Standard Ethernet (IEEE 802.3 and the TCP/IP protocol suite) is gradually applied in industrial control system (ICS) with the development of information technology. It breaks the natural isolation of ICS, but contains no security mechanism. A modified intrusion detection system (IDS), which is strongly correlated to specific industrial scenario, is necessary for modern ICS. On the one hand, this paper outlines attack models, including infiltration attacks and our creative forging attack. On the other hand, we proposes a hierarchical IDS, which contains a traffic prediction model and an anomaly detection model. The traffic prediction model, which is based on autoregressive integrated moving average (ARIMA), can forecast the traffic of ICS network in the short term and precisely detect the infiltration attacks according to abnormal changes in traffic pattern. The anomaly detection model using one-class support vector machine (OCSVM) is able to detect malicious control instructions by analyzing the key field in EtherNet/IP packets. The experimental results show that the hierarchical IDS has an outstanding performance in detecting infiltration attacks and forging attack compared with other two innovative IDSs.

Security has become a critical issue in today’s highly distributed and networked systems. Network intrusion detection systems (NIDSs), especially signature-based NIDSs, are being widely deployed in a distributed network environment with the purpose of defending against a variety of network attacks. Most of the commercially available NIDSs are software based and rely on pattern matching to extract the threat from network traffic. The increase in network speed and traffic may make existing algorithms to become a performance bottleneck. Therefore it is very necessary to develop faster and more efficient pattern matching algorithm in order to overcome the troubles on performance of NIDSs. Therefore, we propose a multi fusion pattern matching algorithm for Network Intrusion Detection Systems. The results obtained in percentages from the proposed fusion algorithm given better values in terms processing time in milliseconds than the existing algorithms when data English text are applied to evaluate the fusion performances.

Nowadays, the Internet of Things (IoT) devices and applications have rapidly expanded worldwide due to their benefits in improving the business environment, industrial environment, and people's daily lives. However, the IoT devices are not immune to malicious network traffic, which causes potential negative consequences and sabotages IoT operating devices. Therefore, developing a method for screening network traffic is necessary to detect and classify malicious activity to mitigate its negative impacts. Therefore, this research proposes a predictive machine learning model to detect and classify network activity in an IoT system. Specifically, our model distinguishes between normal and anomaly network activity. Furthermore, it classifies network traffic into five categories, normal, Mirai attack, denial of service (DoS) attack, Scan attack, and man-in-the-middle (MITM) attack. Five supervised learning models were implemented to characterize their performance in detecting and classifying network activities for IoT systems. This includes models shallow neural networks (SNN), decision trees (DT), bagging trees (BT), support vector machine (SVM), and k-nearest neighbor (kNN). The learning models were evaluated on a new and broad dataset for IoT attacks, the IoTID20 dataset. Besides, a deep feature engineering process was applied to the dataset to improve the accuracy of the learning models. Our experimental evaluation exhibited an accuracy of 100% recorded for the detection using all implemented models and an accuracy of 99.4%-99.9% recorded for the classification process.

The smart grid system, an improvised form of the traditional grid, is considered a critical cyber-physical system. Due to its complex combination of smart and legacy technologies, this technology is characterized by a wide range of features such as full duplex communication, advanced metering infrastructure, remote monitoring, and control. However, despite this system’s substantial environmental and socio-economic impact on modern life, it poses severe security vulnerabilities due to its integration and interconnected and interdependent cyber-physical components. Based on the rapid development of cyber-physical systems (CPS), academics and industries have investigated relevant techniques to enhance and strengthen the security measures of the SG system. The intrusion detection system is a countermeasure, a powerful safeguard against various cyber-attacks and threats. The contribution of the IDSs to the SG paradigm is examined in this study. A comprehensive review has been presented in this study, highlighting different techniques, basic ideas, and analyses. Besides discussing the contemporary pertinent research studies, the shortcomings of the existing IDS for the SG system are also identified with a recommendation for future research direction.

The necessity for effective intrusion detection systems (IDS) in big data environments has grown critical due to the rising prevalence of big data systems and the rising amount of security threats. Applying conventional intrusion detection methods to the enormous and intricate data produced by big data ecosystems presents difficulties. Deep learning, has proven to be exceptionally adept at deciphering complex, large-scale data. This study proposes a Deep Learning-based Intrusion Detection System (IDS) created specifically for the Big Data environment. Traditional intrusion detection systems struggle to efficiently identify and prevent cyber threats due to the ever-increasing volume and complexity of data in current networks. We suggest an IDS that makes use of Deep Learning (CNN, LSTM, GAN, etc.), to address this problem. These cutting-edge neural network topologies give the system the ability to process and analyze massive amounts of data for precise intrusion detection. Data collection, data preprocessing, feature engineering, DL model training, intrusion detection, warning generation, and reaction are some of the crucial parts of the suggested IDS. The data collection module mines the Big Data environment for network traffic, system logs, and security event information. To make sure the data is suitable for analysis, it is preprocessed. To improve the detection abilities of the DL models, important features are extracted from the data using feature engineering approaches.

A practical method is presented to estimate rare earth elements (REE) concentrations in magmatic vapour phase (MVP) in equilibrium with water-saturated granitic melts based on empirical fluid-melt partition coefficients of REE (k_P^REE). The values of k_P^REEcan be calculated from a set of new polynomial equations linking to the chlorine molality (m_Cl^v) of the MVP associated with granitic melts, which are established via a statistical analysis on the existing experimental dataset. These equations may be applied to the entire pressure range (0.1 to 10.0 kb) within the continental crust, suggesting that light REEs behave differently in magmatic fluids, i.e. either being fluid compatible with higher m_Cl^v or fluid incompatible with lower m_Cl^v values. In contrast, heavy REEs are exclusively fluid incompatible and partition favourably into granitic melts. Consequently, magmatic fluids tend to be rich in LREE relative to HREE, leading to REE fractionation during the evolution of magmatic hydrothermal systems. Maximum k_P^REEvalue for each element is predicted and presented in a REE distribution diagram constrained by the threshold of m_Cl^v. REE contents of the granitic melt is approximated by whole-rock analysis, so that REE concentrations in the associated MVP would be estimated from the value of k_P^REE given chemical equilibrium retains. Two examples are provided respectively, to show the use of this method as a REE tracer to fingerprint the source of ore-fluids responsible for the Lake George intrusion-related Au-Sb deposit in New Brunswick (Canada), and for the Bakircay Cu-Au (-Mo) porphyry systems in northern Turkey.

The IDS serves as a security system that maintains constant surveillance over network traffic and host systems in order to identify any security breaches or potentially concerning activities. Recently. the rise in cyber-attacks has driven the necessity for the development of automated and intelligent network intrusion detection systems. These systems are designed to learn the typical patterns of network traffic, allowing them to identify any deviations from normal behaviour, which can be classified as anomalous or malicious. Machine learning methods are widely used to exhibit a satisfactory effectiveness in detecting malicious payloads in the network traffic. While the volume of the data generated from IDS is increasing exponentially results in the emergence of substantial security risks, it highlighted the imperative to strengthen network security. The performance of traditional machine learning methods depends on the dataset and the data balance distribution in it. while most of IDS datasets suffer from unbalancing, this limits the performance of the machine learning method used in the system and results in missed detections and false alarms in the conventional IDSs. To address this issue, this paper presents a new model-based Generative Adversarial Network (GAN) called TDCGAN to enhance the detection rate of less of minor class in the dataset while maintaining efficiency. The proposed model consists of one generator and three discriminators with an election layer at the end of architecture. The UGR’16 data set is used for evaluation purposes. In order to demonstrate the efficacy of our proposed model, various machine learning algorithms have been utilized for comparison. The experimental findings have determined that TDCGAN presents an efficient resolution for addressing imbalanced intrusion detection and surpasses the performance of other oversampling machine learning methods.

. In today’s world, cyber attack is one of the major issues concerning the organizations that deal with technologies like cloud computing, big data, IoT etc. In the area of cyber security, intrusion detection system (IDS) plays a crucial role to identify suspicious activities in the network traffic. Over the past few years, a lot of research has been done in this area but in the current scenario, network attacks are diversifying in both volume and variety. In this regard, this research article proposes a novel IDS where a combination of information gain and decision tree algorithm has been used for the purpose of dimension reduction and classification. For experimental purpose the NSL-KDD dataset has been used. Initially out of 41 features present in the dataset only 5 high information gain valued features are selected for classification purpose. The applicability of the selected features are evaluated through various machine learning based algorithms. The experimental result shows that the decision tree based algorithm records highest recognition accuracy among all the classifiers. Based on the initial classification result a novel methodology based on decision tree has been further developed which is capable of identifying multiple attacks by analyzing the packets of various transactions in real time.

Cloud computing is an emerging area which provide on demand computing resources and services through internet. It is faster and efficient technique but prone to severe security attacks. In this paper author have proposed a Network Intrusion Detection System (NIDS) to detect attacks at front end and backend when bulky flow of data packets flowing in a cloud environment. In our framework we used Signature based detection system for identifying the intruder and the Anomaly based detection system for detecting network attacks. The NIDS sensors were placed in a collaborative manner to prevent the attacks and to update the knowledge bases. Author have used supervised learning model to detect abnormal behavior of packets from network traffic. The dataset were trained and tested in terms of precision, recall, accuracy and model build time to select the best machine-learning model for detection of intruder and to improve the computational time and performance.

Cyber security plays an important role to protect our computer, network, program and data from unauthorized access. Intrusion detection system (IDS) and intrusion prevention system (IPS) are two main categories of cyber security, designed to identify any suspicious activities present in inbound and outbound network packets and restrict the suspicious incident. Deep neural network plays a significant role in the construction of IDS and IPS. This paper highlights a novel IDS using optimized convolution neural network (CNN-IDS). An optimized CNNIDS model is an improvement over CNN which selects the best weighted model by considering the loss in every epoch. All the experiments have been conducted on the well known NSL-KDD dataset. Information gain has been used for dimensionality reduction. The accuracy of the proposed model is evaluated through optimized CNN for both binary and multiclass categories. Finally, a critical comparison has been performed with other general classifiers like J48, Naive Bayes, NB tree, Random forest, Multilayer Perceptron (MLP), Support Vector Machine (SVM), Recurrent Neural Network (RNN) and Convolution Neural Network(CNN). All the experimental results demonstrate that the optimized CNN-IDS model records the best recognition rate with minimum model construction time.

An existing power grid is going through a massive transformation. Smart grid technology is a radical approach for improvisation in prevailing power grid. Integration of electrical and communication infrastructure is inevitable for the deployment of Smart grid network. Smart grid technology is characterized by full duplex communication, automatic metering infrastructure, renewable energy integration, distribution automation and complete monitoring and control of entire power grid. Wireless sensor networks (WSNs) are small micro electrical mechanical systems which are accomplished to collect and communicate the data from surroundings. WSNs can be used for monitoring and control of smart grid assets. Security of wireless sensor based communication network is a major concern for researchers and developers. The limited processing capabilities of wireless sensor networks make them more vulnerable to cyber-attacks. The countermeasures against cyber-attacks must be less complex with an ability to offer confidentiality, data readiness and integrity. The address oriented design and development approach for usual communication network requires a paradigm shift to design data oriented WSN architecture. WSN security is an inevitable part of smart grid cyber security. This paper is expected to serve as a comprehensive assessment and analysis of communication standards, cyber security issues and solutions for WSN based smart grid infrastructure.

In recent years, several industries have registered an impressive improvement in technological advances such as Internet of Things (IoT), e-commerce, vehicular networks, etc. These advances have sparked an increase in the volume of information that gets transmitted from different nodes of a computer network (CN). As a result, it is crucial to safeguard CNs against security threats and intrusions that can compromise the integrity of those systems. In this paper, we propose a machine mearning (ML) intrusion detection system (IDS) in conjunction with the Genetic Algorithm (GA) for feature selection. To assess the effectiveness of the proposed framework, we use the NSL-KDD dataset. Furthermore, we consider the following ML methods in the modelling process: decision tree (DT), support vector machine (SVM), random forest (RF), extra-trees (ET), extreme gradient boosting (XGB), and naïve Bayes (NB). The results demonstrated that using the GA algorithm has a positive impact on the performance of the selected classifiers. Moreover, the results obtained by the proposed ML methods were superior to existing methodologies.

