Previously, we demonstrated that IR triggers the invasion/migration of A549 cells via activation of an EGFR–p38/ERK–STAT3/CREB-1–EMT pathway. Here, we have demonstrated the involvement of a novel intracellular signaling mechanism in γ-ionizing radiation (IR)-induced migration/invasion. Expression of receptor-interacting protein (RIP) 1 was initially increased upon exposure of A549, a non-small cell lung cancer (NSCLC) cell line, to IR. IR-induced RIP1 is located downstream of EGFR and involved in the expression/activity of matrix metalloproteases (MMP-2 and MMP-9) and vimentin, suggesting a role in epithelial-mesenchymal transition (EMT). Our experiments showed that IR-induced RIP1 sequentially induces Src-STAT3-EMT to promote invasion/migration. Inhibition of RIP1 kinase activity and expression blocked induction of EMT by IR and suppressed the levels and activities of MMP-2, MMP-9, and vimentin. IR-induced RIP1 activation was additionally associated with stimulation of the transcriptional factor NF-κB. Specifically, exposure to IR triggered NF-κB activation and inhibition of NF-κB suppressed IR-induced RIP1 expression followed by a decrease in invasion/migration as well as EMT. Based on the collective results, we propose that IR concomitantly activates EGFR and NF-κB and subsequently triggers the RIP1–Src/STAT3–EMT pathway, ultimately promoting metastasis.

In clinical guidelines, such as National Comprehensive Cancer Network guidelines, it is embodied as first therapeutic option the combination of erlotinib and bevacizumab, based on a small clinical trial which included patients with HLRCC. With this case report we bring out another treatment option, not described before, with extraordinary results based on the combination of a check-point inhibitor and a tyrosine-kinase inhibitor, based on theoretical tumor immunogenic environment.

Glioblastoma multiforme (GBM) is a highly heterogeneous brain tumor with limited treatment options and a poor prognosis. Cancer stem cells (CSCs) have emerged as a critical factor in GBM resistance and management, contributing to tumor growth, heterogeneity, and immunosuppression. The transcription factor FOXM1 has been identified as a key player in the progression, spread, and therapy resistance of various cancers, including GBM. In this study, researchers conducted structure-based in silico screening to identify natural compounds that could target the DNA-binding domain (DBD) of the FOXM1 protein. Through molecular docking analyses, identified Silybin B as a potential inhibitor of FOXM1, exhibiting strong interaction with the protein. MD simulations were performed to validate the binding stability of the FOXM1-Silybin B complex. The study provides valuable insights into the potential of Silybin B as a FOXM1 inhibitor and its ability to induce senescence in GBM stem cells. These findings contribute to the development of structure-based design strategies for FOXM1 inhibitors and innovative therapeutic approaches for the treatment of Glioblastoma.

Background Successful treatment for patients with metastatic colorectal cancer who failed to response to first-line treatment has been a challenge due to their low response rate for later-line treatment and poor progression free survival and overall survival. The application of dendritic cell-cytokine-induced killer cells (DC-CIK) immunotherapy combined with conventional treat-ment, either surgical resection or chemotherapy, showed improvement in survivals in first-line treatment for metastatic colorectal cancer. In this retrospective study, we aimed to evaluate the benefit of dendritic cell-cytokine-induced killer cells (DC-CIK) immunotherapy for patient with refractory metastatic colorectal cancer. Methods A total of 20 patients with refractory metastatic colorectal cancer receiving cell-cytokine-induced killer cells (DC-CIK) immunotherapy were enrolled to this study. Among these patients, 11 patients responded to the treatment and the remaining 9 patients did not. All patients were followed for at least one years and the determination of treatment response was mainly based on image study at 6 months after the completion of treatment. Data were analyzed with Kaplan-Meier method and log-rank test. Results The treatment response rate of the study group is 55% (11/20). The median progression free sur-vival (PFS) and median overall survival (OS) of responsive patients was 7 months and 12 months, respectively. The median overall survival of irresponsive patients was 9.5 months. Four responsive patients received subsequent metastectomy or cytoreduction plus hyperthermic in-traperitoneal chemotherapy surgery (CRS + HIPEC). Conclusion DC-CIK cell-based immunotherapy may provide benefits for patients with refractory mCRC with improved response rate and progression free survival.

