 strain identified 641 genes specific for the C. difficile ST201, and a number of them were predicted as fitness and virulence associated genes. The identification of those genes also contributes to the pathogenesis of the ST201 strain. To our knowledge, this is the first study that the genome sequence of C. difficile ST201 was discussed in detail, and the present study would have a contribution to understanding the pathogenesis basis of C. difficile ST201.

Innovative strategies to control malaria are urgently needed. Exploring the interplay between the Plasmodium sp. parasites and host red blood cells (RBC) offers opportunities for novel antimalarial interventions. Pyruvate kinase deficiency (PKD), characterized by heightened 2,3-diphosphoglycerate (2,3-DPG) concentration, has been associated with protection against malaria. Elevated 2,3-DPG levels, a specific mammalian metabolite, may hinder glycolysis, prompting us to hypothesize its potential contribution to PKD-mediated protection. We investigated the impact of the extracellular supplementation of 2,3-DPG on the Plasmodium falciparum intraerythrocytic developmental cycle in vitro. Results showed an inhibition of parasite growth, resulting from significantly less progeny from 2,3-DPG-treated parasites. We analyzed differential gene expression and the transcriptomic profile of P. falciparum trophozoites, from in vitro cultures submitted or not submitted to the action of 2,3-DPG, using Nanopore Sequencing Technology. The presence of 2,3-DPG in the culture medium was associated to a significant differential expression of 71 genes, mostly associated to GO terms nucleic acid binding, transcription, or monoatomic anion channel. Further, several genes related to the cell cycle control were downregulated in treated parasites. These findings suggest that the presence of this RBC-specific glycolytic metabolite impact the expression of genes transcribed during the parasite trophozoite stage and the number of merozoites released from individual schizonts, which supports the potential role of 2,3-DPG in the mechanism of protection against malaria by PKD.

In recent years, frequent occurrences of low temperature disasters due to global climate change have significantly impacted the normal growth of crops. Research has indicated that inorganic selenium (which is more toxic) can not only enhance the effects of low temperature stress but also increase selenium content on plants; however, there is a scarcity of studies investigating the impacts of organic selenium and nano-selenium on crops. In order to investigate whether organic selenium and nano-selenium can enhance low-temperature tolerance and increase selenium content in pak choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), different concentrations (0, 5, 10, 20 mg L-1) of exogenous selenium were applied in this experiment to assess their effects on plant growth, nutritional quality and antioxidant properties. RNA-Seq technology was used to sequence the transcriptome of the leaves. Based on the transcriptome data, a Weighted Gene Co-expression Network Analysis (WGCNA) was employed to construct a network that associates with physiological traits related to stress resistance. Two highly correlated gene co-expression modules were identified, and within them, nine hub genes associated with endocytosis, antioxidant stress, absorption, transport, and metabolism of selenium were discovered. The results indicated that the beneficial effects on yield and total selenium content under low temperature were attributed to (1) protection of photosynthetic pigments for enhancing photosynthetic capacity by the up-regulation of LHca2, LHcb1, LHca1, LHcb4 in KEGG pathway: photosynthesis-antenna proteins; (2) activation of antioxidant system for efficient ROS homeostasis such as SOD, POD and CAT by the genes such as Superoxide dismutase, Monodehydroascorbate and (3) selenium absorption by endocytosis, seleninum transportation by ABC transporter gene family and selenium metabolism related genes such as Cysteine synthase, Glutaredoxin. These findings provide a foundation for further investigation into the molecular mechanisms underlying the effects of organic selenium and nano-selenium on cyanochloride production at low temperatures.

Cancer researchers are fascinated by the chemistry of diverse natural products which show exciting potential as anticancer agents. In this study, we aimed to investigate the anticancer properties of watermelon rind extract (WRE) by examining its effects on cell proliferation, apoptosis, senescence, and global gene expression in human renal cell adenocarcinoma cells (HRAC-769-P) in vitro. Our metabolome data analysis of WRE exhibited untargeted phyto-constituents and targeted citrulline (22.29 µg/mg). HRAC-769-P cells were cultured in RPMI-1640 media and treated with 22.4, 44.8, 67.2, 88.6, 112, 134.4, and 156.8 mg mL-1 for 24, 48, and 72 hrs. At 24 hrs after treatment, (88.6 mg ml-1 of WRE) cell proliferation significantly reduced, more than 34% compared to the control. Cell viability decreased 48 and 72 hours after treatment to 45% and 37%, respectively. We also examined poly caspase, SA-beta-galactosidase (SA-beta-gal), and wound healing activities using WRE. All treatments induced an early poly caspase response and a significant reduction in cell migration. Further, we analyzed the transcript profile of the cells grown at 44.8 mg ml-1 of WRE after 6 hours using RNA sequencing (RNAseq) analysis. We identified 186 differentially expressed genes (DEGs), including 149 upregulated genes and 37 downregulated genes, in cells treated with WRE compared to the control. The differentially expressed genes were associated with NF-Kappa B signaling and TNF pathways. Crucial apoptosis-related genes such as BMF, NPTX1, NFKBIA, NFKBIE, and NFKBID might induce intrinsic and extrinsic apoptosis. Another possible mechanism is a high quantity of citrulline may lead to induction of apoptosis by the production of increased nitric oxide. Hence, our study suggests the potential anticancer properties of WRE and provides insights into its effects on cellular processes and gene expression in HRAC-769-P cells.

Bromodomain (BRD)-containing proteins are involved in many biological processes, most notably epigenetic regulation of transcription, and BRD protein dysfunction has been linked to many diseases, including tumorigenesis. However, the role of BRD proteins in the pathogenesis of uterine fibroids (UFs) is entirely unknown. The present study aimed to determine the expression pattern of BRD9 protein in UFs and matching myometrium and further assess the impact of BRD9 inhibitors on UF phenotype and epigenetic/epitranscriptomic changes. Our studies demonstrated that the levels of BRD9 were significantly upregulated in UFs compared to matched myometrium, suggesting that the aberrant BRD protein expression may contribute to the pathogenesis of UFs. We then evaluated the potential roles of BRD9 using its specific inhibitor I-BRD9. Targeted inhibition of BRD9 suppressed the UF tumorigenesis with increased apoptosis and cell cycle arrest, decreased cell proliferation, and extracellular matrix deposition in UF cells. The latter is the key hallmark of UFs. Unbiased transcriptomic profiling coupled with downstream bioinformatics analysis further and extensively demonstrated that targeted inhibition of BRD9 impacted the cell cycle- and ECM-related biological pathways, reprogrammed the UF cell epigenome and epitranscriptome, and altered miRNA-mediated gene regulation in UFs. Taken together, our data support the critical role of BRD9 in UF cells and the strong interconnection between BRD9 and other pathways controlling the UF progression. Targeted inhibition of BRD proteins might provide a non-hormonal treatment option for this most common benign tumor in women of reproductive age.

The current classification of acute myeloid leukemia (AML) relies largely on genomic alterations. AML with mutated Nucleophosmin1 (NPM1-mut) is the largest of the genetically defined groups, involving about 30% of adult AMLs and is currently recognized as a distinct entity in the actual AML classifications. NPM1-mut AML usually occurs in de novo AML and is associated predominantly with a normal karyotype and relatively favorable prognosis. However, NPM1-mut AMLs are genetically, transcriptionally, and phenotypically heterogeneous. Furthermore, NPM1-mut is a clinically heterogenous group. Recent studies have in part clarified the consistent heterogeneities of these AMLs and have strongly supported the need for an additional stratification aiming to improve the therapeutic response of the different subgroups of NPM1-mut AML patients.