As the world increasingly becomes more interconnected, the demand for safety and security is ever-increasing, particularly for industrial networks. This has prompted numerous researchers to investigate different methodologies and techniques suitable for intrusion detection systems (IDS) requirements. Over the years, many studies have proposed various solutions in this regard including signature-based and machine-learning (ML) based systems. More recently, researchers are considering deep learning (DL) based anomaly detection approaches. Most proposed works in this research field aimed to achieve either one or a combination of high accuracy, considerably low false alarm rates (FARs), high classification specificity and detection sensitivity, achieving lightweight DL models, or other ML and DL-related performance measurement metrics. In this study, we propose a novel method to convert a raw dataset to an image dataset to magnify patterns. Based on this we devise an anomaly detection for IDS using a lightweight convolutional neural network (CNN) that classifies denial of service and distributed denial of service. The proposed methods were evaluated using a modern dataset, CSE-CIC-IDS2018, and a legacy dataset, NSL-KDD. We have also applied a combined dataset to assess the generalization of the proposed model across various datasets. Our experimental results have demonstrated that the proposed methods achieved high accuracy and considerably low FARs with high specificity and sensitivity. The resulting loss and accuracy curves have also demonstrated the excellent generalization of the proposed lightweight CNN model, effectively avoiding overfitting. This holds for both the modern and legacy datasets, including their mixed version.

Since the advent of the Internet, there has been a significant shift from wired to wireless communication between devices. The volume of data transmitted has surged, primarily driven by the exponential growth of network services, Internet of Things (IoT) devices, and online users. This trend became especially pronounced with the onset of the COVID-19 pandemic, as the Internet's role and significance expanded dramatically. People began to spend more time online, engaging in activities like e-learning, remote work, and online shopping. Concurrently, concerns about the security of wireless communication channels have escalated. As more data is stored and transmitted over the Internet, cybercriminals are actively seeking unauthorized access to it to further their malicious objectives. Through a comprehensive literature review in the realm of wireless network security and privacy, it has become evident that several factors render these networks susceptible to vulnerabilities. The aim of this paper is to shed light on the major and common security and privacy challenges faced by existing wireless networks. Additionally, it seeks to demonstrate the array of techniques available to mitigate these issues. Ultimately, this paper will culminate in an in-depth analysis of cybersecurity measures to address the issues in wireless networks.

The ever-evolving landscape of technology continually drives the demand for more robust and secure systems. Intrusion Detection and Prevention Systems (IPS) play a pivotal role in safeguarding digital infrastructures. IPS harnesses a blend of cutting-edge technologies, specifically Network-Based, Wireless-Based, and Host-Based Intrusion Detection Systems (IDS), to fortify network security. This multifaceted approach enhances the system's capacity to scrutinize incoming data and network traffic, effectively reducing the risk of intrusion. In the realm of malicious activity detection, IPS employs a diverse array of techniques and mechanisms. Our proposed IPS integrates both anomaly-based and signature-based analysis approaches. In signature-based analysis, intrusions are identified by matching data collected from various activities with pre-defined signatures, employing rule-based methods to detect anomalies effectively. In the anomaly-based analysis approach, the system juxtaposes current activities with a baseline of normal behaviour to flag any deviations. This is achieved through distance-based methods, ensuring a well-rounded approach to threat detection. Our comprehensive prevention system encompasses a suite of security measures, including anti-virus software, Deep Packet Inspection, and Quarantine. These components work in synergy to detect and thwart malicious activities effectively. Even when concealed or hidden, the IPS remains a reliable sentinel, ensuring the integrity of your digital ecosystem. This review delves into the intricate web of terminologies and concepts surrounding Intrusion Detection and Prevention Systems, shedding light on the evolving technology landscape and the critical role IPS plays in bolstering cybersecurity.

A single Information security is of pivotal concern for consistently streaming information over the widespread internetwork. The bottleneck flow of incoming and outgoing data traffic introduces the issue of malicious activities taken place by intruders, hackers and attackers in the form of authenticity desecration, gridlocking data traffic, vandalizing data and crashing the established network. The issue of emerging suspicious activities is managed by the domain of Intrusion Detection Systems (IDS). The IDS consistently monitors the network for identifica-tion of suspicious activities and generates alarm and indication in presence of malicious threats and worms. The performance of IDS is improved by using different signature based machine learning algorithms. In this paper, the performance of IDS model is determined using hybridization of nestrov-accelerated adaptive moment estimation –stochastic gradient descent (HNADAM-SDG) algorithm. The performance of the algorithm is compared with other classi-fication algorithms as logistic regression, ridge classifier and ensemble algorithm by adapting feature selection and optimization techniques

This report covers the analysis of Intrusion Detection Systems nowadays. Therefore, it focuses on the IDS classification, which includes not only a well-known explanation of Network/Host-Based IDS type but also cloud-based solutions. The paper explores ways of intrusion detection, providing examples of the best detecting tools (OSSEC, Snort or Bro (ZEEK)). Another aspect covered in this report is the juxtaposition of three systems: IDS, IPS and IRS and their response. Finally, there will be presented Intrusion Detection Systems' evasion techniques and challenges, followed by critical conclusions.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This study aims to develop a performance evaluation system that can facilitate performance evaluation at region, hospital, and department levels to enable better cost management for sustainable development. A multi-level system of performance evaluation informs a hierarchical assessment of cost management from regions to hospitals to departments using diagnosis-related group (DRGs). Various metrics are developed employing the variances between targets and actuals where targets are determined from two perspectives: benchmarking using external regional prices and change management using internal data. Targets for the latter are statistically based and specifically incorporate variability. The model is applied to two hospitals, twenty departments, nine DRGs and 1071 inpatients. The analyses indicate that the approach can provide a practical evaluation tool that allows for particular characteristics at multiple levels. The system provides macro-micro and external-internal perspectives in performance, enabling high-level variances to be decomposed thereby identifying sources of performance variability and financial impact.

As Automated Driving Systems (ADS) technology gets assimilated into the market, the driver’s obligation will be changed to a supervisory role. A key point to consider is the driver’s engagement in the secondary task to maintain the driver/user in the control loop. The paper’s objective is to monitor driver engagement with a game and identify any impacts the task has on hazard recognition. We designed a driving simulation using Unity3D and incorporated three tasks: No-task, AR-Video, and AR-Game tasks. The driver engaged in an AR object interception game while monitoring the road for threatening road scenarios. From the results, there was less than 1 second difference between the means of gaming task (mean = 2.55s, std = 0.1002s) to no-task (mean = 2.55s, std = 0.1002s). Game scoring followed three profiles/phases: learning, saturation, and decline profile. From the profiles, it is possible to quantify/infer drivers’ engagement with the game task. The paper proposes alternative monitoring that has utility, i.e., entertaining the user. Further experiments AR-Game focusing on real-world car environment will be performed to confirm the performance following the recommendations derived from the current test.

This study presents the developments regarding the time-domain-induced polarisation method, as a supporting tool for resistivity soundings during investigations of coastal detrital aquifers that are salinised by marine intrusion. The interpretation of resistivity measurements in such aquifers, which have variable hydrochemistry and lithology, involves uncertainties owing to the presence of low-resistivity lithologies, such as clays. To reduce these uncertainties, the use of other geophysical parameters is necessary; hence, this study focuses on induced polarisation, since it can be measured simultaneously with resistivity. In detail, we propose the determination of induced polarisation using 1D techniques, while developing a different algorithm for processing the induced polarisation data. The aim is to extend the results of this phenomenon, using instead of chargeability, the concepts of polarisability and decay time, which are extracted from the decay curve, given that they represent more intrinsic properties of the various analysed subsurface media. We present results obtained by applying this methodology to a Quaternary aquifer of the Costa del Sol in the SE Iberian Peninsula (in the province of Almería) during two different campaigns, one before and one after winter (i.e., in October and February, respectively). The results reveal the position of the saline front during each campaign, while reflecting the seasonal movement of the marine intrusion.

Dry intrusion is an important mid-latitude atmosphere phenomenon within the upper troposphere and lower stratosphere. It is always found to be related to the cyclogenesis, rainstorm, as well as convection generation and precipitation enhancement. Since the atmosphere environment for any of these above-mentioned weather is terribly complicated, those preexisting popular schemes which takes no account of water vapor may not suitable for detecting the dry intrusion related to these weathers. With regard to the merits and demerits of the current preexisting schemes, a new scheme based on Fengyun-2E geo-stationary satellite data is presented in this study to detect the atmospheric dry intrusion. The scheme is set up based on the statistical relationship between water vapor at high level troposphere, the general moist potential vorticity, ozone concentration and upper-level jet. After using the total amount of ozone and ozone profile operational products retrieved by Fengyun-3 Polar Orbiting Meteorological Satellites and the potential vorticity calculated by ECMWF Interim data for validation, this scheme is applied to analyze two typical middle-latitude weather processes. One is the famous Beijing extreme rainfall of 21 July 2012 and the other is a hailstorm occurred on the eastern China during March 19, 2014. A good application effect in both cases suggests that our new method of detecting dry intrusion is feasible and can be helpful in middle-latitude disastrous weather monitoring and forecasting.

In today's digital landscape, cybersecurity has become a priority, with attacks becoming increasingly sophisticated. Traditional security approaches are no longer enough, requiring a more dynamic and advanced response. In this context, integrating Artificial Intelligence (AI) and Machine Learning (ML) appears key to addressing this growing threat. However, despite their high effectiveness, there is a developed problem: the integration of various data sources and technologies for comprehensive protection. This article presents an in-depth review of integrating Artificial Intelligence and Machine Learning in cybersecurity, focusing particularly on Open Extended Detection and Response (Open XDR) technology. The literature review in this article was meticulously conducted with specific criteria in mind. It focused on sourcing peer-reviewed journals, authoritative cybersecurity publications, and recent conferences that primarily concentrate on the advancements in AI and ML within the cybersecurity domain, particularly from 2018 to 2023. This timeframe was chosen to ensure the inclusion of the most current and relevant developments in Open XDR technology, Intrusion Detection Systems, Endpoint Detection and Response, and Security Information and Event Management systems. Additionally, the review gave special attention to studies and reports highlighting practical implementations and real-world applications of these technologies, thereby ensuring a comprehensive understanding of their impact and effectiveness in enhancing cybersecurity resilience. The methodology used is a detailed literature review, examining how various cybersecurity components interact and function. These components include Intrusion Detection Systems (IDS), which monitor networks for malicious activities; Endpoint Detection and Response (EDR), which focuses on detecting and investigating security incidents on endpoints; and Security Information and Event Management (SIEM), systems that provide real-time analysis of security alerts. The review also considers the role of Active Directory, a directory service for Windows domain networks, and the process of log forwarding, where log files are transmitted to a central server for analysis, in the context of AI and ML. The paper delves into the development of AI and ML, underscoring their roles in cybersecurity for advanced data processing, pattern recognition, and predicting threats. It explores both supervised (where the model is trained on labeled data) and unsupervised learning (where the model learns from unlabeled data) in ML, and how these techniques bolster cybersecurity measures. The article highlights the significance of Open XDR as a critical innovation that integrates data from multiple sources for comprehensive security analysis. Further, the review discusses how the integration of AI and ML into various cybersecurity tools, such as IDS, EDR, and SIEM, augments capabilities in threat detection and response. It addresses the challenges and opportunities that AI and ML present in the cybersecurity domain, focusing on ethical issues, data privacy concerns, and the necessity for ongoing professional development in this rapidly advancing field. The paper concludes by affirming the effectiveness of merging AI and ML with these cybersecurity tools within the Open XDR framework.

The evolutionary theory of aging, particularly antagonistic pleiotropy (AP), provides an account of the ultimate origins of aging. What remains unclear is the nature of the proximate mechanisms by which AP gives rise to diseases of aging, like cardiovascular disease and Alzheimer’s disease. Damage-centric theories focusing on loss of genetic and cellular function have been proposed, as well as programmatic theories focusing on unwanted gene and cellular function. The latter include the hyperfunction and developmental theory that view aging as the futile continuation, or run-on, of growth and developmental programmes into later life. Yet neither type of theory has performed well in explaining late-life disease aetiology, particularly with respect to disease onset, presentation and progression. What is proposed here in this review is a new programmatic theory of aging. We argue that the emergence of many specific diseases may involve quasi-programmes that are not the result of run-on, but rather are triggered by other factors in late life. Such triggers may be non-programmatic (e.g. infection, mechanical injury) or programmatic. Moreover, the consequent pre-pathological and pathological changes may in some cases trigger further changes, leading to futile and destructive cascades of quasi-programmes and pathology. The origins of triggered quasi-programmes can be traced to biological constraint i.e. the inability of organisms to optimise all functions at once. And, to some extent, the new theory presented here revises the understanding of AP. That is, because any gene can be triggered in an erroneous manner, every gene is potentially an AP gene that risks pathology, though level of risk varies according to constraint. To help validate the theory, we test it against several complex diseases of aging. The new model in this review attempts to provide a blueprint understanding that, to a certain extent, closes the gap in the causal chain of events between evolutionary causes of aging and the aetiology of age-related diseases. It also helps to explain why certain disorders mimic accelerated aging and how interventions, such as the suppression of IIS and mTOR retard many aspects of aging; notably, though, unlike prior programmatic theories, the new theory is not mTOR-centric. Finally, it provides new perspectives on possible treatment of aging.