Oral cancer cells (TYS) and the signalling pathways involved in metastasis, in response to cancer-associated fibroblasts (CAFs, COM) and normal oral mucosal fibroblasts (MM1) was studied. Metastatic cell behaviour was observed by cell-scatter, 3D-collagen gel migration and 3D-spheroid invasion assays. Akt, MAPK, EGFR, TGFβRii and CXCR4 inhibitors were used to identify the signalling pathways involved. Signalling pathway protein expression and activation were assessed by SDS-PAGE and Western Blotting. COM-CM (conditioned medium) and MM1-CM stimulated cancer cell scattering, which was blocked only by the Akt inhibitor. COM-CM induced scattered cancer cells showed higher levels of Akt phosphorylation than the negative control and MM1-CM. Migration and invasion of TYS cells into the collagen gels from the spheroids was stimulated by CM from both sources, compared to the negative control. COM cells stimulated TYS, cancer cell invasion into the collagen more than MM1 and the control. Akt and EGFR inhibitors effectively blocked CM and COM cell-induced invasion. Akt-silenced cancer cells were not stimulated to migrate and invade by fibroblast-CM and did not survive addition of the EGFR inhibitor. This suggests that CAFs stimulate oral cancer cell migration and invasion in an Akt- dependent manner. EGFR and Akt are potential therapy targets in metastatic oral cancer.

Lung cancer is almost the most common cause of cancer death in the world. Clinically, the conventional therapy to eradicate the cancer cells is chemotherapy but a better drug remains required. In this study, the effects of three bufadienolides, kalantuboside B, kalantuboside A and bryotoxin C, isolated from Kalanchoe tubiflora (Harvey) were evaluated and characterized in CL1-5 highly metastatic human lung cancer cells. Contrary to the apoptosis-promoting activity in other cancer cells, these three bufadienolides did not induce apoptosis in CL1-5 cancer cells. Instead, they activated an autophagy pathway, as indicated by the increase of autophagosomes formation. The induction of autophagy by these three bufadienolides was demonstrated to link to down-regulation of p-mTOR as well as up-regulation of LC3-II, ATG5, ATG7, Beclin-1. Moreover, among these three compounds, kalantuboside B in which a monosaccharide is attached at the bufadienolide aglycon, exhibited a better autophagy induction. Our findings revealed an alternative mechanism of drug action by bufadienolides in lung cancer cells and provided evidence for the possibility of treating highly metastatic human lung cancer through an autophagy pathway.

The currently available anti-cancer therapies, such as gamma-radiation and chemotherapeutic agents, induce cell death and cellular senescence not only in cancer cells but also in the adjacent normal tissue. New anti-tumor approaches focus on limiting the side effects on normal cells. In this frame, the potential anti-tumor properties of Pulsed Electromagnetic Fields (PEMFs) through irradiation of breast cancer epithelial cells (MCF-7 and MDA-MB-231) and normal fibroblasts (FF95) were investigated. PEMFs had a frequency of 8 Hz, full-square wave type, magnetic flux density of 0.011 T and applied twice daily for 5 days. Data collected showcases that PEMF application decreases the proliferation rate and viability of breast cancer cells while having the opposite effect on normal fibroblasts. Moreover, PEMF irradiation induced cell death and cellular senescence only in breast cancer cells without any effect in the non-cancerous cells. These findings suggest PEMF irradiation as a novel, non-invasive anti-cancer strategy in combination with senolytic drugs, to eliminate both cancer and the remaining senescent cells while simultaneously avoiding the side effects of the current treatments.

This review article seeks to provide relevant information about the applicability of cell-based assays in assessing cytotoxicity of phytochemicals in light of several traditional methods available. Phenolic compounds and other phytochemicals are significant resources for drug discovery and development, thus underlining the enormous potentials of plant-derived natural products for the prevention and management of oxidative stress associated with cancer and other diseases. These effects have been linked to the content of phytochemicals such as phenolic compounds and their antioxidant properties. The abundance and complexity of these bio-constituents highlight the need for well-defined methods for the in vitro characterization and quantification of extracts and/or preparations that can translate to in vivo effects. Cell culture systems provide a useful model for basic research and a wide range of clinical in vitro studies and physiological processes as well as assessing the toxicity and therapeutic potential of compounds including plant extracts with potential medicinal benefits. Their use in cancer research provide a useful insight into possible therapeutic properties of phytochemicals at the cellular level. This approach has been instrumental in the initial stages of developing chemotherapeutic agents where human cancer cell lines are used as experimental models. These models have continued to contribute to elucidating specific requirements for certain biochemical events associated with proliferation, metabolism, loss of cell viability/apoptosis. Cell culture systems remain a promising tool in natural product development.