Following the central dogma of molecular biology, gene expression heterogeneity can aid in predicting and explaining the wide variety of protein products, functions, and, ultimately, heterogeneity in phenotypes. There is currently overlapping terminology used to describe the types of diversity in gene expression profiles, and overlooking these nuances can misrepresent important biological information. Here, we describe transcriptome diversity as a measure of the heterogeneity in 1) the expression of all genes within a sample or a single gene across samples in a population (gene-level diversity) or 2) the isoform-specific expression of a given gene (isoform-level diversity). We first overview modulators and quantification of transcriptome diversity at the gene level. Then, we discuss the role alternative splicing plays in driving transcript isoform-level diversity and how it can be quantified. Additionally, we overview computational resources for calculating gene-level and isoform-level diversity for high-throughput sequencing data. Finally, we discuss future applications of transcriptome diversity. This review provides a comprehensive overview of how gene expression diversity arises, and how measuring it determines a more complete picture of heterogeneity across proteins, cells, tissues, organisms, and species.

A recent paradigm shift in diagnostics of medulloblastoma allows the distinction of four major groups defined by genetic data rather than histology. This new molecular classification correlates better with prognosis and will allow better clinical management for therapies targeting druggable mutations, but also offers a new combination of monitoring tumor development in real-time and treatment response by sequential liquid biopsy. This review highlights recent developments after a century of milestones in neurosurgery, radio- and chemotherapy, but also controversial theories on the cell of origin, animal models and the use of liquid biopsy.

Crustacean hyaluronidases are 1 poorly understood both in terms of their enzymatic properties and in terms of their structural features. In this work, we have shown that the hepatopancreas homogenate of the red king crab has a hyaluronidase activity that is an order of magnitude higher than its commercial counterpart. Zymography revealed the hyaluronidase activity of the protein roughly from40 to 50 kDa relative to the molecular marker used in electrophoresis. Analysis of the hepatopancreas transcriptome revealed a hyaluronidase sequence with an expected molecular weight of 42.5 kDa. It turned out that the reaction of cleavage of hyaluronate in the presence of a homogenate proceeds by the mechanism of b-elimination, which is well known for bacterial hyaluronidases. Thus, a new hyaluronidase of higher eukaryotes was found and described, which is not integrated into the modern classification of hyaluronidases.

The Pashmina and Barbari are two famous goat breeds found in the wide areas of the Indo-Pak region. Pashmina is famous for its long hair-fiber (Cashmere) production while Barbari is not-selected for this trait. So, the mRNA expression profiling in the skin samples of both breeds would be an attractive and judicious approach for detecting putative genes involved in this valued trait. Here, we performed differential gene expression analysis on publicly available RNA-Seq data from both breeds. Out of 44,617,994 filtered reads of Pashmina and 55,995,999 of Barbari which are 76.48% and 73.69% mapped to the ARS1 reference transcriptome assembly respectively. A pairwise comparison of both breeds resulted in 47,159 normalized expressed transcripts while 8,414 transcripts are differentially expressed above the significant threshold. Among these, 4,788 are upregulated in Pashmina while 3,626 transcripts are upregulated in Barbari. Fifty-nine transcripts harbor 57 genes including 32 LOC genes and 24 are annotated genes which were selected on the basis of TMM counts > 500. Genes with ectopic expressions other than uncharacterized and LOC symbol genes are Keratins (KRT) and Keratin Associated Proteins (KRTAPs), CystatinA&6, TCHH, SPRR4, PPIA, SLC25A4, S100A11, DMKN, LOR, ANXA2, PRR9 and SFN. All of these genes are likely to be involved in keratinocyte differentiation, sulfur matrix proteins, dermal papilla cells, hair follicles proliferation, hair curvature, wool fiber diameter, hair transition, hair shaft differentiation and its keratinization. These differentially expressed reported genes are critically valuable for enhancing the quality and quantity of the pashmina fiber and overall breed improvement. This study will also provide important information on hair follicle differentiation for further enrichment analyses and introducing this valued trait to other goat breeds as well.

The eyes are the sense organs through we view the world around us, and the cornea is the transparent layer which covers the outer, visible part of the eye. It is known that the gene expression of corneal endothelium depends on age. And the expressed genes of the endothelium of cornea for pediatric samples is different than that of the adult samples. The purpose or objective of this study was to characterize human corneal endothelial cell (HCEnC) gene expression and differential gene expression and to detect the expressed genes mapped to chromosomal loci associated with some corneal endothelial dystrophies. Both upregulated and downregulated genes were analyzed. For this purpose, total RNA was isolated from ex vivo corneal endothelium taken from six pediatric and five adult corneas. The complementary DNA was hybridized to the Affymetrix GeneChip 1.1 ST array. The data analysis was performed using the Enrichr software for both upregulated and downregulated genes. These are described in more detail in the results and discussion section. This study uses bioinformatics tools to identify and analyse gene sets present in the transcriptome of the corneal endothelium, and tries to find out and observe the relation of the aging effect on the corneal endothelium gene expression. The human subjects had participated voluntarily and informed consent was obtained from all before carrying out any testing procedure. Proper guidelines from the hospital ethical committee were also followed and no harmful chemicals were used on the participants. This study simply aims to raise some awareness of the given topic among the local people so that they are better able to take informed choices about their health in the near future, and also so that they seek medical help when necessary and have no inhibitions in doing so.

New insights into the causes and mechanisms of congenital heart disease (CHD) have been gained through the use of next-generation sequencing. Examination of the whole exome sequence detects detrimental gene variations modifying single or contiguous nucleotides, that are characterised as pathogenicity based on statistical assessments of families. and correlates with congenital heart disease, elevated expression during heart development, and reduction of harmful protein-coding mutations in the general population. Patients with CHD and extracardiac abnormalities enriched for gene classes meeting these criteria. CHDs and extracardiac defects, supporting a common set of pathways in the organogenesis of CHDs. Single-cell transcriptomics data reveal the expression of genes associated with CHD in specific cell lineages, and emerging evidence suggests that genetic variants disrupt multicellular genes essential for cardiogenesis. Metrics and units are being tracked in whole genome sequence studies.

Accurate cloud quantification is essential in climate change research. In this work, we construct an automated computer vision framework by synergistically incorporating deep neural networks and finite sector clustering to achieve robust whole sky image-based cloud classification, adaptive segmentation, and recognition under intricate illumination dynamics. A bespoke YOLOv8 architecture attains over 95% categorical precision across four archetypal cloud varieties curated from extensive annual observations (2020) at a Tibetan highland station. Tailor-made segmentation strategies adapted to distinct cloud configurations, allied with illumination-invariant image enhancement algorithms, effectively eliminate solar interference and substantially boost quantitative performance even in illumination-adverse analysis scenarios. Compared with the traditional threshold analysis method, the cloud quantification accuracy calculated within the framework of this paper is significantly improved. Collectively, the methodological innovations provide an advanced solution to markedly escalate cloud quantification precision levels imperative for climate change research, while offering a paradigm for cloud analytics transferable to various meteorological stations.