Humans are often exposed to various environmental contaminants, among which phthalates are prevalent due to their extensive use as plasticizers in various consumer goods. Di(2-ethylhexyl) phthalate (DEHP), a widely used phthalate, is recognized as an endocrine disruptor chemical (EDC). DEHP is reported to affect various organs. Few studies have addressed the effects of phthalates on bone. However, the effects of DEHP on the bone forming cells (osteoblasts) are obscure. The present study was peformed to determine the cytotoxic effects of DEHP on human osteoblasts in vitro and to delineate the mechansims. In this study, we exposed the human osteo-blastic cell line MG-63 to various concentrations of DEHP (1, 25, 50 and 100 µM) for 24, 48 and 72 h. Cell viability was assessed by MTT assay. Total RNA and protein were collected after 48 h treatment with 1 and 100 µM DEHP and determined for the mRNA and/or protein expression of alkaline phosphatase (ALP), sex steroid receptors (androgen and estrogen receptors), receptor activator of nuclear factor kappa-Β ligand (RANKL), runt-related transcription factor 2 (RUNX2) and peroxisome proliferator-activated receptor alpha (PPARα). The mRNA expression was stud-ied by real-time RT-PCR analysis and the protein expression was determined by western blot analysis. Statistical analyses were done by one-way analysis of variance (ANOVA) followed by the Students–Newman–Keuls (SNK) test. The exposure of MG-63 cells to DEHP caused a signifi-cant decrease in osteoblast viability in all the treatment groups and at all the time points stud-ied. Interestingly, DEHP exposure decreased the mRNA expression of ALP, a bone formation marker. DEHP had differential effects on estrogen receptor alpha (ERα) mRNA and protein ex-pression. However, DEHP treatment downregulated the mRNA and protein expression of ERβ, and androgen receptor (AR). Surprisingly, DEHP downregulated the RANKL mRNA expression. DEHP decreased the protein expression of RUNX2, the key transcription factor and master regu-lator of bone formation. Furthermore, DEHP increased the PPARα protein expression in the os-teoblasts. Importantly, DEHP increased the reactive oxygen species (ROS) molecules and thus oxidative stress in osteoblasts, as observed by increased hydrogen peroxide, hydroxyl radical levels and lipid peroxidation. On the other hand, it decreased the enzymatic and non-enzymatic antioxidant levels namely catalase, superoxide dismutase, glutathione peroxidase activity and reduced glutathione. Our study demonstrated that in vitro exposure to DEHP reduces the osteo-blast viability possibly through alterations in the oxidant-antioxidant system and modulation of the key genes involved in bone formation, highlighting the cytotoxic effects of DEHP on bone forming cells.

Although congenital sensorineural hearing loss (SHL) in the bilateral cochleae mainly results from genetic abnormalities, chronic SHL progressing in later life is often influenced by systemic immune disturbances, including autoimmunity, chronic inflammation, and immunosenescence. We have investigated the relationship between the inner ear and systemic immunity and reviewed the possibilities to prevent SHL, including autoimmune SHL and age-related SHL. We also demonstrated two lymphocyte populations, interleukin 1 receptor type II (IL-1R2)-positive T cells (T1R2) and naturally occurring regulatory T cells (nTregs) in CD4⁺ T cells, which increase with aging, suppress host immune function and promote organ degeneration. Alterations in systemic immunity by fewer microbial antigen challenges in the living environment, elimination of immune suppressive lymphocytes, or immune rejuvenation with a reconstituted thymus may contribute not only to renew the cochlear function in SHL, but also to extend the healthy life of functional organs in a vigorous and youthful body, one of humanity’s greatest dreams.

With a software-defined network (SDN), the control plane is separated from the data plane, allowing the control of network flows to be easy and dynamic at the same time. While the controller, which is equipped with various control applications, is capable of analyzing a large amount of data, it may become overburdened when it is faced with a large volume of traffic. The intrusion detection system (IDS) is an example of control applications that can be used to detect intrusions. It is recommended to deploy instances of the IDS across the data plane. This will improve the processing power and detection rate and as a result reduce the load on the controller at the same time. While there is no doubt that an IDS would be beneficial for improving detection rates, installing one at each switch in the data plane would be costly. To address this issue, this paper proposes the deployment of IDS chains across the data plane. The controller directs incoming traffic via alternative paths, including the IDS chain, which increases the detection rate while avoiding overloading. In order to improve transmission efficiency, our study proposes a method of balancing the distribution of flows and assigning them to specific IDS chains. This approach minimizes the cost of flow grouping through the use of a new incoming traffic grouping technique. Our method is tested and evaluated through the use of a test bed and trace-based simulation, and has been proven to effectively reduce delays and hop counts across various traffic scenarios.

The rising number of unknown-type attacks on the Internet emphasizes the significance of developing efficient intrusion detection systems, even if machine learning-based techniques can detect unknown types of attacks. The necessity for innovative techniques is highlighted by the possibility that traditional machine learning techniques will not be sufficient for identifying these unknown types of attacks. In this research, we address this difficulty by proposing a deep learning-based solution: the log-cosh variational autoencoder (LVAE). When it comes to understanding intricate data distributions and creating freshly reconstructed data, LVAE inherits the strong modeling skills of the variational autoencoder (VAE). To better imitate discrete features of actual attacks and generate unknown types of attacks, this study develops an effective reconstruction loss term employing the logarithmic hyperbolic cosine (log-cosh) function in the log-cosh variational autoencoder (LVAE). When compared to conventional VAEs, LVAE exhibits promising potential for effectively generating data that closely resembles an unknown attack, a crucial capability for increasing the unknown attack detection rate. To categorize the generated unknown-type data, eight feature extraction and classification techniques were used. Using the most recent CICIDS2017 dataset, numerous experiments were carried out, training under varying amounts of real and unknown-type attacks. Our optimal experimental results outperformed several state-of-the-art techniques with accuracy and average F1 scores of 99.89% and 99.83%, respectively. Outstanding results were also shown by the suggested LVAE strategy for producing unknown attack data. In general, our work sets a strong basis for the accurate and efficient identification of unknown types of attacks and contributes to the development of intrusion detection techniques.

With the continuous development of network technology, complex network systems generate massive unbalanced attack traffic. Due to the severe imbalance in the quantities of normal samples and attack samples, as well as among different types of attack samples, intrusion detection systems suffer from low detection rates for rare class attack data. In this paper, we propose a geometric synthetic minority oversampling technique based on optimized kernel density estimation algorithm. This method can generate diverse rare class attack data by learning the distribution of rare class attack data while maintaining similarity with the original sample features. Meanwhile, the balanced data is input to a feature extraction module built upon multiple denoising autoencoders, reducing information redundancy in high-dimensional data and improving the detection performance for unknown attacks. Subsequently, a soft voting ensemble learning technique is utilized for multi-class anomaly detection on the balanced and dimensionally reduced data. Finally, an intrusion detection system is constructed based on data preprocessing, imbalance handling, feature extraction, and anomaly detection modules, and validated on the NSL-KDD and N-BaIoT datasets. Comparative experiments with baseline models and other state-of-the-art methods demonstrate that the proposed system improves the detection rate of rare class attack data. Furthermore, it achieves a good overall detection rate on the Internet of Things dataset (N-BaIoT), indicating its strong applicability.

Machine learning has become widely adopted as a strategy for dealing with a variety of cybersecurity issues, ranging from insider threat detection to intrusion and malware detection. However, by their very nature, machine learning systems can introduce vulnerabilities to a security defence whereby a learnt model is unaware of so-called adversarial examples that may intentionally result in mis-classification and therefore bypass a system. Adversarial machine learning has been a research topic for over a decade and is now an accepted but open problem. Much of the early research on adversarial examples has addressed issues related to computer vision, yet as machine learning continues to be adopted in other domains, then likewise it is important to assess the potential vulnerabilities that may occur. A key part of transferring to new domains relates to functionality-preservation, such that any crafted attack can still execute the original intended functionality when inspected by a human and/or a machine. In this literature survey, our main objective is to address the domain of adversarial machine learning attacks and examine the robustness of machine learning models in the cybersecurity and intrusion detection domains. We identify the key trends in current work observed in the literature, and explore how these relate to the research challenges that remain open for future works. Inclusion criteria were: articles related to functionality-preservation in adversarial machine learning for cybersecurity or intrusion detection with insight into robust classification. Generally, we excluded works that are not yet peer-reviewed; however, the authors include some significant papers that make a clear contribution to the domain. There is a risk of subjective bias in the selection of non-peer reviewed articles; however, this is mitigated by co-author review. We selected the following databases with a sizeable computer science element to search and retrieve literature: IEEE Xplore, ACM Digital Library, ScienceDirect, Scopus, SpringerLink,Google Scholar. The literature search was conducted upto January 2022. We have striven to ensure a comprehensive coverage of the domain to the best of our knowledge. We have performed systematic searches of the literature, noting our search terms and results, and following up on all materials that appear relevant and fit within the topic domains of this review. This research was funded by the Partnership PhD scheme at the University of the West of England in collaboration with Techmodal Ltd.

This work presents updated reconstructions of watershed runoff to San Francisco Estuary from tree-ring data to AD 903, coupled with models relating runoff to freshwater flow to the estuary and salinity intrusion. We characterize pre-development freshwater flow and salinity conditions in the estuary over the past millennium and compare this characterization with contemporary conditions to better understand the magnitude and seasonality of changes over this time. This work shows that the instrumented flow record spans the range of runoff patterns over the past millennium (averaged over five, ten, twenty and one hundred years), and thus serves as a reasonable basis for planning-level evaluations of historical hydrologic conditions in the estuary. Over annual timescales we show that, although median freshwater flow to the estuary has not changed significantly, it has been more variable over the past century compared to pre-development flow conditions. We further show that the contemporary period is generally associated with greater spring salinity intrusion and lesser summer-fall salinity intrusion relative to the pre-development period. Thus, salinity intrusion in summer and fall months was a common occurrence under pre-development conditions and has been moderated in the contemporary period due to the operations of upstream reservoirs, which were designed to hold winter and spring runoff for release in summer and fall. This work also confirms a dramatic decadal-scale hydrologic shift in the watershed from very wet to very dry conditions during the late 19th and early 20th centuries; while not unprecedented, these shifts have been seen only a few times in the past millennium. This shift resulted in an increase in salinity intrusion in the first three decades of the 20th century, as documented through early records. Population growth and extensive watershed modification during this period exacerbated this underlying hydrologic shift. Putting this shift in the context of other anthropogenic drivers is important in understanding the historical response of the estuary and in setting salinity targets for estuarine restoration. By characterizing the long-term behavior of San Francisco Estuary, this work supports decision-making in the State of California related to flow and salinity management for restoration of the estuarine ecosystem.

The present study evaluates the psychometric properties of the Conflicts in Romantic Relationships Over Facebook Use Scale with a sample of Puerto Rican adults. A total of 577 Puerto Ricans participated on this confirmatory and psychometric study. The results confirmed that the scale has a multidimensional structure. These dimensions are: Partner Facebook intrusion, Conflict over Facebook use, and Jealousy over Facebook use. A total of 18 items complied with the criteria of discrimination and presented appropriate factorial loads (6 items per dimension). The Cronbach’s Alpha indexes of the dimensions ranged between .87 and .95 and the omega coefficients ranged between .88 and .95. In summary, the instrument has the appropriate psychometric properties to continue with validation studies, as well as to be implemented in various work areas, both theoretical and applied.