The emergence of immune checkpoint inhibitors (ICIs) has dramatically changed the treatment landscape for patients with metastatic non-small cell lung cancer (NSCLC). These achievements inspired investigators and pharmaceutical companies to conduct clinical trials in patients with early-stage NSCLC because both adjuvant and neoadju-vant platinum-based doublet chemotherapies (PT-DCs) showed only a 5% improve-ment in the 5-year overall survival. IMpower010, a phase 3 trial (P3), showed that ad-juvant PT-DC followed by maintenance atezolitumab significantly prolonged dis-ease-free survival than adjuvant PT-DC alone (hazard ratio, 0.79; stage II to IIIA). Since conventional therapies, including chemotherapy and radiotherapy, can promote im-munogenic cell death, which releases tumour antigens from dead tumour cells, ICI combination therapies with conventional therapies are widely proposed. Checkmate 816 trial (P3) indicated a significantly higher pathological complete response rate of neoadjuvant nivolumab/PT-DC combination therapy than neoadjuvant PT-DC alone (odds ratio, 13.9, for stage IB to IIIA). Detection of circulating tumour DNA is highly anticipated for the evaluation of minimal residual disease. Multimodal approaches and new ICI agents are being attempted to improve the efficacy of ICI treatment in phase 2 trials. This review presents the development of perioperative treatment using ICIs in patients with NSCLC while discussing problems and perspectives.

Growing evidence has revealed the implication of germline variation in cancer predisposition and prognostication. Here, we describe an analysis of putatively disruptive rare variants across the genomes of 726 patients with B-cell lymphoid neoplasms. We discovered a significant enrichment of 26 genes in germline protein truncating variants (PTVs), affecting cell signaling (MET, JAK2, ANGPT2), energy metabolism (ACO1) and nucleic acid metabolism and repair pathways (NT5E, DCK). Interestingly, some of these variants were restricted to either chronic lymphocytic leukemia (CLL) (i.e., ANGPT2 and AKR1C3) or B-cell lymphoma cases (PNMT, TPT1 and IGHMBP2). Additionally, we detected 1,675 likely disrupting variants in genes associated with cancer, of which 44.75% were novel events and 7.88% were PTVs. Among these, the most frequently affected genes were ATM, BIRC6, CLTCL1A and TSC2. Homozygous or compound heterozygous variants were detected in 28 cases; and coexisting somatic events were observed in 17 patients, some of which affected key lymphoma drivers such as ATM, KMT2D and MYC. Finally, we observed that variants in the helicase gene WRN were independently associated with shorter survival in CLL. Our study results support an important role for rare germline variation in the pathogenesis, clinical presentation and disease outcome of B-cell lymphoid neoplasms.

Osteopontin (OPN)-CD44 signaling plays an important role in promoting tumor progression and metastasis. In cancer, OPN and CD44 overexpression is a marker of aggressive disease and poor prognosis, and correlates with therapy resistance. In this study, we aimed to evaluate the association of single nucleotide polymorphisms (SNPs) in the OPN and CD44 genes with clinical outcomes in 307 non-small cell lung cancer (NSCLC) patients treated with radiotherapy or chemoradiotherapy. The potential impact of the variants on plasma OPN levels was also inves-tigated. Multivariate analysis showed that OPN rs11730582 CC carriers had a significantly in-creased risk of death (p = 0.029), while the CD44 rs187116 A allele correlated with reduced risk of locoregional recurrence (p = 0.016) in the curative treatment subset. The rs11730582/rs187116 combination was associated with an elevated risk of metastasis in these patients (p = 0.016). Fur-thermore, the OPN rs1126772 G variant alone (p = 0.018) and in combination with rs11730582 CC (p = 7x10-5) was associated with poor OS in the squamous cell carcinoma subgroup. The rs11730582 CC, rs187116 GG and rs1126772 G, as well as their respective combinations, were in-dependent risk factors for unfavorable treatment outcomes. The impact of rs11730582-rs1126772 haplotypes on OS was also observed. These data suggest that OPN and CD44 germline variants may predict treatment effects in NSCLC.