To accurately predict the matching relationships between the various components and the engine performance in the whole aero-engine environment, this study introduces a two-dimensional throughflow simulation method for the whole aero-engine. This method is based on individual throughflow solvers for the turbo-machinery and the combustor. It establishes a throughflow simulation model for the whole engine by integrating with the compressor-turbine co-operating equations and boundary conditions. The turbo-machinery throughflow solver employs a circumferentially averaged form of the time-dependent Navier-Stokes equations (N-S) as the governing equation. The combustor solver uses the Reynolds Average Navier-Stokes (RANS) method to solve flow and chemical reaction processes by constructing turbulence, combustion, and radiation models. The accuracy of the component solver is validated using Pratt &amp; Whitney’s three-stage axial compressor (P&amp;W3S1) and General Electric’s high-pressure turbine (GE-EEE HPT), and the predicted results are consistent with the experimental data. Finally, the developed throughflow method is applied to simulate the throttling characteristics of the WZ-X turboshaft engine. The results predicted by the throughflow program are consistent with the GasTurb calculations, including the trends of shaft power delivered, specific fuel consumption (SFC), inlet airflow, and total pressure ratio of the compressor. The developed method to perform throughflow simulation of the whole aero-engine eliminates the dependence on a general component map. It can quickly obtain the meridian flow field parameters and overall engine characteristics, which is expected to guide the design and modification of the engine in the future.

Phantom Limb Pain (PLP) is a challenging condition affecting a significant proportion of amputees. In this article we describe the case of a 54-year-old Paralympic athlete with Phantom Limb Syndrome following right leg amputation and widespread sports-related enthesitic pain, who underwent a Whole Body Cryostimulation (WBC) cycle, an emerging treatment known for its rapid pain-relieving and anti-inflammatory effects. Assessments were conducted before and after a 10-session WBC cycle, including pain and quality of life assessment, and use of medications. A substantial reduction in enthesitic pain, PLP intensity, paresthesia, tingling related to atmospheric events and an improved function and quality of life were reported after the WBC cycle and lasted for two weeks. One month after WBC, the enthesitic pain following sports activity and PLP gradually returned but with lesser intensity. Similarly, the stump's sensitivity to atmospheric changes returned but with lower frequency. Pain at night remained lower than before WBC with significantly improved quality of sleep. This case study suggests that WBC could be a valuable adjuvant treatment for alleviating PLP. Controlled studies are warranted to validate the findings of this case-report and elucidate the mechanisms underlying the positive effects of WBC in this condition.

Vancomisin resistant enterococcus(VRE), is a resistant microorganism which colonizates and causes infections in hospitalized patients. It was aimed to show the spread of vancomycin-resistant Enterococcus (fVREfm) step-by-step in all intensive care units, which started with the growth of vancomycin-resistant Enterococcus faecium (VREfm) on 02.12.2021 in the blood culture of a patient hospitalized in the anesthesia intensive care unit of our hospital and was found to have reached epidemic size in the surveys. Rectal swab samples were taken from all patients hospitalized in intensive care units, VRE colonization was determined and the VanA and VanB resistance genes associated with vancomycin resistance of VREfm isolates were determined by PCR method, and clonal association analysis was performed by Arbitrarily Primed-PCR (AP-PCR) and Pulsed-Field Gel Electrophoresis. In our study, VRE was detected in 61 of 2601 rectal swab samples. 54 (85.52%) of the VRE isolates were Enterococcus faecium, 3 (4.91%) was Enterococcus faecalis, 3 (4.91%) was Enterococcus gallinorum, 1 (1.63%) was Enterococcus casseliflavus. It was determined that all of the 54 VREfm isolates, which were the most detected among all VRE isolates, carried the vanA gene. In the clonal association analysis of the isolates by AP-PCR and PFGE methods, it was found that they had 12 different genotypes, 48 of them were included in any cluster, the clustering rate was 88.8%, and the largest cluster was genotype 1 cluster with 36 isolates. Of the 54 patients with VREfm isolated recently, 18.51 percent of the clinical samples were isolated before the survey, and 9.24% were isolated after the survey. It was determined that 100% of VREfm isolates were resistant to ampicillin, levofloxacin, ciprofloxacin, high-level gentamicin, trimethoprim-sulfamethoxazole, teicoplanin, 7.4% to tigecycline and 1.85% to linezolid. In our study, in the clonal association analysis performed by isolating VREfm in rectal swab samples, it was found that 88.8% of the samples were indistinguishably similar and the increase in the number of VREfm infections after the index case in our hospital was associated with the epidemic. VREfm infections cause long term hospitalization, costs and also deaths, which shows the seriousness of the event, and the importance of the combination of epidemiological and molecular analysis in epidemic research.

Background: This study aimed to investigate the molecular profiles of stage III CRC patients from the international IDEA study. It also sought to correlate these profiles with Toll-like and vitamin D receptor polymorphisms, clinicopathological and epidemiological characteristics, and patient outcomes. Methods: Whole Exome Sequencing and PCR-RFLP on surgical specimens and blood samples, respectively, were performed to identify molecular profiling and the presence of Toll-like and vitamin D polymorphisms. Bioinformatic analysis revealed mutational status. Results: Among the enrolled patients, 63.7% were male, 66.7% had left-sided tumors, and 55.7% received CAPOX as adjuvant chemotherapy. Whole exome sequencing identified 59 mutated genes in 11 different signaling pathways from the Kyoto Encyclopedia of Genes and Genomes (KEGG) CRC panel. On average, patients had 8 mutated genes (range, 2-21 genes). Mutations in ARAF and MAPK10 emerged as independent prognostic factors for reduced DFS (p=0.027 and p<0.001, respectively), while RAC3 and RHOA genes emerged as independent prognostic factors for reduced OS (p=0.029 and p=0.006, respectively). Right-sided tumors were also identified as independent prognostic factors for reduced DFS (p=0.019) and OS (p=0.043). Additionally, patients with tumors in the transverse colon had mutations in genes related to apoptosis, PIK3-Akt, Wnt, and MAPK signaling pathways. Conclusions: Molecular characterization of tumor cells can enhance our understanding of the disease course. Mutations may serve as promising prognostic biomarkers, offering improved treatment options. Confirming these findings with require larger patient cohorts and international collaborations to establish correlations between molecular profiling, clinicopathological and epidemiological characteristics and clinical outcomes.

The genus Vigna is penta-tropical having more than 200 species with many desirable economically important traits. The aim of study was to validate the in-silico polymorphism of whole genome sequence developed mungbean specific SSR markers and their transferability among the different Vigna species. The present study utilized a set of 200 SSR markers developed from whole genome sequence of mungbean and validated using a diversity panel of 25 accessions which belongs to 13 Vigna species. Out of 200 SSR markers, 130 markers (65%) were polymorphic across the various Vigna species and the number of alleles amplified varied between 7 to24. The SSR markers showed more than 90 percent transferability across the different Vigna species accessions. Based on allelic data, the 25 Vigna accessions grouped into three clusters based upon the unweighted pair group method with arithmetic mean (UPGMA) phylogenetic tree. The principal co-ordinates analysis (PCA) biplot graph and UPGMA based neighbor joining clustering diagram showed similar pattern of Vigna accessions distribution. The population structure assessment has grouped the cultivated and wild species accessions into two sub-population. The estimated marker parameters such as polymorphic information content (0.09 – 0.84), marker index (0.091 – 3.342) and effective multiplex ratio (1.0 – 4.0) suggested their adequacy in several genetic studies such as parental selection, hybrid testing, genetic mapping and marker aided breeding programmes for genetic enhancement of species belonging to the Vigna genus.