Background: Patients with infectious complications related to the presence of cardiac implantable electronic devices (CIED) constitute a heterogeneous group, including local pocket infection (PI) and lead related infectious endocarditis (LRIE). The diagnosis of CIED-related infection is often difficult and requires complex imaging and microbiological tests. The aim of the current study was to evaluate the usefulness of new simple hematological parameters in detecting infectious complications in patients with CIED and assessing their extent. Methods: The retrospective analysis of clinical data of 2909 patients (36.37% with CIED-related infections), undergoing transvenous lead extraction (TLE) procedures in three high-volume centres in the years 2006-2020, was conducted. The sensitivity and specificity of new hematological markers were evaluated: the neutrophil to lymphocyte ratio (NLR), neutrophil to platelet ratio (NPR), and lymphocyte to platelet ratio (LPR) in the diagnosis of infectious complications, assessment of the spread of the infectious process and differentiation of additional structures related to the presence of leads. Results: In patients with CIED infections, compared to the non-infectious group, high inflammatory parameters were confirmed, and the highest specificity of the new markers in detecting the infectious process was demonstrated. (79.47% for NPR and 72.82% for NLR). Analysis of laboratory parameters in infectious and non-infectious patients with the presence of additional lead-related masses showed the highest specificity of NPR (82,78%) in predicting the diagnosis of vegetation. Comparison of laboratory parameters in patients with LRIE and PI showed higher NLR % (4.24 vs 2.56; p<0.001, area under curve (AUC) in a receiver operating characteristic (ROC) curve: 0.67 and 0.78 respectively) and higher NPR (0.03 vs 0.02; p<0.001; AUC: 0,51 and 0,55) in patients with LRIE. The highest sensitivity in the detection of coexistence LRIE with PI has been demonstrated for NLR (87.33%). Conclusions: Novel hematological markers may be helpful in the recognition of the inflammatory process in patients with CIED, differentiation of vegetation and vegetation-like masses, and the extent of infection in patients with PI.

This study aims to understand Filipino rice farmers’ aspirations, both farming and non-farming-related. Understanding aspirations can help the government and interested third-party entities to provide impactful initiatives to farmers. The Role Identity Theory guided our analysis in this study. This study is predominantly qualitative, with focus group discussion as the main method of collecting data. The research sites were in Kalinga, Nueva Ecija, Laguna, Quezon, Northern Samar, Zamboanga del Sur, Sultan Kudarat, and Agusan del Norte. Among the farming-related aspirations noted in this study relate to property, fair price, infrastructure, government support, and good governance. The non-farming related aspirations relate to infrastructure development; progress; government support and governance; love, passion, peace, and unity; wellness and long life.

Anthropogenic development can strongly influence natural river processes, leading to environmental changes that negatively affect important habitats and biodiversity, and consequently reduce economically important natural resources. This study investigated the effects of salinity intrusion on the habitat of the clam Corbicula japonica in the Seomjin River estuarine zone. We employed the Environmental Fluid Dynamics Code (EFDC) model, which incorporates topographic data and hydrological changes, to simulate salinity concentrations. Two salinity measurement facilities were installed in Seomjin River estuarine and operated to optimize the EFDC model. The results show that reduced flow rates due to intake have a negligible impact on the increased salinity. Maintaining optimal salinity (15–20 psu) during neap tides at the Seomjin River Bridge requires constant high flow rates, which poses significant challenges. Saltwater stratification is identified as the primary cause of pronounced salinity stratification, particularly during neap tides. Addressing this issue through river discharge and intake facility operation is challenging. Structural measures, including riverbed restoration and underwater barriers, are recommended to improve resistance to seawater intrusion. Future research should aim to develop scenarios to reduce salinity concentrations, quantify the reduction efficiency, and propose region-specific measures.

Intrusion detection is generally carried out by matching network traffic patterns with known attack patterns or by identifying abnormal network traffic patterns. One statistical methodological approach used in intrusion detection is Statistical Process Control (SPC) by constructing a control chart. Hotelling’s T2 control chart is a multivariate control chart commonly used to monitor the mean process. The performance of the T2 chart in monitoring mean shifts can be increased if a robust estimator is utilized. Based on previous research, T2 based on the Fast-MCD estimator has good performance in monitoring low to medium outlier contaminated data. Therefore, the MRCD estimator can be used to detect intrusion. On the other hand, this research focuses on developing a bootstrap-based robust Hotelling’s T2 charts with Fast-MCD and MRCD estimators for evaluating performance in detecting intrusion on intrusion detection datasets. Based application of UNSW-NB15, the proposed chart has better performance than the conventional T2 and Fast-MCD-based T2 despite the longer execution time.

Today’s intruders usually send attacking commands to a target system through several stepping-stone hosts, in order to reduce the chance of being detected. With stepping-stone intrusion (SSI), the intruder’s identity is hidden behind a long interactive chain of hosts and very hard to detect. An effective approach for SSI detection (SSID) is to estimate the length of the chain. This type of method is called network-based SSID. Most existing network-based SSID worked effectively only when intruders’ session manipulation was not present. These known SSID algorithms are either weak to resist intruders’ chaff-perturbation manipulation or having very limited capability in resisting attacker’s session manipulation. This paper develops a novel network-based SSID algorithm resistant to intruders’ chaff-perturbation by using packet crossover. Our proposed SSID algorithm is simple and easy to implement as the number of packet crossovers can be easily computed. We conduct rigorous technical proofs to verify the correctness of our proposed algorithm. The experimental results show that our proposed SSID algorithm works effectively and perfectly in resisting intruders’ chaff-perturbation up to 50% chaff rate.

The advancement in network security threats led to the development of new Intrusion Detection Systems(IDS) that rely on deep learning algorithms known as deep IDS. Along with other systems based on deep learning, deep IDS suffer from adversarial examples: malicious inputs aiming to change the prediction of a machine learning/deep learning model. Protecting deep learning against adversarial examples remains an open challenge. In this paper, we propose “NIDS-Defend” a framework to enhance the robustness of Network IDS against adversarial attacks. Our framework is composed of two layers: a statistical test and a classifier that together detect adversarial examples in real-time. The detection process consists of two steps: (1) flagging flows that contain adversarial examples with a statistical test, and (2) extracting individual adversarial examples in the previously flagged flows with a classifier. Our approach is evaluated on binary IDS with the NSL-KDD dataset. To generate adversarial examples, the crafting methods used are (1) Boundary attack and (2) HopSkipJumpAttack. We investigate the vulnerabilities of a Network IDS against adversarial examples, then apply our defense. The statistical test can confidently distinguish adversarial flows with more than 95% accuracy, and the classifier detects individual adversarial examples with more than 80% accuracy. We also show that our framework detects adversarial examples crafted by an adversary aware of the defense and confirm the effectiveness of our solution against adversarial attacks.

Recent years have witnessed a rapid growth of code-reuse attacks in advance persistent threats and cyberspace crimes. Carefully crafted code-reuse exploits circumvent modern protection mechanisms and hijack the execution flow of a program to perform expected functionalities by chaining together existing codes. The sophistication and intrication of code-reuse exploits hinder the scrutinization and dissection on them. Although the previous literature has introduced some feasible approaches, effectiveness and reliability in practical applications remain severe challenges. To address this issue, we propose Horus, a data-driven framework for effective and reliable detection on code-reuse exploits. In order to raise the effectiveness against underlying noises, we comprehensively leverage the strengths of time-series and frequency-domain analysis, and propose a learning-based detector that synthesizes the contemporary twofold features. Then we employ a lightweight interpreter to speculatively and tentatively translate the suspicious bytes to open the black box and enhance the reliability and interpretability. Additionally, a functionality-preserving data augmentation is adopted to increase the diversity of limited training data and raise the generality for real-world deployment. Comparative experiments and ablation studies are conducted on a dataset composed of real-world instances to verify and prove the prevalence of Horus. The experimental results illustrate that Horus outperform existing methods on the identification of code-reuse exploits from data stream with an acceptable overhead. Horus does not rely on any dynamic executions and can be easily integrated into existing defense systems. Moreover, Horus is able to provide tentative interpretations about attack semantics irrespective of target program, which further improve system's effectiveness and reliability.

Computer network attacks are evolving in parallel with the evolution of hardware and neural network architecture. Despite major advancements in Network Intrusion Detection System (NIDS) technology, most implementations still depend on signature-based intrusion detection systems, which can’t identify unknown attacks. Deep learning can help NIDS to detect novel threats since it has a strong generalization ability. The deep neural network’s architecture has a significant impact on the model’s results. We propose a genetic algorithm based model to find the optimal number of hidden layers and the number of neurons in each layer of the deep neural network (DNN) architecture for the network intrusion detection binary classification problem. Experimental results demonstrate that the proposed DNN architecture shows better performance than classical machine learning algorithms at a lower computational cost.

Soil above a platinum-group element (PGE)-bearing horizon within the Freetown Layered Intrusion, Sierra Leone contains anomalous concentrations of n-alkanes (CnH2n+2) in the range C14 to C22 not readily attributable to an algal or lacustrine origin. Longer chain n-alkanes (C23 to C31) in the soil were derived from the breakdown of leaf litter beneath the closed canopy humid tropical forest. Spontaneous breakdown of the longer chain n-alkanes to form C14-22 n-alkanes without biogenic or abiogenic catalysts is unlikely as the n-alkanes are stable. In the Freetown soil, the catalytic properties of the PGE (Pt in particular) may lower the temperature at which oxidation of the longer chain n-alkanes can occur. Reaction between these n-alkanes and Pt species such as Pt2+(H2O)2(OH)2 and Pt4+(H2O)2(OH)4 can bend and twist the alkanes, and significantly lower the Heat of Formation. Acknowledging the possibility of microbial catalysis and the difficulty of identifying a direct organic geochemical source of the lighter n-alkanes, this paper explores the theoretical potential for abiogenic Pt species catalysis as a mechanism of breakdown of the longer n-alkanes to form C14-22 alkanes. This novel mechanism could substantiate the presence of the PGE in solution predicted by soil geochemistry and illustrate processes involving the PGE. Graphical Abstract

The rapid evolution of technology has given rise to a connected world, where billions of devices interact seamlessly, forming what is known as the Internet of Things (IoT). While IoT offers incredible convenience and efficiency, it presents a significant challenge in cybersecurity and is characterized by various power, capacity, and computational process limitations. Machine learning techniques are employed within Intrusion Detection Systems (IDS) to enhance their capabilities in identifying and responding to security threats. The key features selected to improve IDS efficiency and reduce dataset size, thereby decreasing the time required for attack detection, are drawn from the extensive network dataset. This paper introduces an enhanced feature selection method designed to reduce the computational overhead on IoT resources while simultaneously strengthening intrusion detection capabilities within the IoT environment. Experimental results based on the InSDN dataset demonstrate that our proposed methodology achieves the highest accuracy with the fewest number of features and low computational cost. Specifically, we attain a 99.99% accuracy with 11 features and a computational time of 0.8599 seconds.

This paper presents a comprehensive study based on multiphase seepage and wellbore multiphase flow theories. It establishes a gas intrusion rate calculation model that considers various factors including formation pore permeability, bottomhole pressure difference, drilling fluid rheology, and surface tension. Experiments were conducted to investigate the gas intrusion mechanism under shut-in conditions, and the experimental results were employed to validate the reliability of the proposed gas intrusion rate calculation method. Furthermore, the research explores the transportation rates of single bubbles and bubble clusters in drilling fluid under shut-in conditions. Meanwhile, empirical expressions were derived for the drag coefficient for single bubbles and bubble clusters in the wellbore. These expressions can be used to calculate gas transportation rates for various equivalent radii of single bubbles and bubble clusters. Additionally, a method was developed for calculating the rising velocity of bubble clusters in water based on experimental results. The study reveals that the average bubble size in the bubble cluster is significantly smaller than the size of the single bubble generated from the orifice. When the viscosity of the drilling fluid is low, the bubble cluster transportation velocity exhibits a positive correlation with the average bubble diameter. When the average bubble diameter exceeds 1 mm, the bubble velocity no longer varies with the change in the bubble cluster diameter. The initial bubble size of intrusive gas, the transportation speed of intrusive gas in the wellbore, the gas intrusion rate, and variations of the wellbore pressure after gas intrusion were analyzed. The research results provide theoretical support for wellbore pressure prediction and pressure control under shutdown conditions.

Internet users have significantly increased as a result of the spread of Internet of Things (IoT) technologies and 5G networks. But these developments also make people more susceptible to cybercrime. Intrusion detection systems (IDSs), which protect against cyber threats and facilitate early response, have emerged as crucial security measures to handle this expanding risk. This study intends to present a comprehensive review of IDS, how it interacts with machine learning (ML), and develop a suitable approach for attack detection in 5G and IoT environments. To accomplish this, we leverage the AWID dataset, which is the first wireless traffic dataset specifically designed for security purposes, focusing on the IEEE 802.11 standard and developed to the AWID3 dataset. In this research, we suggest a powerful machine-learning framework for wireless system intrusion detection. We perform evaluations in three stages, covering scenarios for multiple nominal classes, multiple numeric classes, and binary classes. In order to improve the performance of the intrusion detection model, we also use feature selection approaches. Additionally, we offer a model that incorporates the outcomes of three feature selection techniques, highlighting how crucial it is to comprehend the features present in wireless datasets. Our experiments demonstrate how a machine learning-based approach can detect attacks with a high level of accuracy. In particular, the boosted decision tree performs best when overlapping feature selection procedures, whereas the Logistic Regression approach obtains the maximum accuracy of 99% in the first two phases. By providing a comprehensive framework for identifying attacks in 5G and IoT contexts using machine learning approaches, this research makes a contribution to the field of intrusion detection. The results underline how important it is to comprehend wireless dataset characteristics and highlight the possibility of ML-based methods for attaining highly accurate intrusion detection.