Prostate cancer (PCa) Lung metastases are rarely resected, therefore PCa lung metastases are insufficiently molecularly characterized. We recently identified carcinoembryonic antigen cell adhesion molecule 6 (CEACAM6) as a potential driver of pulmonary metastatic spread. Here, we show the biological significance of CEACAM6 in PCa cell proliferation, apoptosis and migration. CEACAM6 was silenced by siRNA in PC3 cells. Functional assessment of apoptosis, cell viability, proliferation and migration were performed in siRNA-CEACAM6 PC3 cells. Non-treated and scrambled (scr) RNA PC3 cells were used as control. Following a specific knockdown of CEACAM6 in PC3 cells, the expression of CEACAM6 protein was significantly decreased in comparison to controls. Cell viability and cell counts decreased in CEACAM6 silent PC3 cells. In contrast, caspase-3 activity was highly elevated in siRNA-CEACAM6 PC3. Furthermore, by performing a cell scratch assay, the migration ratio in siRNA-CEACAM6 PC3 cells were significantly diminished compared with the control group after 48 hours of post transfection incubation. CEACAM6 as a cell adhesion molecule has been implicated in promoting metastatic disease in several solid tumours such as colorectal or gastric cancer. We could show that silencing of CEACAM6 has a significant functional effect on PCa cells. CEACAM6 might play an important role in fostering metastatic spread to the lung of PCa patients via enhancing proliferation and suppressing apoptosis. CEACAM6 might therefore pose an attractive therapeutic target to prevent metastatic disease.

The mechanistic target of rapamycin (mTOR) kinase is one of the top drug targets for promoting health and lifespan extension. Besides rapamycin, only a few other mTOR inhibitors have been developed and shown their ability to slow aging. We used machine learning to predict novel small molecules targeting mTOR. We selected one small molecule, TKA001, based on in-silico predictions of a high on-target probability, low toxicity, favorable physicochemical properties, and preferable ADMET profile. We confirmed TKA001 binding in silico by molecular docking. TKA001 potently inhibits both TOR complex 1 and 2 downstream signaling in vitro. Furthermore, TKA001 inhibits human cancer cell proliferation in vitro and extended the lifespan of C. elegans, suggesting that TKA001 can slow aging in vivo.

In this perspective, we identify emerging frontiers in clinical and basic research of melanocyte biology and its associated biomedical disciplines. We describe challenges and opportunities in clinical and basic research of normal and diseased melanocytes that impact current approaches to research in melanoma and the dermatological sciences. We focus on four themes: (1) clinical melanoma research, (2) basic melanoma research, (3) clinical dermatology, and (4) basic pigment cell research, with the goal of outlining current highlights, challenges, and frontiers associated with pigmentation and melanocyte biology.

Background: Bladder cancer (BC) development is highly related to immune cell infiltration and inflammation. This study aimed to construct a new classification of bladder cancer (BC) molecular subtypes based on immune cells-associated CpG sites. Methods: The genes of 28 types of immune cells were obtained from previous studies. Then methylation sites corresponding to immune cells-associated genes were acquired. Differentially methylation sites (DMSs) were identified between normal samples and bladder cancer samples. Unsupervised clustering analysis of differentially methylation sites was performed to divide into several subtypes. Then the potential mechanism of different subtypes was exploded. Result: Bladder cancer patients were divided into three groups. Cluster 3 (methylation-L) subtype had the best prognosis. Cluster 1 (methylation-M) had the worst prognosis. The distribution of immune cells, level expression of checkpoints, stromal score, immune score, ESTIMATEScore, tumor purity, APC_co_inhibition, APC_co_stimulation, HLA, MHC_class_I, Type_I_IFN_Reponse, and Type_II_IFN_Reponse were significant difference among three subgroups. The distribution of genomic alterations was different among them. Conclusion: The classification was accurate and stable. BC patients could be divided into three subtypes based on the immune cells-associated CpG sites. Specific biological signaling pathways, immune mechanisms, and genomic alterations were various among three subgroups. High level immune infiltration was a correlation with high level methylation. The lower RNAss score was associated with higher immune infiltration and higher level expression of CD274.