Urinary cytology is a useful, essential diagnostic method in routine urological clinical practice. Liquid-based cytology (LBC) for urothelial carcinoma screening is commonly used in the routine clinical cytodiagnosis because of its high cell collection rate. Since conventional screening processes by cytoscreeners and cytopathologists using microscopes is limited in terms of human resources, it is important to integrate new deep learning methods that can automatically and rapidly diagnose a large amount of specimens without delay. The goal of this study was to investigate the use of deep learning models for the classification of urine LBC whole-slide images (WSIs) into neoplastic and non-neoplastic (negative). We trained deep learning models using 786 WSIs by transfer learning, fully supervised, and weakly supervised learning approaches. We evaluated the trained models on two test sets (equal and clinical balance) with a combined total of 750 WSIs, achieving ROC-AUCs for WSI diagnosis in the range of 0.984-0.990 by the best model, demonstrating the promising potential use of our model for aiding urine cytodiagnostic processes.

Amino acid efflux and influx transport systems play vital roles in industrial microorganisms’ cell growth and metabolism. However, although biochemically characterized, most amino acid transporters remain unknown at the molecular level in Bacillus licheniformis. This study focuses on the molecular and functional characterizations of three transporters, YdgF, YvbW, and YveA, mainly when catalyzing the cross-membrane flux of L-Aspartate. When growing in the minimal medium with L-Asp as the only carbon and nitrogen source, the growth of strains lacking proteins YdgF, YvbW, and YveA was significantly inhibited compared with wild-type strains, while supplementing the expression of the corresponding proteins in the single-gene knockout strains can alleviate the inhibition to some extent. Upon overexpression, the recombinant proteins mediate the accumulation of L-aspartate to varying degrees. Compared with wild-type strains, the single knockout strains of the three protein genes exhibited reduced absorption of L-aspartate. In addition, this paper focuses on the effects of these three proteins on the absorption of β-alanine, L-glutamate, D-serine, D-alanine, and glycine.

The use of whole-body vibration (WBV) for therapeutic purposes is far from being standardized and only very recently an empirical foundation for reporting guidelines for human WBV studies has been published. Controversies about safety and therapeutic dosage stll exist. The present study aimed to investigate the metabolic and mechanical effects of low-intensity WBV in according to the ISO 2631 norm on subjects with obesity. 41 obese subjects (BMI≥ 35 kg/mˆ2) were recruited to participate in a 3-week multidisciplinary inpatient rehabilitation program including fitness training and WBV training. During WBV the posture was monitored with an optoelectronic system with 6 infrared cameras (Vicon, Vicon Motion System, Oxford, UK). The primary endpoints were: variation in body composition, factors of the metabolic syndrome, functional activity (sit-to-stand and 6-min walking test), muscle strength, and quality of life. Secondary endpoints were: modification of irisin, testosterone, growth hormone, IGF1 levels. We observed significant changes in salivary irisin levels, Group 2 (p&lt;0.01) as compared to the control group, while muscle strength, function, and other metabolic and hormonal factors did not change after a 3-week low-intensity WBV training respect control group. Future studies are needed to deeper investigate the potential metabolic effect of low-intensity WBV in managing weight.

Triploidy in cancer is associated with poor prognosis but its origins remain unclear. Here, we attempted to differentiate between random chromosomal and whole-genome origins of cancer triploidy. In silico meta-analysis was performed on 15 male malignant and 5 benign tumour cohorts (2928 karyotypes) extracted from the Mitelman Database, comparing their ploidy and combinations of sex chromosomes. A distinct near-triploid fraction was observed in all malignant tumour types, being especially high in seminoma. For all tumour types, X-chromosome doubling, predominantly observed as XXY, correlated strongly with the near-triploid state (r≈0.9, p<0.001), negatively correlated with near-diploidy, and did not correlate with near-tetraploidy. A smaller near-triploid component with a doubled X-chromosome was also present in 3 of 5 benign tumour types, especially notable in colon adenoma. Principal Component Analysis revealed a non-random correlation structure shaping the X-chromosome disomy distribution across all tumour types. We suggest that doubling of the maternal genome followed by pedogamic fusion with a paternal genome (a possible mimic of the fertilization aberration, 69, XXY digyny) associated with meiotic reprogramming may be responsible for the observed rearrangements of genome complements leading to cancer triploidy. The relatively frequent loss of the Y-chromosome results secondary from chromosome instability.

Stereotactic radiosurgery (SRS) has become increasingly important in the management of brain metastases due to improving systemic disease control and rising incidence. Initial trials demonstrated SRS with whole brain radiotherapy (WBRT) improved local control rates versus WBRT alone. Concerns with WBRT associated neurocognitive toxicity have contributed to greater use of SRS alone, including for patients with multiple metastases and following surgical resection. Molecular information, targeted agents and immunotherapy have also altered the landscape for the management of brain metastases. This review summarises current and emerging data on the role of SRS in the management of brain metastases.

Recent studies have elucidated the diversity of genes encoding venom in sea anemones. However, most of those genes are yet to be explored in an evolutionary context. Insulin is a common peptide across metazoans and has been coopted into a predatory venom in many venomous lineages. In this study, we focus on the diversity of insulin-derived venoms in sea anemones and on elucidating their evolutionary history. We sourced data for 34 species of sea anemones and found sequences belonging to two venom families that have Insulin PFAM annotations (Cono-Insulin, VP302). Our findings show that both families have undergone duplication events. Members of each of the independently evolving clades have consistent predicted protein structures and distinct dN/dS values. Our work also shows that VP302 is part of a multidomain venom contig and has experienced a secondary gain into the venom system of cuticulate sea anemones.

Poa crymophila is a perennial, cold-tolerant, native grass species, widely distributed to the Qing-hai-Tibet Plateau. However, the molecular mechanism behind the cold stress tolerance and role of key regulatory genes and pathways of P. crymophila are poorly understood yet. Therefore, the present study investigated the physiological and transcriptome responses of P. crymophila’s roots, stems, and leaves under cold stress to explore the molecular mechanism of cold tolerance. Results of the present study suggested that cold stress significantly changed the physiologic characteristics of roots, stems, and leaves of P. crymophila. In addition, the transcriptome results showed that 4434, 8793, and 14942 differentially expressed genes (DEGs) were identified in roots, stems, and leaves, respectively; however, 464 DEGs were commonly identified in these three tissues. The Gene On-tology (GO) results showed that a large numbers of DEGs were significantly enriched in the pho-tosynthetic related categories in leaves. In addition, the “response to stimulus” category was sig-nificantly enriched in roots and stems. The Kyoto Encyclopedia of Genes and Genomes (KEGG) results showed that DEGs involved in “phenylpropanoid biosynthesis” were significantly enriched in roots, “photosynthesis” and “circadian rhythm-plant” pathways significantly enriched in stems and leaves, starch and sucrose metabolism, and galactose metabolism were pathways significantly enriched in three tissues. Weighted gene coexpression network analysis (WGCNA) identified Hub genes involved in P. crymophila cold response. This study provides new insights into the molecular mechanisms underlying the cold tolerance of P. crymophila belowground and aboveground tissues. In addition, specific genes involved in Ca2+ signaling, ROS scavenging system, hormones, circadian clock, photosynthesis, and transcription factors (TFs) were identified in P. crymophila. The identi-fication of key genes may provide valuable resources for further functional genomic and breeding studies.