Intrusion Detection Systems (IDS) plays a part in modern cyber security, as a result of the increasing need for cyber security systems in the “real” world due to the increasing number of cyber attacks, more sophisticated systems are required in order to prevent these attacks - an IDS can provide this protection. Due to the sophistication of these systems, they must be properly understood, developed and analyzed - research papers can be used as a tool to improve IDS systems. This paper is composed of two main sections: a survey and a taxonomy, providing information, reviews and interpretations from relevant papers, a timeline of important papers, a discussion on the future of IDS and a classification on IDS and how to apply this.

The Internet of Things technology opens the horizon for a broader scope of intelligent applications in smart cities. However, the massive amount of traffic exchanged among devices may cause security risks, significantly when devices are compromised or vulnerable to cyber-attack. An intrusion detection system is the most powerful tool to detect unauthorized attempts to access smart systems. It identifies malicious and benign traffic by analyzing network traffic. In most cases, only a fraction of network traffic can be considered malicious. As a result, it is difficult for an intrusion detection system to detect attacks at high detection rates while maintaining a low false alarm rate. This work proposes an integrated framework to detect suspicious traffic to address secure data communication in smart cities. This paper presents an approach to developing an intrusion detection system to detect various attack types. It can be done by implementing a Principal Component Analysis method that eliminates redundancy and reduces system dimensionality. Furthermore, the proposed model shows how to improve intrusion detection system performance by implementing an ensemble model.

With the rapid development of Internet of Things (IoT)-based near-earth remote sensing technology, the problem of network intrusion for near-earth remote sensing systems has become more complex and large-scale. Therefore, it is essential to seek an intelligent, automated, and robust network intrusion detection method. In recent years, network intrusion detection methods based on graph neural networks (GNNs) have been proposed. However, there are still some practical issues with these methods. For example, they have not taken into consideration the characteristics of near-earth remote sensing systems, the state of the nodes, and the temporal features. Therefore, this article analyzes the characteristics of existing near-earth remote sensing systems and proposes a spatio-temporal graph attention network (N-STGAT) that considers the state of nodes. The proposed network applies spatiotemporal graph neural networks to the network intrusion detection of near-earth remote sensing systems and validates the effectiveness of the proposed method on the latest flow-based dataset.

The constant increase in volume and wide variety of available Internet of Things (IoT) devices leads to highly diverse software and hardware stacks, which opens new avenues for exploiting previously unknown vulnerabilities. The ensuing risks are amplified by the inherent IoT resource constraints both in terms of performance and energy expenditure. At the same time, IoT devices often times generate or collect sensitive, real-time data used in critical application scenarios (e.g. health monitoring, transportation, smart energy, etc.). All these factors combined make IoT networks a primary target and potential victims for malicious actors. In this paper, we present a brief overview of existing attacks and defense strategies against urban IoT networks. The goal of this work is twofold: First, it presents a summary of some of the common attack vectors and the corresponding solutions available in the research literature. Then, the paper lays out a theoretical plan and a corresponding pipeline of steps (i.e. development and implementation process) for the design and application of the solutions encountered throughout the course of the research efforts. The end goal of following this plan is the deployment of the proposed IoT security measures in a real-world urban IoT infrastructure.

In this work, we adapt the fine-tuning algorithm of the Naïve Bayesian (FTNB) classifier to make it more suitable for imbalanced datasets. In particular, we boost misclassified instance probability terms by an amount that is disproportional to the harmonic mean of actual and predicted classes. The intuition is that discriminative attributes when the instance is misclassified would have small probability term pair values in both the actual class due to data scarcity and the predicted class due to weak correlation. Conversely, if both values are relatively high, then the attribute has good data coverage (support) and it should not be a cause for misclassification. Since the harmonic average is dominated by the smaller value and we have an imbalanced dataset, we should enact a large update if both or either term probabilities of actual and predicted classes are small. We used several benchmark datasets (60 different balanced and imbalanced datasets) to determine if the poor performance of the NB classifier is due to the scarcity of data and compared the performance of the proposed algorithm with NB, original FTNB, and other relatively new SOTA Ensemble Imbalanced Classifiers. Our empirical results reveal that the new proposed algorithm significantly outperforms all other classifiers.

The combined ecological, geophysical, climatic, and social factors of the Northeast of Russia influence the organism from the early childhood being too intense for the functional systems. The purpose of the research is to study the emotional characteristics of adolescents of different ethnic groups in the northeast of Russia. Presented in the paper are results of the study that covered 826 adolescents (445 females and 381 males) at the age of 15–17, different by ethnic origin. We used standard methods of psycho-diagnostics. Our study has showed that the formation of the adolescents’ emotional sphere in the North is undoubtedly influenced not only by the climatic and socio-economic environmental factors but also by ethnic features. There are intergroup differences in the aggressiveness profile of older adolescents living in the remote settlement vs. the regional center. It is shown that high school students in the remote settlement of Evensk, compared to their peers in Magadan, regardless of gender and ethnicity, are characterized by more pronounced hostile and auto-aggressive reactions. In adolescents of the Aboriginal population, as compared with their age mate Caucasians, the indicators of impairment in the field of Neuro Psychic Adaptation, Situational and Personal Anxiety, and Social Frustration are significantly more pronounced.

Land-use planning plays an important role in agricultural development, however it lacks tools to support planner in proposing land-use planning solutions especially, under saltwater intrusion condition in the coastal regions. This study aims to apply optimization in analyzing land-use solutions for agricultural land-use planning. In which a multi-objective optimization model is developed to optimize land-use area including land-use allocation taking into account socio-economic and environmental factors. The model has been applied in three districts of Soc Trang province, Vietnam (Long Phu, My Xuyen and Tran De) representing three ecological regions including salt water, brackish water and freshwater in the Mekong Delta of Vietnam. The results showed that two multi-objective optimization scenarios (in terms of profit, labor, environment benefits and risk reduction) have been implemented: (i) Multi-objective optimization of agricultural land-use until 2030 under normal conditions; (ii) Optimizing agricultural land-use until 2030 under climate change conditions similar to the 2016 drought and saltwater intrusion phenomenon in the Mekong Delta. The results showed that the second scenario is the option considered for implementing land-use plan thanks to the balance between good profits and minimizing economic and environmental risk. The land allocation was carried out taking into account household economic, the influence of adjacent production types, local traffic and canal systems factors to allocate optimal land-use areas. The combination of land-use optimization and spatial allocation process can help planners improve the quality of agricultural land-use planning.

Coastal areas are increasingly being damaged with the expansion of seawater intrusion areas. We suggest a three-step method for reducing seawater intrusion areas by predicting future damage to groundwater being used continuously. First, the area most vulnerable to seawater intrusion damage is selected from among 25 areas on the west coast of the Republic of Korea. Having identified the Taean area as the region in question in the second step, we use RCP 4.5 and 8.5 as future sea level rise scenarios and predict the future usage of groundwater using linear-regression analysis of data for the past 10 years. Consequently, for RCP 8.5 (groundwater-usage scenario 1.0), 68.5% of the total Taean area is projected to be influenced by seawater intrusion. In the third step, the effectiveness of seawater intrusion reduction measures is analyzed considering the projected future situation and the local characteristics of the Taean area. After considering the effects of alternative locations, as well as seawater intrusion related data, alternatives were prioritized using a multi-criteria decision-making method. Consequently, 3, 5, and 4 were prioritized in the listed order, and we judged that by applying seawater intrusion area reduction measures according to this result, we will achieve the biggest effect.

Currently, hepatitis B virus (HBV) core antibody (anti-HBc antibody) and HBV core-related antigen (HBcrAg) are widely used as serum markers for diagnosis based on the HBV core region. While anti-HBc is very significant for clinical diagnosis, the clinical significance of quantitative assay of anti-HBc antibody has been reevaluated with improvements in diagnostic performance, including its association with clinical stage and prediction of carcinogenesis and reactivation. In addition, concerning the new HBcrAg, a high-sensitivity assay method has recently been established, and its diagnostic significance, including the prediction of reactivation, is being reevaluated. On the other hand, the quantitative level of anti-HBc antibody expressed in different units among assay systems, complicating the interpretation of the results. However, it is difficult to standardize assay systems as they vary in advantages, and caution is needed in interpreting the assay results. In this review, the clinical usefulness and remaining problems of anti-HBc antibody and HBcrAg were summarized.

This study investigated gender differences in exposure to hazardous factors, health problems, and work environment satisfaction and identified the effects of such differences on farmworkers in Korea. Through the 6th Korean Working Conditions Survey (KWCS) conducted by the Occupational Safety and Health Research Institute (OSHRI), the raw data on 2,347 farm-workers were analyzed to present descriptive statistics for demographic characteristics, exposure to hazardous factors, health problems, and work environment satisfaction. We compared be-tween genders using chi-squared tests and investigated the effects of gender-specific working conditions on work-related health problems and work environment satisfaction using multi-variate logistic analysis. The results were presented as an odds ratio (OR) with 95% confidence interval. Job position predicted work-related health problems in male farmworkers and work environment satisfaction in female farmworkers. Furthermore, female farmworkers perceived themselves to have more health problems than male farmworkers. Nevertheless, female farm-workers received less health and safety information and had lower work environment satisfac-tion compared to male farmworkers. The findings may improve the occupational welfare of farmworkers through continuous enhancement of the agricultural labor environment. Keywords: work-related; working condition; farmworker; agriculture; musculoskeletal; KWCS

Background and Objectives: The current study aimed to determine the impact of fasciotomy on mortality and morbidity in children and adults with crush-related AKI following the 2023 Kahramanmaraş earthquakes. Materials and Methods: The study included individuals who had suffered crush injuries after the 2023 Kahramanmaraş earthquakes and were identified as having acute kidney injury (AKI). Patients with AKI were divided into two groups based on age: those under 18 years and those over 18 years. A comparative analysis was conducted between the mortality and morbidity rates of patients who underwent fasciotomy and those who did not. Disseminated intravascular coagulopathy (DIC), sepsis, and adult respiratory distress syndrome (ARDS) have all been identified as contributors to morbidity. Results: The study was conducted with a total of 40 patients (21 males and 19 females) aged between four and 83 years. A total of 21 patients underwent fasciotomy and the patients underwent varying numbers of fasciotomy, ranging from zero to 11. The mortality rate was 12.5%, corresponding to five adult patients. No instances of mortality were reported in the paediatric cohort. The application of fasciotomy in instances of crush-induced AKI did not result in elevated levels of mortality in either the paediatric or adult demographic. Within the adult population, a substantial difference in the duration of dialysis was observed between individuals who underwent fasciotomy and those who did not. A statistically significant increase in the number of fasciotomy incisions was observed in patients diagnosed with sepsis compared with those without sepsis. The study found a significant positive correlation between the number of fasciotomy incisions and dialysis days. Conclusions: Neither adult nor paediatric patients with crush-induced AKI showed an increased risk of death after fasciotomy. The number of fasciotomy incisions significantly correlated with the development of sepsis. Despite experiencing delays in hospital admission for paediatric patients, the incidence of both crush syndrome and mortality rates among children remained relatively low.

Background: Epileptic patients frequently encounter cognitive impairment. Functions that are mostly affected involve memory, attention and executive function; however this is mainly dependant on the location of the epileptic activity. The aim of the study is to assess cognitive functions in MRI-negative epilepsy patients by means of neurophysiological and neuropsychological measures. Methods: The patients were enrolled from the outpatient Epilepsy/Clinical Neurophysiology clinic over a time period of 6 months. The study sample comprised 20 MRI negative epilepsy patients [mean age ± standard deviation (SD), 30.3 ± 12.56 years; age range 16-60 years; average disease duration, 13.95 years) and 10 age-matched controls (mean age ± SD, 24.22 ± 15.39 years), that were also education-matched (p>0.05) Patients with epileptogenic lesions were excluded from the study. Informed consent was obtained from all subjects involved in the study. Auditory ERPs and the cognitive screening tool EpiTrack, were administered to all subjects. Results: Latencies of P300 and slow waves were prolonged in patients compared to controls (p<0.05). ASM load and the patients’ performance in the EpiTrack maze subtest were the most significant predictors of P300 latency. A decline in memory, attention, and speed of information processing has been observed in patients with cryptogenic epilepsy compared to age-matched controls, as reflected by P300 latency and EpiTrack scores.