Currently, large cell neuroendocrine carcinoma of the lung (LCNEC) is classified as a rare lung cancer subtype, but given the high incidence of lung cancer, the overall number of cases is considerable. The pathologic diagnosis is based on the microscopic appearance of the tumor cells, the amount of intra-tumoral necrosis, the mitotic rate, and the presence of positive neuroendocrine markers identified by immunohistochemistry. Recently, a subdivision into two main categories was proposed based on mutation signatures involving the RB1, TP53, KRAS, and STK11/LKB1 genes, into SCLC-like (small cell lung cancer-like) and NSCLC-like (non-small cell lung cancer-like) LCNEC. In terms of treatment, surgery remains the best option for resectable, stage I–IIIA cases. Chemotherapy and radiotherapy have conflicting evidence. Etoposide/platinum remains the standard chemotherapy regimen. However, based on the newly proposed LCNEC subtypes, some retrospective series report better outcomes using a pathology-driven chemotherapy approach. Encouraging outcomes have also been reported for immunotherapy and targeted therapy, but the real impact of these strategies is still being determined in the absence of adequate prospective clinical trials. The current paper scrutinizes the epidemiology, reviews the reliability of pathologic diagnosis, discusses the need for molecular subtyping, and reviews the heterogeneity of treatment algorithms in LCNEC.

The antibody Trastuzumab (Tz) targeting ERBB2 has improved the prognosis of patients with breast cancer (BCa) that overexpress this receptor. Resistance to Tz negatively impacts prognosis. Several mechanisms have been reported to cause Tz resistance. The objective of this study was to identify common mechanisms in in vitro models of acquired BCa Tz resistance. In particular, we used three widely available ERBB2+ BCa cell lines adapted to grow in Tz. We performed several analyses to address possible changes in phenotype, proliferation, and ERBB2 membrane expres-sion common to the three Tz-R cell lines compared to wt, but none was found. High-resolution mass spectrometry analysis identified, instead, a common set of differentially expressed proteins (DEPs) in Tz-R vs. wt cells. Furthermore, bioinformatic tools revealed that all three Tz-R cell models shared a modulation of proteins involved in the metabolism of lipids, organophosphate biosynthetic process, and macromolecule methylation. Ultrastructural analysis confirmed altera-tion of lipid droplets in resistant cells. Our data strongly support the hypothesis that complex metabolic adaptation, including lipid metabolism, protein phosphorylation, and possibly chro-matin remodeling, may fuel Tz resistance. The identification of a common set of 10 DEPs in all three TZ-resistant cell lines may provide novel targets for therapeutic intervention.

Autoantibodies against specific lung cancer-associated antigens have been suggested for lung cancer diagnosis. This study aimed to evaluate the diagnostic performance of anti-gen-autoantibody immune complex (AIC) against its free antigens for CYFRA21-1, ProGRP, NGAL, and NSE in non-small cell lung cancer (NSCLC). In total, 85 patients with NSCLC and 120 healthy controls (HCs) were examined using a 9G DNA chip method. The ratios of AICs to their antigens and combinations of ratios consisting of two to four markers were calculated. The levels of AICs for CYFRA21-1, ProGRP, NGAL, and NSE were higher than their free antigens in all participants. The levels of each free antigen distinguished patients with NSCLC from HCs. The ratios of AIC to its antigen and seven combinations consisting of two to four ratios were significantly higher in patients with NSCLC than those in HCs. Excellent diagnostic performance was observed for all combination ratios (C4-1), with 85.9% sensitivity and 86.7% specificity at cutoff 3.51. Higher sensitivity was observed in the very early stages (0–I) and adenocarcinoma than in stages II–IV and other pathological types. The combination of all ratios of AICs and their antigens for all four markers is useful in the diagnosis of NSCLC.