Atrial fibrillation (AF) is a form of sustained cardiac arrhythmia and microRNAs (miRs) play crucial roles in pathophysiology of AF. To identify novel miR-mRNA pairs, we performed RNAseq from atrial biopsies of AF and non-AF patients. Differentially expressed miRs (11-down and 9-up) and mRNAs (95-up and 82-down) were identified and hierarchically clustered in a heat-map. Subsequently, GO, KEGG, and GSEA analyses were run to identify deregulated pathways. Then, miR targets were predicted in miRDB database, and a regulatory network of negatively correlated miR-mRNA pairs was constructed using Cytoscape. To select potential candidate genes from GSEA analysis, top-50 enriched genes in GSEA were overlaid with predicted targets of differentially deregulated miRs. Besides, protein-protein-interaction (PPI) network of enriched genes in GSEA was constructed, and subsequently GO and canonical pathway analyses were run for genes in PPI network. Our analyses showed that TNF-α, p53, EMT, and SYDECAN1 signaling were among the highly affected pathways in AF samples. SDC-1 (syndecan-1) was the top-enriched gene in p53, EMT, and SYDECAN1 signaling. Consistently, SDC-1 mRNA and protein levels were significantly higher in atrial samples of AF patients. Among negatively correlated miRs, miR-302b-3p was experimentally validated to suppress SDC-1 transcript levels. Overall, our results suggested that miR-302b-3p/SDC-1 axis may involve in pathogenesis of AF.

Heavy metals are dangerous contaminants constituting a threat to human health because they persist in soils and are easily transferred into the food chain, causing damages to human health. Among heavy metals, nickel appears to be one of the most dangerous responsible for different disorders. Public health protection requires nickel detection in environment and food chains; a simple, rapid and sensitive method to detect nickel contamination is represented by biosensors. In this paper we report the setup of a whole-cell based system, in which protoplasts, obtained from Nicotiana tabacum leaves, were used as transducers to detect the presence of heavy metal ions and, in particular, nickel ions. Protoplasts were genetically modified with a plasmid containing the GFP reporter gene under the promoter region of a sunflower small HSP gene control. By this device the presence of heavy metal ions was detected. Thus, the possibility to use this whole-cell system as a novel tool to detect the presence of nickel ions in food matrices was assessed.

A 23-month-old neutered male dog of unknown ancestry presented with a history of progressive neurological signs that included anxiety, cognitive impairment, tremors, seizure activity, ataxia, and pronounced visual impairment. The clinical signs were accompanied by global brain atrophy. Due to progression in the severity of disease signs, the dog was euthanized at 26 months of age. Examination of tissues collected at necropsy revealed dramatic intracellular accumulations of autofluorescent inclusions in the brain, retina, and cardiac muscle. The inclusions were immunopositive for subunit c of mitochondrial ATP synthase, and their ultrastructural appearances were similar to those of lysosomal storage bodies that accumulate in some of the neuronal ceroid lipofuscinosis (NCL) diseases. The also dog exhibited widespread neuroinflammation. Based on these findings, the dog was deemed likely to have suffered from a form of NCL. A whole genome sequence analysis of the proband’s DNA revealed a homozygous C to T substitution that altered the intron 3 – exon 4 splice site of CLN6. Other mutations in CLN6 cause NCL diseases in humans and animals including dogs. CLN6 protein was undetectable with immunolabeling in the tissues of the proband. Based on the clinical history, fluorescence and electron-microscopy, immunohistochemistry, and molecular genetic findings, the disorder in this dog is classified as an NCL resulting from the absence of CLN6 protein. Screening the dog’s genome for a panel of breed-specific polymorphisms indicated that its ancestry included numerous breeds, with no single breed predominating. This suggests that the CLN6 disease variant is likely to be present in other mixed breed dogs and at least some of the ancestral breeds.

To facilitate the promotion and application of the whole process engineering consulting (WPEC) model, the transmission mechanism of influencing factors in WPEC's promotion and application is investigated. It identifies and categorizes the influencing factors within the framework of "external environment-project factors-stakeholders", systematically organizing and summarizing ten primary categories and thirty-eight secondary influencing factors of WPEC's promotion and ap-plication. Utilizing the complex network analysis method, a network of influencing factors in the promotion and application of WPEC is constructed. The network is then converted into three binary networks based on weight, which are subjected to structural analysis and motif analysis. On this basis, the transmission mechanism of influencing factors in WPEC's promotion and applica-tion and its causations are explored.

The present study aimed to determine the genetic diversity of isolates of Mycobacterium tuberculosis (Mtb) from presumed drug resistant tuberculosis patients from several states of Brazil. The isolates had been submitted to conventional drug susceptibility testing for first- and second-line drugs. Multidrug-resistant (MDR-TB) (54.8%) was the most frequent phenotypic resistance profile, in addition to an important high frequency of pre-extensively resistant (p-XDR-TB) (9.2%). Using whole-genome sequencing (WGS), we characterized 298 Mtb isolates from Brazil. Besides analysis of genotype distribution and possible correlations between molecular and clinical data, we determined the performance of an in-house WGS pipeline with other online pipelines for Mtb lineages and drug resistance profile definition. Sub-lineage 4.3 (52%) was the most frequent genotype and the genomic approach revealed a p-XDR-TB level of 22.5%. We detected 20 novel mutations in three resistance genes, and six of these were observed in eight phenotypically resistant isolates. Cluster analysis of 170 isolates showed that 43.5% of the TB patients belonged to 24 genomic clusters, suggesting considerable ongoing transmission of DR-TB, including two interstate transmissions. The in-house WGS pipeline showed the best overall performance in drug-resistance prediction, presenting the best accuracy values to five of nine drugs tested. Significant associations were observed between suffering from fatal disease and genotypic p-XDR-TB (p = 0.03) and either phenotypic (p = 0.006) and genotypic (p = 0.0007) ethambutol resistance. The use of WGS analysis improved our understanding of the population structure of MTBC in Brazil, genetic and clinical data correlations and demonstrating its utility for surveillance efforts for spread of DR-TB, hopefully helping to avoid the emergence of even more resistant strains and to reduce TB incidence and mortality rates.

Multidrug resistance (MDR) among gram-negative bacteria is a global public health threat because it has exhausted all standard therapeutic options. This has necessitated clinicians to reconsider colistin, an “old sort” antibiotic which was deemed toxic for clinical use. Unfortunately, swift resistance towards colistin by K. pneumoniae has been reported in different parts of the world. The study aimed at investigating the genetic determinants of colistin resistance in K. pneumoniae isolated from patients admitted in a tertiary care hospital in Kampala, Uganda. 31 archived multidrug resistant K. pneumoniae isolates obtained from rectal swabs of patients admitted to the Mulago Hospital ICU were retrieved. From this collection, we selected 7 colistin resistant K. pneumoniae isolates for whole genome sequencing and molecular profile analysis. In silico sequence data analyses were performed using established web-based bioinformatics tools. The sequence analysis of the genes involved in colistin resistance revealed several non-synonymous mutations in nucleotide sequences of pmrA, pmrB, phoP, phoQ and mgrB genes. Insertion transposase genes for the insertion sequences IS1 and IS5 which are highly implicated in colistin resistance via modification or inactivation of mgrB gene were identified in all isolates and were located in the chromosomal DNA at different genomic positions. No plasmid-borne mcr genes were detected. More so, the strains harbored numerous multidrug resistant genes. This study underscores the need of genomic surveillance of K. pneumoniae strains to limit further spread of colistin resistance genes to avert the potential risk of pandrug resistance. And high throughput sequencing is imperative.