Previous research on video game player aggression has focused on violent content, while recent studies have examined competitive factors. Few research has examined the solely impacts of competitive factors in video games without violent content on aggression, and it is still unknown what neurological processes of these effects. The present study is the first to examine the the electrophysiological characteristics of short-term competitive video game exposure and aggression. Thirty-five participants played a video game in either competitive or solo mode for 15 minutes, followed by an ERP experiment based on the Oddball paradigm and the hot sauce paradigm to measure aggressive behavior. Results showed that playing competitive game mode was associated with faster judgment to aggressive words, larger P300 amplitudes, and selection of more chili powder. The P300 amplitude partially mediated the relationship between competitive game exposure and aggressive behavior. These findings support the general aggression model.

As the world's population ages and the resulting health problems become more serious, medical and health policies in developed countries are focused on how to prevent and treat the diseases of the aging population and how to maintain their quality of life. Typical age-related diseases include deafness, cataracts, osteoarthritis, chronic obstructive pulmonary disease, diabetes mellitus, and dementia. Although the mechanisms by which these diseases develop differ, they are all caused by the accumulation of molecular and cellular damage over time. In addition, age-related diseases can cause a decline in physical and mental functions and the ability to perform activities of daily living, as well as the loss of roles in society and a sense of fulfillment in life. Therefore, there is a need for treatment and measures to accurately grasp and maintain their quality of life.

In this study was found that these cancers were attributable to risk factors such as cigarette smoking, second-hand smoke, alcohol intake, excess body weight, diet, and six cancer-associated infections. Several databases were reviewed including PUBMED, Google scholar, and Web of Science. The facts suggest that a number of individuals present risk factors for cancer, which can be modifiable.

Abstract: (1) Background: tuberculosis presents an epidemiological trend towards inequality, especially among people in social exclusion and situations of vulnerability. To analyze territories where there is a concentration of people diagnosed with tuberculosis, in a street situation, and who make chronic use of alcohol, tobacco, and illicit drugs. We will also analyze trends in this health condition in southern Brazil; (2) Methods: Ecological study, developed in the 399 municipalities of Paraná, Southern Brazil, with all tuberculosis cases in the homeless population registered in the Information System of Notifiable Diseases between 2014 to 2018. For data analysis, we used descriptive statistics, for the time series, the Prais-Winsten autoregression method, whereas for spatial analysis, we used the Getis-Ord Gi technique*; (3) Results: in total, 560 cases were reported. We found a predominance of alcohol, smoking, and illicit drugs users, with an increasing trend in the state and clusters of spatial risk in the East health macro-region; (4) Conclusions: We observed territories with critical levels of highly vulnerable people who use psychoactive substances and are in a street situation. The results highlight the importance of incorporating public policies of social protection to these individuals and resolutive health services that receive and assist in eradicating TB.

Accumulating evidences demonstrate that the host genome's epigenetic modificationsare essential for living organisms to adapt extreme conditions.DNA methylation, covalent modifications of histone, andinter-association of non-coding RNAs facilitate the cellular manifestation ofepigenetic changes in the genome. Out of various factors involved in the epigenetic programming of the host, miRNA (microRNA) and LncRNA (Long non-coding RNA) are new generationnon-coding molecules that influence a variety of cellular processes like immunity, cellular differentiation, and tumor development. During tumor development, temporal changes in miRNA/LncRNA rheostat influence sterile inflammatory responses accompanied by the changes in the carcinogenic signalling in the host. At the cellular level, this is manifested by the up-regulation of Inflammasome and inflammatory pathways, which promotes cancer-related inflammation. In view of this, we discuss the potential of lncRNA and miRNA directed interventions in regulating inflammation and tumor development in the host.

Fire-related deaths are issues for forensic pathologists particularly in ascertaining if death occurred before or during fire. The authors highlight a unique bronchiolar epithelial cytological clue (nuclear heat-induced elongation) determined by active inhalation of hot gases and fumes, not yet described in the literature at distal small airways level.

Mastocytosis is characterized by pathological accumulation of mast cells (MC) in various organs. In these patients, MC may degranulate and thereby contribute to clinical symptoms, especially when a concomitant allergy is present. However, MC activation can not only be induced by high-affinity receptors for IgE, but also by anaphylatoxins, neuropeptides, IgG immune complexes, complement-components, drugs, products of bacteria or parasites, as well as physical factors such as heat, cold, vibration, stress, sun, or physical effort. Symptoms due to mediators released by activated MC may develop in adults suffering from systemic mastocytosis, but also evolve in children who usually have cutaneous mastocytosis (CM). Clinically, CM is otherwise characterized by typical brown, maculopapular skin lesions or mastocytoma associated with a positive Darier’s sign. Pruritus and flushing are common and blistering may also be recorded, especially in diffuse CM (DCM). Pediatric patients with mastocytosis may also have gastrointestinal, respiratory, and neurologic complaints. Although anaphylaxis is not a typical finding, pediatric patients with massive skin involvement and high tryptase levels have a relatively high risk to develop anaphylaxis. This paper reviews MC mediator-related symptoms and anaphylaxis in children with mastocytosis, with special emphasis on risk factors, triggers, and management.

This study presents a meta-analysis of studies that investigate the effectiveness of chitosan administration on lifestyle-related disease in murine models. A total of 34 published studies were used to evaluate the effect of chitosan supplementation. The effect sizes for various items after chitosan administration were evaluated using the standardized mean difference. Using Cochran’s Q test, the heterogeneity of effect sizes was assessed, after which a meta-ANOVA and –regression test was conducted to explain the heterogeneity of effect sizes using the mixed-effect model. Publication bias was performed using Egger’s linear regression test. Among the items evaluated, blood triglyceride and HDL-cholesterol showed the highest Q statistics and I2 values, respectively. Other than blood HDL-cholesterol, total cholesterol, and triglyceride in feces, most items evaluated showed a negative effect size with high significance in the fixed- and random-effect model (p<0.0001). In the meta-ANOVA and -regression test, administering chitosan and resistant starch was revealed to be most effective in lowering body weight. In addition, chitosan supplementation proved to be an effective solution for TNF-α inhibition. In conclusion, chitosan has been shown to be somewhat useful in improving symptoms of lifestyle-related disease. Although there are some limitations in the results of this meta-analysis due to the limited number of animal experiments conducted, chitosan administration nevertheless shows promise in enhancing the quality of human life.

This study was designed to assess variation of possible phytochemical compounds in the ethanolic extracts of Gigantochloa scortechinii rhizome. Destructive sampling was done by using selective random sampling method on four consecutive rhizomes from healthy clumps and was conducted at two natural forests and one secondary forest (planted). Homogenized sample were extracted using solvent extraction (70% ethanol) method. Ethanolic extracts of G. scortechinii rhizome were qualitatively analyzed using GC/MS GC2010 Plus, Shimadzu to determine the composition of phytochemical compounds and identified using FFNSC 1.3, NIST11, PMW_tox2, and Wiley229 spectral library. A qualitative variation was observed with a total of 56 compounds were identified and differentiated between study site and rhizome age. Results revealed that G. scortechinii rhizome contains various phytochemical compounds with potential as a plant of phytopharmaceutical importance. This is the first finding on the spatial and age-related effects of phytochemical compounds in a consecutive rhizome and of G. scortechinii rhizome specifically.

The aim of this cross-sectional study was to assess the perceived medication-related burden among patients with multiple non-communicable diseases (NCDs), and to investigate the association between perceived burden and adherence to medication therapy. Medication-related burden was measured in three primary care clinics in Qatar using the Living with Medicines Questionnaire (LMQ) among adults with diabetes, with or without other comorbidities. Adherence was measured using the Adherence to Refills and Medications Scale (ARMS). Two hundred ninety-three eligible patients participated in the study. Majority of participants reported experiencing minimum (66.6%) to moderate (24.1%) medication-related burden. There was a significant positive correlation between the medication-related burden (measured by the LWQ) and medication adherence (measured by ARMS) (rs (253) = 0.317, p <0.0005). The duration of diabetes diagnosis, adherence score, marital status, employment status, and presence diagnosis of hypertension were significant predictors of medication burden. A considerable proportion of the patients in this study have reported experiencing medication-related burden. Healthcare providers should seek strategies to address this burden especially among patients with risk factors of cardiovascular diseases, non-adherent to their medication therapy, living alone, or non-employed.

A brand-new approach to the understanding of breast cancer (BC) is urgently needed. In this contribution, the etiology, pathogenesis, and treatment of this disease is approached from the new pH-centric anticancer paradigm. Only this Unitarian perspective based upon that the hydrogen ion (H+) dynamics of cancer, allows understanding and integrating the many dualisms, confusions, and paradoxes of the disease. The new H+-related wide range model can embrace under a unique frame of mind the many aspects of the disease and at the same time therapeutically interfere with most, if not with all, the hallmarks of cancer known to date. The pH-related armamentarium available for the treatment of BC here reviewed may be beneficial for all types and stages of the disease. In this vein, we have attempted a mega synthesis of traditional and new knowledge in the different areas of breast cancer research and treatment based upon the wide range approach afforded by the hydrogen ion dynamics of cancer. The concerted utilization of a pH-related drugs nowadays available for the treatment of breast cancer is advanced.

The CAN protocol is widely adopted for in-vehicle networks due to its cost efficiency and reliable transmission. However, despite its popularity, the protocol lacks built-in security mechanisms, making it vulnerable to various attacks such as flooding, fuzzing, and DoS. These attacks can exploit vulnerabilities and disrupt the normal behavior of the in-vehicle network. One of the main reasons for these security concerns is that the protocol relies on broadcast frames for communication between ECUs within the network. To tackle this issue, this paper presents an intrusion detection system that leverages multiple LSTM-Autoencoders. The proposed system utilizes diverse features, including transmission interval and payload value changes, to capture various characteristics of normal network behavior. By analyzing different types of features separately using the LSTM-Autoencoder model, the system effectively detects anomalies. In our evaluation, we conducted experiments using real vehicle network traffic, and the results demonstrated the system's high precision with a 99% detection rate in identifying anomalies.

Saltwater intrusion in the rapidly developing city of Da Nang in central Vietnam is currently causing various water-related challenges, including inadequate water supply and water pollution. An integrated SWAT-MODFLOW numerical model was used to investigate the origin and mechanism of saltwater in Holocene and Pleistocene aquifers. Geophysical and isotopic approaches were used to validate the SEAWAT model applied for simulating saltwater intrusion. The results suggest that the ebb and flow of tides, as well as water levels in rivers primarily impact coastal aquifers. However, effective water resource planning and management, along with maintaining the natural recharge of fresh water from local rain during the rainy season, could enable the rational and efficient utilization of groundwater, reducing saltwater intrusion in many areas. During the dry season, groundwater is recharged from higher altitude areas. The current saltwater intrusion mainly occurs along the rivers up to the hydraulic dam. Simulated models, using scenarios of stop abstracting groundwater, but changing to the use of surface water for drinking water, show that the area of saline water shrinks quickly after 30 years, reducing from 59.6 km2 to 39.5 km2 and from 40.2 km2 to 28.6 km2 in Holocene and Pleistocene, respectively.

Artificial Intelligence (AI) is one of the key technologies of the Fourth Industrial Revolution (Industry 4.0), which can be used for the protection of Internet-connected systems from cyber-threats, attacks, damage, or unauthorized access. To intelligently solve today's various cybersecurity issues, popular AI techniques involving Machine Learning (ML) and Deep Learning (DL) methods, the concept of Natural Language Processing (NLP), Knowledge Representation and Reasoning (KRR), as well as the concept of knowledge or rule-based Expert Systems (ES) modeling can be used. Based on these AI methods, in this paper, we present a comprehensive view on "AI-driven Cybersecurity" that can play an important role for intelligent cybersecurity services and management. The security intelligence modeling based on such AI methods can make the cybersecurity computing process automated and intelligent than the conventional security systems. We also highlight several research directions within the scope of our study, which can help researchers do future research in the area. Overall, this paper's ultimate objective is to serve as a reference point and guidelines for cybersecurity researchers as well as industry professionals in the area, especially from an AI-based technical point of view.