In this study, we aimed to identify blood lymphocytes as a prognostic factor for survival in patients with locally advanced stage III non-small cell lung cancer (NSCLC) treated with concurrent chemoradiotherapy (CCRT). We conducted a secondary analysis of 196 patients enrolled in the Korean Radiation Oncology Group 0903 phase III clinical trial to evaluate the prognostic significance of circulating blood lymphocyte levels. The median total lymphocyte count (TLC) reduction ratio during CCRT was 0.74 (range: 0.29 – 0.97). In multivariate analysis, patient age (p = 0.014) and gross tumor volume (GTV, p = 0.031) were significant factors associated with overall survival, while TLC reduction (p = 0.018) and pretreatment neutrophil-to-lymphocyte ratio (NLR; p = 0.010) were associated with progression-free survival (PFS). In multivariate logistic regression analysis, pretreatment NLR, GTV, and heart V20 were significantly associated with TLC reduction. TLC reduction during CCRT is a significant prognostic factor for PFS, and heart V20 is significantly associated with TLC reduction. Thus, constraining the volume of the radiation dose to the whole heart must be prioritized to reduce TLC.

Oral cancer is a major public health burden worldwide. The lack of biomarkers for early diagnosis has increased the difficulty in managing this disease. Recent studies have reported that neutrophil gelatinase-associated lipocalin (NGAL), a secreted glycoprotein, is upregulated in various tumors. In our study we found that NGAL was significantly downregulated in primary malignant and metastatic tissues of oral cancer compared to normal tissues. The downregulation of NGAL was strongly correlated with the degree of differentiation and stage (I-IV), and can serve as a prognostic biomarker for oral cancer. Tobacco carcinogens were also found to be involved in the downregulation of NGAL. Mechanistic studies revealed that knockdown of NGAL increased oral cancer cell proliferation, survival, and migration, and also induced resistance against cisplatin. Silencing of NGAL activated mTOR signaling and reduced autophagy by the LKB1-AMPK-p53-Redd1 signaling axis. Moreover, cyclin-D1, Bcl-2, and MMP-9 were upregulated, and caspase-9 was downregulated, suggesting that silencing of NGAL increases oral cancer cell proliferation, survival, and migration. Thus, from our study it is evident that downregulation of NGAL activates the mTOR pathway and helps in the progression of oral cancer.

Background: The phase III KEYNOTE-604 study confirmed the benefit of pembrolizumab combined with chemotherapy in the first-line treatment of extensive-stage small-cell lung cancer(ES-SCLC). Intergrated the clinical benefits of pembrolizumab and its high cost into account, this study aim to assess the cost-effectiveness of adding pembrolizumab to standard first-line etoposide-platinum (EP) for patients with ES-SCLC from the the US payer perspective. Methods: A Markov model was developed to compared the costs and quality-adjusted life-years (QALYs) of pembrolizumab plus EP and placebo plus EP over a 10-year time horizon. Clinical efficacy, treatment utilization and safety data were pooled from the KEYNOTE-604 trial. Utilities were obtained from published resources. Costs were mainly collected from Medicare in 2020. Sensitivity analyses were performed to examined the robustness of our model. Results: Adding pembrolizumab to standard first-line EP, resulted in better effectiveness than the use of EP alone for ES-SCLC by 0.22 QALYs. Pembrolizumab plus EP was dominated economically by placebo plus EP, leading to an incremental cost-effectiveness ratio(ICER) of $334,373/ QALY. Deterministic sensitivity analyses indicated that the uncertainty in model parameters exerts no substantial effect on our results. Probability sensitivity analysis indicated that probabilities for pembrolizumab plus EP being cost-effective within a wide rang of willingness to pay were modest. Conclusion: From the US payer perspective, the first-line treatment for ES-SCLC with pembrolizumab plus EP was not cost-effective compare with placebo plus EP. Although pembrolizumab combination chemotherapy was beneficial to the survival of ES-SCLC, price reduction may be the necessary measure to improve its cost-effectiveness.

Most pivotal clinical trials in advanced non-small cell lung cancer (NSCLC) have excluded patients with poor performance status (PS), and data on the efficacy and safety of pharmacotherapy have not been fully accumulated. For NSCLC patients with PS 2 and without druggable genetic alterations, monotherapy with cytotoxic agents or carboplatin-based combination therapy is usually administered based on the results of several randomized trials. However, the evidence of cytotoxic chemotherapy for patients with PS 2 is insufficient, with limited efficacy and toxicity concerns. Immune checkpoint inhibitors (ICIs) are a promising treatment for patients with PS 2 because of lower incidence of severe toxicity compared to cytotoxic chemotherapy. Meanwhile, several reports suggest that anti-PD-1 antibodies monotherapy is less effective for patients with PS 2, especially for those with PS 2 caused by disease burden. Although the combination therapy of nivolumab and ipilimumab is a promising treatment option, there is a divergence in efficacy data between clinical trials. The standard of care for advanced NSCLC with PS 2 has not been established, and future therapeutic strategies should take into account the heterogeneity of the PS 2 population.