Background: This prospective study assesses the use of Rapid Remote Online Cytological Evaluation analysis for diagnosing endoscopical achieved biopsies. It focuses on its effectiveness in identifying benign and malignant conditions using digital image processing. Methods: The study was conducted between April 2021 and September 2022 and involved a total of 314 Rapid Remote Online Cytological Evaluations (17 brush, 143 fine needle aspirations and 154 imprint cytologies) analyses performed on 239 patients at the LungenClinic Grosshansdorf. During on-site evaluation via telecytology, the time requirement was determined and the findings were compared with the cyto-/histological and final diagnoses. Results: By means of Rapid Remote Online Evaluation, 86 cytological benign and 190 malignant and 38 findings of unclear diagnosis were recorded (Ø assessment time 100 sec., range 11 - 370sec.). In 27 of the 38 cases with unclear diagnosis, the final findings were malignant tumours and only 6 were benign changes. The diagnosis of another five of these 38 cases remained unclear. Excluding these 38 findings, the Rapid Remote online cytology achieved a sensitivity of 78.6% with a specificity of 99.5% and a correct classification rate of 93.1% with regard to the final diagnosis of all cases. As expected, an increase in the sensitivity rate for the cytological detection of malignant tumours (76.1% vs. 92.5%) was found especially in fine-needle aspirations. Conclusions: Rapid remote online analysis allows fast quantitative and qualitative evaluation of clinically obtained cytological specimens. With a correct classification rate of more than 93%, sampling deficiencies can be corrected promptly and diagnostic and therapeutic approaches can be derived.

Methicillin-resistant Staphylococcus aureus (MRSA) constitutes a serious public health concern with a considerable impact on patients' health and substantial healthcare costs. In this study, patients, and healthcare workers (HCWs)from six public hospitals in Benin were screened for MRSA. Strains were identified as MRSA using conventional microbiological methods in Benin and confirmed using Matrix-Assisted Laser Desorption/Ionization Time of Flight (MALDI-TOF) mass spectrometry in Belgium. Whole genome sequencing (WGS) was used on confirmed MRSA isolates to characterize their genomic content and study their relatedness. In total,304 and 61 samples were collected from patients and HCWs, respectively. The mecA gene was detected in all isolates. The isolates were assigned to five sequence types (STs), with ST8 (55.6%, n=15), ST152 (18.52%, n=5), and ST121 (18.52%, n=5) being the most common. All isolates carried multiple virulence genes, including genes encoding the Panton-Valentine leukocidin toxin (48.15%, n=13) and the test gene (29.63%, n=8) associated with toxic shock syndrome. The presence of strains carrying numerous genomic features associated with antibiotic resistance and virulence in HCWs is a major public health concern. This study highlights the need to implement a multimodal strategy for reducing the risk of cross-transmission of MRSA in hospitals.

This study aims to investigate the impact of body heat loss on the thermal and aerodynamic conditions in a whole-body cryotherapy chamber. The underlying hypothesis is that the heat generated by the human body alters the thermal and aerodynamic environment inside the cabin. A numerical study was conducted to test this hypothesis to analyze the thermodynamic exchanges between the human body and the cabin during a 3-minute whole-body cryotherapy session. The computational fluid dynamics (CFD) approach was used to study the unsteady heat transfer between the human body and the interior of the cryotherapy cabin. A thermal boundary condition, based on a mathematical model developed from experimental data, was applied to simulate skin cooling kinetics over time. The post-processing of the 3D results, including temperature, velocity fields, and thermal flux maps at the body surface, provided insight into the thermo-convective mechanisms involved in a whole-body cryotherapy session. The study found that body heat loss significantly affects the temperature fields inside the cabin, leading to global modifications of the aeraulic and thermal conditions. These findings suggest that cryotherapy protocols may need to be adjusted or the cabin set temperature optimized to enhance the therapeutic benefits.

Background: After its initial detection in Wuhan, China, in December 2019, SARS-CoV-2 has spread rapidly, causing successive epidemic waves worldwide. This study aims to provide a genomic epidemiology of SARS-CoV-2 in Burkina Faso. Methods: Three hundred and seventy-seven SARS-CoV-2 genomes obtained from PCR-positive nasopharyngeal samples (PCR cycle threshold score <35) collected between May 5, 2020, and January 31, 2022 were analysed. Genomic sequences were assigned to phylogenetic clades using NextClade and to Pango lineages using pangolin. Phylogenetic and phylogeographic analyses were performed to determine the geographical sources and time of virus introduction in Burkina Faso. Results: The analyzed SARS-CoV-2 genomes could be assigned to 10 phylogenetic clades and 27 Pango lineages already described worldwide. Our analyses revealed the important role of cross-border human mobility in the successive SARS-CoV-2 introductions in Burkina Faso from neighboring countries. Conclusion: This study provides additional insights into the genomic epidemiology of SARS-CoV-2 in West Africa. It highlights the importance of land travel in the spread of the virus and the need to rapidly implement preventive policies. Regional cross-border collaborations and the adherence of the general population to government policies are key to prevent new epidemic waves.

Many neonates undergoing whole body hypothermia (WBH) following moderate to severe perinatal asphyxia suffer from renal impairment. While recent data suggest a WBH-related reno-protection, the differences in serum creatinine (Scr) patterns to reference patterns were not yet reported. We therefore aimed to document Scr trends and patterns in asphyxiated neonates undergoing WBH, and compared these to centiles reference Scr dataset of non-asphyia neonates. Using a systematic review strategy, reports on Scr trends (mean ± SD, or median and range) were collected (day 1-7) in WBH cohorts, and compared to centiles of an earlier reported reference cohort of non-asphyxia cases. Based on 13 papers on asphyxia+WBH cases, a pattern on postnatal Scr trends in asphyxia+WBH cases was constructed. Compared to the reference cohort, mean or median Scr values at birth (>90th centile) and the first two days of WBH (>75th centile) remained clinical relevantly higher in asphyxia+WBH cases, with a subsequent decline to reach at best high or high normal creatinine values (all >50th centile, but mainly >75th centile) from day 4 onwards. Such patterns are valuable to anticipate average changes in renal clearance capacity relevant for pharmacotherapy, but do not yet cover the relevant inter-patient variability observed in WBH cases.