In a computing context, cybersecurity is undergoing massive shifts in technology and its operations in recent days, and data science is driving the change. Extracting security incident patterns or insights from cybersecurity data and building corresponding data-driven model, is the key to make a security system automated and intelligent. To understand and analyze the actual phenomena with data, various scientific methods, machine learning techniques, processes, and systems are used, which is commonly known as data science. In this paper, we focus and briefly discuss cybersecurity data science, where the data is being gathered from relevant cybersecurity sources, and the analytics complement the latest data-driven patterns for providing more effective security solutions. The concept of cybersecurity data science allows making the computing process more actionable and intelligent as compared to traditional ones in the domain of cybersecurity. We then discuss and summarize a number of associated research issues and future directions. Furthermore, we provide a machine learning-based multi-layered framework for the purpose of cybersecurity modeling. Overall, our goal is not only to discuss cybersecurity data science and relevant methods but also to focus the applicability towards data-driven intelligent decision making for protecting the systems from cyber-attacks.

Tritordeum is an amphiploides species resulting from the hybridization between durum wheat (T. durum) and wild barley (H. chilense). This new cereal is considered a natural crop as it is obtained by traditional breeding techniques. Given its appreciable organoleptic characteristics, agronomic features, presence of interesting components, and good technological properties, tritordeum is of promising interest for the development of health-oriented foods. In this study, we evaluated two registered tritordeum cultivars, Bulel and Aucan. T. durum (Provenzal) was employed as the positive control. The extracted proteins were digested by gastric /pancreatic proteases and their biological effects on Caco-2 differentiated on transwell inserts were determined. Changes in cell viability, monolayer permeability, organization of F-actin microfilaments, and ER stress, triggered by protein-digested samples (DPs) were inspected. Our results showed that exposure to Provenzal-DPs promptly disrupted the tight junction barrier. Conversely, Aucan-DPs did not enhance monolayer permeability; whereas, Bulel-DPs exerted only slight effects. Provental-DPs-induced toxicity was also confirmed by changes in cell viability and by the deep reorganization of the enterocyte cytoskeleton. In contrast, Aucan-DPs and Bulel-DPs did not affect monolayer viability and cytoskeleton structure. Overall, our findings suggest that both tritordeum cultivars could be potential candidates for mitigating the toxicity of wheat flour.

Aging is a major risk factor for the higher incidence and prevalence of chronic conditions, such as cancer, cardiovascular and metabolic diseases, and neurodegenerative diseases. Closely linked with the onset of all these age-related diseases is immunosenescence, a condition defined as progressive reconfiguration of the immune functions leading to an increased susceptibility to infectious diseases, poorer response to vaccination, increased prevalence of cancer, rheumatoid arthritis, and other chronic diseases characterized by a pro-inflammatory state named inflammaging. Given that immunosenescence frames age-related diseases, it is natural to ask how these illnesses are related under the context of innate and adaptative components of the immune system. Knowledge processing by Formal Concept Analysis (FCA) of age-related diseases framed in an immunosenescence multivalued context shows that a hierarchy among these diseases emerges with a subconcept-superconcept nested structure, with two clusters, first made of metabolic diseases, cancer, and cardiovascular diseases. Second metabolic and neurodegenerative diseases and rheumatoid arthritis. Metabolic diseases seem to be a pivot illness and they must be a primary target given their global incidence and prevalence and their cost-effective treatments like regular physical activity, weight loss, healthy diet, stopping smoking, and reducing or managing stress. Another implication of the ontological analysis of age-related diseases is about the nature of immunosenescence, suggesting that initial symptoms of age-related diseases are mainly related to innate immune mechanisms, and developing of severe symptoms of age-related diseases like cancer, cardiovascular or neurodegenerative diseases depends on the activation of acquired immunity processes.

Akebia trifoliata is an economically important self-incompatible fruit tree in the family Lardiza-balaceae. Asexual propagation is the main strategy used to maintain excellent agronomic traits. However, the generation of adventitious roots during asexual propagation is very difficult. To study the important role of the WUSCHEL-related homeobox (WOX) transcription factor in fruit and adventitious root growth and development, we characterized this transcription factor family in the whole genome of A. trifoliata. A total of 10 AktWOXs were identified, with the fol-lowing characteristics: length (657~11328 bp), exon number (2~5), isoelectric point (5.65~9.03), amino acid number (176~361 AA), and molecular weight (20.500~40.173 kDa). 10 AktWOXs were classified into modern (6), intermediate (2), and ancient clades (2) and that all AktWOXs had undergone strong purifying selection during evolution. The expression profile of AktWOXs dur-ing A. trifoliata fruit development and adventitious root formation indicated that AktWOXs are widely involved in the development of the three fruit tissues, flesh, seeds and rind, and play an important role in the regulation of adventitious root development. Overall, this is the first study to identify and characterize the WOX family in A. trifoliata and will be helpful for further re-search on A. trifoliata fruit development and adventitious root formation.

Assessment of renal function is critical to diagnose and manage renal age-related decline, disease (KD), and failure, which are prevalent in the elderly population. Glomerular filtration rate (GFR) is widely used as an indicator of kidney function, but its direct measurement is challenging, as are its age and gender caveats. This makes difficult the differential diagnosis, between age-related physiological decline and KD and/or failure. Currently, the inflammation-based modified Glasgow prognostic score (mGPS) is emerging as promising biomarker of several inflammatory acute/chronic diseases. In this study, the large variability of eGFR with age and gender was evaluated, as the association of eGFR values with mGPS levels. A population of 57449 adult participants (age ≥18 years) was enrolled. Appropriate circulating biomarkers were measured to detect eGFR and mGPS values. The data obtained demonstrated a significant decrease of eGFR in men vs. women across the four selected age classes (18-40, 40-60, 60-80, 80-100 years), eGFR classes were significantly associated with mGPS (p<0.001), as age-classes and gender with mGPS categories. Accordingly, the percentage of people having a mGPS score= 2 significantly increased across the eGFR classes: with a 11% in the G1/eGFR class to achieve the 44% in G5/eGFR. Thus, the combination of mGPS with eGFR could represent the best benchmark risk model for differentiating age-related renal decline from a very KD, and for a better identification of different degrees of KD severity.

The advent of immunotherapy and specifically of immune checkpoint inhibitors (ICIs) for the treatment of solid tumors has deeply transformed therapeutic algorithms in medical oncology. Approximately one third of patients treated with ICIs may develop immune-related adverse events, being the gastrointestinal tract often affected with different grades of mucosal inflammation. Checkpoint inhibitors colitis (CIC) presents with watery or bloody diarrhoea and in case of severe activity requires ICIs discontinuation. The pathogenesis of CIC is multifactorial and still partially unknow: anti-tumor activity that collaterally effects the colonic tissue and the upregulation of specific systemic inflammatory pathways (i.e., CD8+ cytotoxic and CD4+ T lymphocytes) are mainly involved. Many open issues remain on treatment timing and options, and biological treatment, above all with anti-TNF alpha, can be offered to these patients aiming to rapidly resume the oncological therapies. This review aims to summarize the pathogenetic mechanisms underlying CIC and to discuss evidenced-based management including the role of biological therapy.

Age-related macular degeneration (AMD) is a common ocular disease characterized by the de-generation of the central area of the retina in elderly population. Progression and response to treatment is influenced by genetic and non-genetic factors. Proteomics is a powerful tool to study, at the molecular level, the mechanisms underlaying the progression of the diseases, to identify new therapeutical targets and to establish biomarkers to monitor progression and treatment ef-fectiveness. In this work we pursue to systematically review the use of proteomic-based ap-proaches for the study of the molecular mechanisms underlying the development of AMD, as well as the progression of the disease and the on-treatment patient monitoring. The Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) reporting guidelines were followed. Proteomic approaches have identified key players on the onset of the disease, such as proteins involved in lipid metabolism and oxidative stress, but also in the progression to advanced stages, including factors related to extracellular matrix integrity and angiogenesis. Although an-ti-vascular endothelial growth factor (anti-VEGF)-based therapy has been crucial in the treatment of neovascular AMD it is necessary to get deeper into the underlying disease mechanisms to move forward to next-generation therapies of the later-stage forms of this multifactorial disease.

The COVID-19 pandemic has had a significant impact on all facets of life and has exacerbated many challenges faced by people living with tuberculosis (TB). This study aimed to assess the health-related quality of life (HRQoL) of TB patients in Guinea during the COVID-19 pandemic. A mixed-methods study was conducted using two validated psychometric tools to assess HRQoL and qualitative interviews among TB patients enrolled in treatment at three centers in Conakry, Guinea. Multinomial logistic regression was used to identify factors associated with the deterioration of HRQoL. We included 439 participants in the study, among whom 44% and 31% experienced pain and anxiety, respectively. We found that an increase in the number of household members and the distance from participants’ residence to the health centre were significantly associated with lower HRQoL. Qualitative interviews highlighted nutritional and financial concerns which were exacerbated during COVID-19 pandemic and beliefs that the Guinean Government’s assistance plan was insufficient. This study supports the implementation of specific relief plans for TB patients which includes nutritional and psychological support, especially those whose movements are limited by travel restrictions, impeding access to TB care, reducing work opportunities and exacerbating financial needs and stress.

Antibiotics have been used in various fields such as livestock farm and fish farm as well as hospital in order to treat diseases caused by bacteria. However, the antibiotics that are not completely decomposed, but remains as residue and discharge to aquatic environment, can cause an imbalance in the gut flora of host, as well as regulate abnormal host gene regulatory system. We investigated the effects of chronic exposure with the low concentrations of erythromycin and ampicillin on gut microbiome and immune and stress-related gene expression using Korea native ricefish (Oryzias latipes). As a result of microbiome analysis, the proportion of Proteobacteria was increased in the ricefish when exposed to erythromycin and ampicillin chronically, whereas the proportion of other bacterial phyla decreased. In addition, the immune and stress-related genes were significantly influenced in the ricefish under the chronic antibiotics exposure. These results show that the internal microbial flora and the host gene expression are susceptible even in the low concentration of chronic antibiotic existing environments. This study provides the importance of the appropriate use of antibiotics dose to maintain the sustainable and healthy aquaculture industry and water ecosystem.

The importance of diet and the gut-brain axis for brain health and cognitive function is increasingly acknowledged. Dietary interventions are tested for their potential to prevent and/or treat brain disorders. Intermittent fasting (IF), the abstinence or strong limitation of calories for 12 to 48 hours, alternated with periods of regular food intake, has shown promising results on neurobiological health in animal models. In this review article, we discuss the potential benefits of IF on cognitive function and the possible effects on the prevention and progress of brain-related disorders in animals and humans. We do so by summarizing the effects of IF which - through metabolic, cellular and circadian mechanisms - lead to anatomical and functional changes in the brain. Our review shows that there is no clear evidence of a positive short-term effect of IF on cognition in healthy subjects. Clinical studies show benefits of IF for epilepsy, Alzheimer’s disease and multiple sclerosis on disease symptoms and progress. Findings from animal studies show mechanisms by which Parkinson’s disease, ischaemic stroke, autism spectrum disorder and mood- and anxiety disorders could benefit from IF. Future research should disentangle whether positive effects of IF hold true regardless of age or the presence of obesity. Also, variations in fasting patterns, total caloric intake and intake of specific nutrients may be relevant components of IF success. Longitudinal studies and Randomized Clinical Trials (RCTs) will provide a window into the long-term effects of IF on the development and progress of brain-related diseases.

This study presents an in–depth analysis and strategic planning techniques for approaching a situation or achieving progress related to information technology services of Nueva Ecija University of Science and Technology, particularly the San Isidro Campus. As an educational organization and one in the region excellence providers in education, the University has so much vital information to manage and services to offer to provide the student's needs through the Management Information System department, application of IT services as a competing instrument to combat tedious tasks such as online admission, grade release, enrollment information, and online learning, university announcement, and possible students’ internship. The objective of this study is to determine the influence of information technology in day–to–day activities of the organization and strategy applied to streamline processes more conveniently. The researchers develop a conceptual model that would analyze the IT services' impact by identifying its strengths, weaknesses, opportunities, and threats and cleverly act on it using the TOWS Matrix in generating strategic decisions. The overall results were beneficial to the University and MIS as a basis for formulating competitive strategies and integrating it in an extended development plan.