Cathepsins (Caths) are lysosomal proteases that participate in various physiological and pathological processes. Accumulating evidence suggests that cathepsins play a multifaceted role in radiotherapy response. Firstly, cathepsins contribute to the remodelling of the tumor microenvironment by degrading extracellular matrix components, promoting angiogenesis, and facilitating tumor invasion and metastasis. Their proteolytic activity influences the tumor's response to radiation by affecting oxygenation, nutrient availability, and immune cell infiltration within the tumor microenvironment. Furthermore, cathepsins have been implicated in DNA damage repair processes, including non-homologous end joining and homologous recombination. Cathepsin-mediated DNA repair mechanisms can promote radioresistance in cancer cells, limiting the efficacy of radiotherapy. Additionally, cathepsins have been associated with the activation of prosurvival signalling pathways, such as PI3K/Akt and NF-κB, which can confer resistance to radiation-induced cell death. Radiotherapy plays a crucial role in the treatment of various malignancies. However, the effectiveness of radiotherapy can be limited by intrinsic or acquired resistance mechanisms in cancer cells. In recent years, there has been growing interest in understanding the role of cathepsins, a family of proteases, in modulating the response of tumor cells to radiotherapy. In this study, we shed light on the regulation and expression of cathepsin B in colon carcinoma cell line (Caco-2) before and after exposure to radiation were investigated. Radiation-induced upregulation of cathepsin B in dose-independent manner. Proteolytic inhibition of cathepsin B by cathepsin B specific inhibitor CA074 has increased the cytotoxic effect of ionizing irradiation in caco-2 cells. Similar results were also obtained after cathepsin B knockout by CRISPR CAS9. These results showed that cathepsin B could contribute to ionizing radiation resistance and abolishing of cathepsin B either by inhibition its proteolytic activity or expression has increased in caco-2 cells susceptibility to ionizing irradiation.

The incidence of human papillomavirus-related head and neck squamous cell carcinoma (HPV+HNSCC) has reached epidemic levels in the last decade. While prophylactic vaccines will prevent future HPV infections, there are currently no HPV-specific antiviral drugs to treat current HPV infections or HPV+HNSCC. HPV replication and transcription are promising targets for anti-HPV therapeutics, as modulation of these processes can alter expression levels of HPV E6 and E7, which are required for maintenance of the transformed phenotype. This is a particularly attractive target in in HPV+HNSCC where the majority of tumors have episomal genomes replicating in an E1-E2 dependent manner. Here, we describe a model system to study HPV16 E1-E2 mediated DNA replication and HPV16 E2-mediated transcriptional activation and repression in multiple HNSCC cell lines. Our results demonstrate that low levels of IFIT1 are required for HPV16 replication in HNSCC cell lines and HPV16 E1 interacts with IFIT1. Restoration of IFIT1 expression in HNSCC cell lines partially inhibits HPV16 E1-E2 mediated replication. This system can be used to study replication and transcription by HPV16 E1 and E2 in HNSCC as well as be utilized to screen potential anti-HPV therapeutics that target HPV16 replication and transcription.

Circulating tumor cells (CTCs) are cells released from the primary tumor and intravasate into the blood or lymphatic vessels, where they are transported to distant sites and act as seeds that initiate cancer metastases. Recent advances in CTC research have shown their relevance as prognostic markers for early and metastatic disease detection, predictive biomarkers for relapse, and response to medical intervention or therapy. The rapidly evolving landscape of CTC biology has opened new avenues for understanding cancer progression, metastasis, and treatment response. Additionally, translating these findings into clinical applications holds promise for improving cancer diagnostics, prognosis, and personalized therapeutic strategies. This review discusses the significance of CTCs in cancer research and their associated challenges. We explore recent developments in the detection and characterization of CTCs and their implications in cancer research and clinical practice.