Baeyer-Villiger monoxygenases (BVMOs) are flavin-dependant oxidative enzymes capable to catalyse the insertion of an oxygen atom between a carbonylic Csp2 and the Csp3 at the alpha position, therefore transforming linear and cyclic ketones into esters and lactones. These enzymes are dependent on nicotinamides (NAD(P)H) for the flavin reduction and subsequent reaction with molecular oxygen to furnish peroxyflavin, the ultimate responsible for the substrate oxidation. BVMOs can be included in cascade reactions, coupled to other redox enzymes such as alcohol dehydrogenases (ADHs) or ene-reductases (EREDs), so that the direct conversion of alcohols or α,β-unsaturated carbonylic compounds to the corresponding esters can be achieved. This way, it is possible to develop smart synthetic strategies with a convenient cofactor recycling, both using whole cells (native or genetically engineered) as well as isolated enzymes, via multi-steps reaction through sequential or parallel methodologies. Some examples will be commented dealing with these biotransformations, highlighting the advantages of the coupling of enzymatic steps.

Congenital Pouch Colon (CPC) is a rare anorectal anomaly common to North Western India specifically Rajasthan. Despite efforts to understand the clinical genetic makeup of CPC, no attempt on identifying non-coding RNAs was done. We have earlier reported CPC's rare variants from whole exome sequencing across 18 affected samples in a total of 64 subjects. A Smith-Waterman algorithm was used to infer a couple of lncRNAs from WES samples of CPC with predictions from the Noncode database. Further screening and quantification using PCR, we ascertained interactions using Micro Scale Thermophoresis (MST). We report the role of lnc-EPB41-1-1 shown to be promiscuously interacting with KIF13A substantiating their role in regulation.

Due to the limitations on the capabilities of current robots regarding task learning and performance, imitation is an efficient social learning approach that endows a robot with the ability to transmit and reproduce human postures, actions, behaviors, etc., as a human does. Stable whole-body imitation and task-oriented teleoperation via imitation are challenging issues. In this paper, a novel comprehensive and unrestricted real-time whole-body imitation system for humanoid robots is designed and developed. To map human motions to a robot, an analytical method called geometrical analysis based on link vectors and virtual joints (GA-LVVJ) is proposed. In addition, a real-time locomotion method is employed to realize a natural mode of operation. To achieve safe mode switching, a filter strategy is proposed. Then, two quantitative vector-set-based methods of similarity evaluation focusing on the whole body and local links, called the Whole-Body-Focused (WBF) method and the Local-Link-Focused (LLF) method, respectively, are proposed and compared. Two experiments conducted to verify the effectiveness of the proposed methods and system are reported. Specifically, the first experiment validates the good stability and similarity features of our system, and the second experiment verifies the effectiveness with which complicated tasks can be executed. At last, an imitation learning mechanism in which the joint angles of demonstrators are mapped by GA-LVVJ is presented and developed to extend the proposed system.

Clinical metagenomics (CMg), referred to as the application of next-generation sequencing (NGS) to clinical samples, is a promising tool for the diagnosis of hospital-acquired pneumonia (HAP). Indeed, CMg allows identifying pathogens and antibiotic resistance genes (ARGs), thereby providing the information required for the optimization of the antibiotic regimen. Hence, provided that CMg would be faster than conventional culture, the probabilistic regimen used in HAP could be tailored faster, which should lead to an expected decrease of mortality and morbidity. While the inference of the antibiotic susceptibility testing from metagenomic or even genomic data is challenging, a limited number of antibiotics are used in the probabilistic regimen of HAP (namely beta-lactams, aminoglycosides, fluoroquinolones, glycopeptides and oxazolidinones). Accordingly in the perspective of applying CMg to the early diagnostic of HAP, we aimed at reviewing the performances of whole genomic sequencing (WGS) of the main HAP-causing bacteria (Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter baumannii, Stenotrophomonas maltophilia and Staphylococcus aureus) for the prediction of susceptibility to the antibiotic families advocated in the probabilistic regimen of HAP.

Neurofibromatosis type1 (NF1) is an autosomal dominant disorder caused by mutations in the NF1gene. Although congenital pseudarthrosis of the tibia (CPT) has frequently been associated with NF1, the underlying molecular mechanism of CPT in these NF1 patients is yet ill-understood. The aim of the present study was to detect NF1 mutations from genomic DNA and to harbor variants associated with CPT in NF1 patients. Whole-exome sequencing was first carried out with samples from two patients with CPT in one NF1 family, and a novel mutation c.2324A>G (p.E775G) in NF1 gene was identified. Additionally, a missense variant c.455C>T (p.P152L) in BCOR gene completely co-segregated with the CPT phenotype within this family. Subsequently, NF1 and NF2 genes in four other unrelated patients with both NF1 and CPT were screened using targeted sequencing. Four mutations in NF1 gene, including two known mutations (c.2288T>C/p.L763P, c.574 C>T/p.R192*) and two novel mutations (c.768delT/p.F256Lfs*25, c.2229_2230delTG/ p.V744Qfs*23) were detected. Further study confirmed that CPT was present in NF1 families, and NF1 mutations were closely associated with these complex phenotypes. Moreover, the data from the current study indicated that male gender might be a susceptibility factor for CPT in NF1. Therefore, we speculated that BCOR variants might be related to CPT phenotype among male NF1 patients.

The aim of this study was to identify the differentially expressed genes (DEG) from the skeletal muscle and liver samples of animal model for metabolic diseases in human. To perform the study, the fatty acid (FA) profile and RNA sequencing (RNA-Seq) data of 35 samples of liver tissue (SOY1.5, n=17 and SOY3.0, n=18) and 36 samples of skeletal muscle (SOY1.5, n=18 and SOY3.0, n=18) of Large White pigs were analyzed. The FA profile of the tissues was modified by the diet, mainly those related to monounsaturated (MUFA) and polyunsaturated (PUFA) FA. The skeletal muscle transcriptome analysis revealed 45 DEG (FDR 10%), and the functional enrichment analysis identified network maps related to inflammation, immune process, and pathways associated with the oxidative stress, type 2 diabetes and metabolic dysfunction. For the liver tissue, the transcriptome profile analysis revealed 281 DEG, which participate in network maps related to neurodegenerative diseases. With this nutrigenomics study, we verified that different levels of soybean oil in the pig diet, an animal model for metabolic diseases in humans, affected the transcriptome profile of skeletal muscle and liver tissue. These findings may help to better understand the biological mechanisms that can be modulated by the diet.

Whole cell biosensors could serve as eco-friendly and cost-effective alternatives for detecting potentially toxic bioavailable heavy metals in aquatic environments. However, they often fail to meet practical requirements due to an insufficient limit of detection (LOD) and high background noise. In this study, we designed a synthetic genetic circuit specifically tailored for detecting ionic mercury, which we applied to environmental samples collected from artisanal gold mining sites in Peru. We developed two distinct versions of the biosensor, each utilizing a different reporter protein: a fluorescent biosensor (Mer-RFP) and a colorimetric biosensor (Mer-Blue). Mer-RFP enabled real-time monitoring of the culture’s response to mercury samples using a plate reader, whereas Mer-Blue was analysed for colour accumulation at the endpoint using a specially designed, low-cost camera set up for harvested cell pellets. Both biosensors exhibited negligible baseline expression of their respective reporter proteins and responded specifically to HgBr2 in pure water. Mer-RFP demonstrated a linear detection range from 1 nM to 1 μM, whereas Mer-Blue showed a linear range from 2 nM to 125 nM. Our biosensors successfully detected a high concentration of ionic mercury in the reaction bucket where artisanal miners produce a mercury-gold amalgam. However, they did not detect ionic mercury in the water from active mining ponds, indicating a concentration lower than 3.2 nM Hg2+ -a result consistent with chemical analysis quantitation. Furthermore, we discuss the potential of Mer-Blue as a practical and affordable monitoring tool, highlighting its stability, reliance on simple visual colorimetry, and the possibility of sensitivity expansion to organic mercury.