Music and language are hypothesized to share neural resources, particularly at the level of syntax processing. Recent reports suggest that attention modulates this sharing of neural resources, but the time-course of the effects of attention, and the degree to which attention operates similarly on music and language, are yet unclear. In this EEG study we manipulate the syntactic structure of simultaneously presented musical chord progressions and garden-path sentences in a modified rapid serial visual presentation paradigm, while varying top-down attentional demands to the two modalities. The Early Right Anterior Negativity (ERAN) was observed in response to both attended and unattended musical syntax violations. In contrast, an N400 was only observed in response to attended linguistic syntax violations, and a P3 only in response to attended musical syntax violations. Results show that top-down allocation of attention indeed affects the processing of syntax in both music and language, with different neural resources acting upon the two modalities particularly at later stages of cognitive processing. However, the processing of musical syntax at an earlier stage of the perceptual-cognitive pathway, as indexed by the ERAN, is partially automatic, and is strongly indicative of separate neural resources for music and language.

IgE-mediated wheat allergy is a gluten-related disorder. Wheat is one of the five most common food allergens in children. However, the natural history of IgE-mediated wheat allergy has seldom been described in the research literature. This study presents the current state of knowledge about the IgE-mediated wheat allergy in children.

Computers have evolved over the years and as the evolution continues, we have been ushered into an era where high-speed internet has made it possible for devices in our homes, hospital, energy and industry to communicate with each other. This era is what is known as the Internet of Things (IoT). IoT has several benefits in the health, energy, transportation and agriculture sectors of a country’s economy. These enormous benefits coupled with the computational constraint of IoT devices which makes it difficult to deploy enhanced security protocols on them make IoT devices a target of cyber-attacks. One approach that has been used in traditional computing over the years to fight cyber-attacks is Intrusion Detection System (IDS). However, it is practically impossible to deploy IDS meant for traditional computers in IoT environments because of the computational constraint of these devices. In this regard, this study proposes a lightweight IDS for IoT devices using an incremental ensemble learning technique. We used Gaussian Naive Bayes and Hoeffding tree to build our incremental ensemble model. The model was then evaluated on the TON IoT dataset. Our proposed model was compared with other state-of-the-art methods proposed and evaluated using the same dataset. The experimental results show that the proposed model achieved an average accuracy of 99.98\%. We also evaluated the memory consumption of our model which showed that our model achieved a lightweight model status of 650.11KB as the highest memory consumption and 122.38KB as the lowest memory consumption.

With the latest advances in information and communication technologies, greater amounts of sensitive user and corporate information are constantly shared across the network making it susceptible to an attack that can compromise data confidentiality, integrity and availability. Intrusion Detection Systems (IDS) are important security mechanisms that can perform a timely detection of malicious events through the inspection of network traffic or host-based logs. Throughout the years, many machine learning techniques have proven to be successful at conducting anomaly detection but only a few considered the sequential nature of data. This work proposes a sequential approach and evaluates the performance of a Random Forest (RF), a Multi-Layer Perceptron (MLP) and a Long-Short Term Memory (LSTM) on the CIDDS-001 dataset. The resulting performance measures of this particular approach are compared with the ones obtained from a more traditional one, that only considers individual flow information, in order to determine which methodology best suits the concerned scenario. The experimental outcomes lead to believe that anomaly detection can be better addressed from a sequential perspective and that the LSTM is a very reliable model for acquiring sequential patterns in network traffic data, achieving an accuracy of 99.94% and a f1-score of 91.66%.

Although migraine belongs to the main causes of disability worldwide the mechanisms of its pathogenesis are poorly known, which is among the reasons that this disease is underdiagnosed and undertreated. As migraine diagnosis is based on the subjective assessment of symptoms, there is a need to establish objective markers of its occurrence and severity. Tryptophan (TRP) metabolism has been associated with the pathogenesis of neurological and psychiatric disorders. In the present work, we investigated an association between migraine and the urine concentration of TRP and its metabolites 5-hydroxyindoleacetic acid (5-HIAA), kynurenine (KYN), kynurenic acid (KYNA) and quinolinic acid (QA) in 21 low-frequency episodic migraine patients and 32 controls. Migraine patients displayed lower urinary levels of 5-HIAA and KYNA, but KYN and QA were enhanced as compared with the controls. Consequently, the patients were characterized by different values of the 5-HIAA/TRP, KYN/TRP, KYNA/KYN, and KYNA/QA ratios. Furthermore, urinary concentration of 5-HIAA was negatively correlated with Migraine Disability Assessment score, monthly migraine, and monthly headache days. A negative correlation between Patient Health Questionnaire 9 scores assessing depression. In conclusion, the urinary 5-HIAA level may be an easy-to-determine marker of migraine occurrence and severity and may contribute to the identification of migraine patients with depression.

Chronic obstructive pulmonary disease (COPD) is a progressive lung disease that is commonly considered to be a potent driver of non-small cell lung cancer (NSCLC) development and related mortality. A growing body of evidence supports the role of the immune system, mainly played by alveolar macrophages (AMs), as key axes regulating the development of COPD or NSCLC phenotypes in response to harmful agents. MicroRNAs (miRNAs) are small non-coding RNAs that influence most biological processes and interfere with several regulatory pathways. The purpose of this study was to assess miRNA expression patterns in patients with COPD, NSCLC, and ever- or never-smoker controls to explore theirinvolvment in smoking-related diseases. Bronchoalveolar lavage (BAL) specimens were collected from a prospective cohort of 43 sex-matched subjects to determine expression of hsa-miR-223-5p, 16-5p, 20a-5p, -17-5p, 34a-5p and 106a-5p by RT-PCR. In addition, bioinformatic analysis of miRNA target genes linked to cancer was performed. Distinct and common miRNA expression levels were identified in each pathological group suggesting their possible role as an index of NSCLC or COPD microenvironment. Moreover, we identified miRNA targets linked to carcinogenesis using in silico analysis. In conclusion, this study identified miRNA signatures in AMs, allowing us to understand the molecular mechanisms underlying smoking-related conditions and potentially providing new insight for diagnosis or pharmacological treatment.

Abstract: Exercise has been repeatedly shown to be safe and beneficial for cancer survivors. However, there is no normative guideline for exercise prescription, and it is under exploration. Therefore, this literature review aims to provide some advice for the formulation of exercise prescriptions for patients with breast cancer-related lymphedema (BCRL) from the perspective of reducing lymphedema severity. A review of relevant studies published before November 2023 was conducted using three scientific databases PubMed, Embase, and Scopus. A total of 2696 articles were found. Eventually, 13 studies fulfilled the inclusion criteria and were included in this literature review. We concluded daily, or nearly daily exercise at home can be recommended. Moreover, reduced lymphedema severity may not be maintained after ceasing the exercise program, so exercise should be a lifelong practice.

To investigate the associated mechanisms concerning collagen and the expression of apoptosis-related proteins in porcine skin injuries induced by laser exposure, pig skin was treated with a 1064 nm laser. The healing process of the laser-treated areas, alterations in collagen structure, and changes in apoptosis were continuously observed and analyzed from 6 hours to 28 days post-irradiation. On the 28th day following exposure, wound contraction and recovery were notably sluggish in the medium-high dose groups, displaying more premature and delicate type III collagen within the newly regenerated tissues. The collagen density in these groups was roughly 37-58% of that in the normal group. Between days 14 and 28 after irradiation, there was a substantial rise in apoptotic cell count in the forming epidermis and granulation tissue of the medium-high dose group, in contrast to the normal group. Notably, the expression of proapoptotic proteins bax, caspase-3, and caspase-9 surged significantly 14 days after irradiation in the medium-high dose groups and persisted at elevated levels on the 28th day. During the later stage of wound healing, the augmented apoptotic cell population and insufficient collagen generation in the newborn skin tissue of the medium-high dose groups were closely associated with delayed wound recovery.

Breast cancer-related lymphedema (BCRL) affects approximately 20% of women after breast cancer therapy. Advances in treatment have increased life expectancy, thus the prevalence of BCRL will continue to rise with the number of cancer survivors. Hence the need to develop strategies to prevent this condition. We provide a systematic review of the literature on primary prevention of BCRL by prophylactic lymphatic surgery (PLS). Between June and August 2022, we conducted a search of PubMed, Google Scholar and Cochrane. In the end a total of eighteen papers were selected. The eleven studies without a control group reported only 15 of 342 patients who developed lymphedema at least six months after PLS (4.59%). The seven studies with a control group included 569 patients, 328 cases and 241 controls. Among the cases, 36 (10%) developed lymphedema. In contrast, the incidence of lymphedema in controls was 40% (98 of 241 patients). Formulation of definite recommendations in favour of PLS is hindered by low-quality studies. There is no consensus on which technique should be preferred, nor on whether adjuvant radiotherapy might affect the efficacy of PLS. Randomized controlled trials are mandatory to conceive evidence-based recommendations.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

The Vitamin D Receptor (VDR) mediates the actions of vitamin D, which has important roles in bone homeostasis, growth/differentiation of cells, immune functions and reduction of inflammation. Emerging evidences suggest that epigenetic modifications of the VDR gene, particularly DNA methylation, may contribute to the onset and progression of many human disorders. This review aims to summarize the available information on the role of VDR methylation signatures in different pathological contexts, including autoimmune diseases, infectious diseases, cancer and others. The reversible nature of DNA methylation could enable the development of therapeutic strategies, offering new avenues for the management of these worldwide diseases.

Vulvovaginal candidiasis (VVC) is a prevalent condition affecting women worldwide. This study aimed to develop a rapid qPCR assay for accurate identification of VVC etiological agents and reduced azole susceptibility. One hundred and twenty nine vaginal samples from an outpatient clinic (Bilbao-Spain) were analyzed using culture-based methods and multiplex qPCR targeting fungal species, Candida albicans being the predominant species. Antifungal susceptibility tests revealed reduced azole susceptibility in three (3,48%) isolates. Molecular analysis identified several mutations in genes associated with azole resistance and novel mutations in TAC1 and MRR1 genes were also identified, which could contribute to drug resistance.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

In this study, we de novo assembled whole genomes of two small body-sized West Pacific sciaenids (Larimichthys polyactis and Collichthys lucidus) and compared them with published genome data of two closely-related, large body-sized species (Larimichthys crocea and Miichthys miiuy) and one distantly-related, large body-sized outgroup species (Dicentrarchus labrax). The phylogeny constructed using 7,403 single-copy orthologs shared among the five species indicated that L. crocea and L. polyactis diverged about 42 MYA. The two sibling taxa are more closely-related to C. lucidus than M. miiuy. We further identified four growth-related genes (CDHR2, PGC, PTN and PDGFA) that host five diagnostic amino acid variants on body size traits in the fishes, splitting small-body sized L. polyactis and C. lucidus from large-body sized L. crocea, M. miiuy and D. labrax. The results provide new genomic resources and guidelines to facilitate future endeavors in studying functional genomics and developing selective breeding programs for desirable growth traits in sciaenids.

Exposure to extreme heat is a known risk factor that is associated with increased heat-related illness (HRI) outcomes. The relevance of heat wave definitions could change across the health conditions and geographies due to the heterogenous climate profile. This study compared the sensitivity of 28 heat wave definitions associated with HRI emergency department visits over five summer seasons (2011-2016), stratified by two physiographic regions (Coastal and Piedmont) in North Carolina. The HRI rate ratios associated with heat waves were estimated using the generalized linear regression framework assuming a negative binomial distribution. We compared the Akaike Information Criterion (AIC) values across the heat wave definitions to identify an optimal heat wave definition. In the Coastal region, heat wave definition based on daily maximum temperature with a threshold >90^th percentile for two or more consecutive days had the optimal model fit. In the Piedmont region, heat wave definition based on the daily minimum temperature with a threshold value >90^th percentile for two or more consecutive days was optimal. Additionally, we observed that the optimal heat wave definitions from this study captured moderate and frequent heat episodes than the national weather service (NWS) heat products that worked best for extreme heat episodes. This study compared the HRI morbidity risk associated with epidemiologic-based heat wave definitions and with NWS heat products. Our findings could be used for public health education and suggest recalibrating NWS heat products.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

The aim of this study was to evaluate the relationship between serum levels of advanced glycation end products (AGEs) and abdominal aortic calcification (AAC) in patients with type 2 diabetes mellitus (DM2). This was a prospective cross-sectional study conducted from January 2017 to June 2018. One-hundred and four consecutive patients with DM2 were given lateral lumbar X-rays in order to quantify aortic abdominal calcification AAC. Circulating levels of AGEs and classical cardiovascular risk factors were determined. Clinical history was also registered. Patients with higher AGEs values had higher grades of aortic calcification and higher number of diabetic related complications. Multivariate logistic regression analysis showed that being older, male and having high levels of AGEs and triglycerides were the independent risk factors associated to moderate-severe AAC when compared to no-mild AAC. Our results suggest that AGEs plays a role in the pathogenesis of aortic calcifications. In addition, the measurement of AGEs levels may be useful for assessing the severity of AAC in the setting of diabetic complications.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.