Monoclonal antibodies (mAbs) are an important treatment option for COVID-19 caused by SARS-CoV-2, especially in immunosuppressed patients. However, this treatment option can become ineffective due to mutations in the SARS-CoV-2 genome, mainly in the receptor binding domain (RBD) of the spike (S) protein. In the present study 7950 SARS-CoV-2 positive samples from the Uppsala and Örebro regions of central Sweden collected between March 2022 and May 2023 were whole-genome sequenced using next-generation sequencing, mainly with the Nanopore sequencing method. Pango lineages were determined and all single nucleotide polymorphism (SNP) mutations that occurred in these samples were identified. The dominant sublineages changed over time and mutations conferring resistance to currently available mAbs became common. Notable ones are R346T and K444T mutations in the RBD that confer significant resistance against tixagevimab and cilgavimab mAbs. Further, mutations conferring a high-fold resistance to bebtelovimab, such as the K444T and V445P mutations, were also observed in the samples. This study highlights that resistance mutations have over time rendered currently available mAbs ineffective against SARS-CoV-2 in most patients. Therefore, there is a need for continued surveillance of resistance mutations and the development of new mAbs that target more conserved regions of the RBD.

Background: Carbapenem-resistant Klebsiella pneumoniae (CRKP) is a serious public health issue. Aim of the study was to identify the antimicrobial resistance and accessory genes, the clonal relatedness and the evolution dynamics of selected CRKP isolates recovered in an adult and a pediatric intensive care unit of a tertiary hospital in Greece. Methods: Twenty-four CRKP isolates recovered during 2018-2022 were included in the study. Next-generation sequencing was performed using the Ion Torrent PGM Platform. The identification of the plasmid content, MLST and antimicrobial resistance genes, as well as the comparison of multiple genome alignments and the identification of core genome single-nucleotide polymorphism sites, were performed applying various bioinformatics software. Results: The isolates belonged to eight sequence types 11, 15, 30, 35, 39, 307, 323, and 512. A variety of carbapenemases (KPC, VIM, NDM and OXA-48) and resistance genes were detected. CRKP strains shared visually common genomic regions with the reference strain (NTUH-K2044). ST15, ST323, ST39, and ST11 CRKP isolates presented on average 17, 6, 16 and 866 recombined SNPs, respectively. All isolates belonging to ST15, ST323 and ST39 were classified in distinct phylogenetic branches, while ST11 isolates were assigned to a two-subclade branch. For large CRKP sets, the phylogeny seems to change approximately every seven SNPs. Conclusion: The current study provides insight into the genetic characterization of CRKP isolates in the ICUs of a tertiary hospital. Our results indicate clonal dispersion of ST15, ST323, and ST39 and highly diverged ST11 isolates.

Abstract The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was first identified in people in the city of Wuhan at the end of December 2019, and it has since spread to all continents. Global interest has been focused on discovering a treatment and developing a successful coronavirus vaccine as a result of the emergence of this new coronavirus. In this research, we sequenced the whole genome of the SARS-COV-2 virus that were isolated from 40 patients in Duhok, Iraq. 95 different mutations were identified in our isolation when such the whole genome sequence of the SARS-COV-2 isolated from the city of Wuhan, China (Accession number: NC 045512.2) was matched to the virus's sequence using Sequencing technology (Illumina , USA ) and Assembly method (iVar 1.3.1). Sequence analysis revealed that 38 mutations were found at spike glycoprotein (S), 30 of which were found in the ORF1b , 11 mutations were found in ORF1b ,7,3,2,1 mutations were found in ( N,M,ORF6 ,ORF9 /E ) genes which had been linked to structural changes at various places. The conclusion that the cases in Iraq were of different origins of infections and had a close relationship with the isolates from different country and state were further confirmed by phylogenetic analysis and transmission. The whole genome sequence of the SARS-CoV-2 , which were identified from the Iraqi Kurdistan region, and reported as a first study in Kurdistan region.

2,5-Di(hydroxymethyl)furan (DHMF) is a high-value chemical block than can be synthesized from 5-hydroxymethylfurfural (HMF), a platform chemical that results from the dehydration of biomass-derived carbohydrates. In this work, the HMF biotransformation capability of different Fusarium species was evaluated and F. striatum was selected to produce DHMF. The effects of the inoculum size, glucose concentration and pH of the media over DHMF production were evalu-ated by a 23 factorial design. A substrate feeding approach was found suitable to overcome the toxicity effect of HMF towards the cells when added at high concentrations (>75 mM). The pro-cess was successfully scaled-up at bioreactor scale (1.3 L) with excellent DHMF production yields (95%) and selectivities (98%). DHMF was purified from the reaction media with high recovery and purity by organic solvent extraction with ethyl acetate.

Healthy human subjects develop spontaneous CD8+ T cell responses to melanocyte antigens (MA) expressed by normal melanocytes, such as Tyrosinase, MAGE-A3, Melan/Mart-1, gp100, and NY-ESO-1. This natural autoimmunity directed against melanocytes might confer protection against the development of malignant melanoma (MM), where MA are present as overexpressed tumor-associated antigens. Consistent with this notion we report here that functional T cell reactivity to MA was found to be diminished in untreated MM patients: while 57.5% of healthy controls (n=40) exhibited high-frequency MA-specific T cell reactivity ex vivo, such was detected in only 12% of the untreated MM patients (n=24). Three lines of evidence suggest that the MA-reactive T cells present in healthy subjects undergo exhaustion once MM establishes itself. First, only the MA-specific T cell reactivity was affected in the MM patients; that to third party recall antigens was not. Second, in these patients, the residual MA-specific T cells, unlike third party antigen reactive T cells, were functionally impaired, showing a diminished per cell IFN-γ productivity. Third, successful immunotherapy with AGI-101H melanoma vaccine restored natural CD8+ T cell autoimmunity to MA in 85% of the vaccinated patients (n= 27). The role of natural T cell autoimmunity to tumor-associated MA is discussed based on discrete levels of T cell activation thresholds.

The holistic approach of One Health, which sees human, animal, plant, and environmental health as a unit, rather than discrete parts, requires not only interdisciplinary cooperation, but standardized methods for communicating and archiving data, enabling participants to easily share what they have learned and allow others to build upon their findings.Ongoing work by NCBI and the GenomeTrakr project illustrates how open data platforms can help meet the needs of federal and state regulators, public health laboratories, departments of agriculture, and universities. Here we describe how microbial pathogen surveillance can be transformed by having an open access database along with Best Practices for contributors to follow. First, we describe the open pathogen surveillance framework, hosted on the NCBI platform. We cover the current community standards for WGS quality, provide an SOP for assessing your own sequence quality and recommend QC thresholds for all submitters to follow. We then provide an overview of NCBI data submission along with step by step details. And finally, we provide curation guidance and an SOP for keeping your public data current within the database. These Best Practices can be models for other open data projects, thereby advancing the One Health goals of Findable, Accessible, Interoperable and Re-usable (FAIR) data.