Exportin-1, the ubiquitous nuclear protein transporter, is widely confirmed as an active chemotherapeutic target in non-small cell lung cancer condition while Juglans mandshurica is a well-studied anticancer plant in some lung cancer cell lines. We intend to find novel exportin-1 inhibitor from Juglans mandshurica with better potential tolerability and pharmaco-dynamo-kinetic properties than the current selective inhibitors of nuclear export in non-small cell lung cancer treatment. Osiris property explorer DataWarrior, Glide standard precision docking, quantum mechanics polarized ligand docking, MMGBSA binding free energy calculations, Jaguar density functional theory analysis, and the online web-based SwissADME were employed respectively in this study to filter the retrieved compounds based on tolerability, toxicity, and Lipinsky’s rule of five violation potential, determine their druggability, establish relative stability of the lead compound in water solvation model, and evaluates druglikeness, lead-likeness, as well as synthetic accessibility of the lead compound. This study reveals eriodictyol as having higher binding free energy (-40 kcal/mol) than that of standard (-39.56 kcal/mol) in exportin-1 active site, better synthetic accessibility score (3.15 versus 3.29), high GI absorption, non-blood brain barrier permeant, lacks Brenk and PAINS alert, obeying Lipinski’s, Ghose’s, Veber’s, Egan’s, and Muegge’s rule of druglikeness and lead-likeness as well as non-cytotoxic to HepG2 cells. We therefore found eriodictyol as a lead-like, non-toxic exportin-1 inhibitor with good predictive stability and pharmacokinetic potential and thus provided data for further validation of eriodictyol as a candidate exportin-1 inhibitor in both preclinical and clinical studies involving lung cancer therapy.

Colorectal cancer prognosis get worse with advancement of disease into metastatic stage. There is a pertinent need to develop prognostic biomarkers that can be used for personalized and precision medicine. Alternative splicing provides an insight into understanding of changes at isoform expression level which may not be evident at gene level. In this direction, we utilized our prior knowledge about significant alternatively spliced genes and chose ADAM12 and MUC4 for further characterization in a metastatic cell line model. These genes were found to be good prognostic indicators in The Cancer Genome Atlas database. We studied the gene organization and designed primers to specifically amplify a group of isoforms. Differential expression of these group of isoforms was observed in normal, primary and metastatic colorectal cancer cell lines. We further validated the results using sanger sequencing. Isoform expression was found to respond to the 5-fluorouracil treatment. RNAseq analysis of the cell lines further validated the differential expression of gene isoforms. Successful detection of ADAM12 and MUC4 in cell lysates varied according to the antibody used which may reflect differential expression of isoforms. This comprehensive study underscores the importance of studying alternatively spliced isoforms and their probable used as prognostic or predictive biomarkers.

T cells follow a triphasic distinct pathway of activation, proliferation and differentiation before becoming functionally and phenotypically ‘exhausted’ in settings of chronic infection, autoimmunity and in cancer. Exhausted T cells progressively lose canonical effector functions, exhibit altered transcriptional networks and epigenetic signatures and gain constitutive expression of a broad coinhibitory receptor suite. This review outlines recent advances in our understanding of exhausted T cell biology and examines cellular and molecular mechanisms by which a state of dysfunction or exhaustion is established, and mechanisms by which exhausted T cells may still contribute to pathogen or tumour control. Further, this review describes our understanding of exhausted T cell heterogeneity and outlines the mechanisms by which checkpoint blockade differentially engages exhausted T cell subsets to overcome exhaustion and recover T cell function.

A distinctive feature of the SARS-CoV-2 spike protein is its ability to efficiently fuse cells, thus producing syncytia found in COVID-19 patients. This commentary proposes how this ability enables spike to cause COVID-19 complications as well as side effects of COVID-19 vaccines, and suggests how these effects can be prevented..

Cellular locomotion is required for survival, fertility, proper embryonic development, regeneration, and wound healing. Cell migration is a major component of metastasis, which accounts for two-thirds of all solid tumor deaths. While many studies have demonstrated increased energy requirements, metabolic rates, and migration of cancer cells compared to normal cells, few have systematically compared normal and cancer cell migration as well as energy requirements side by side. Thus, we investigated how non-malignant and malignant cells migrate utilizing several cell lines from the breast and lung. Initial screening was done in an unbiased high-throughput manner for the ability to migrate/invade on collagen and/or Matrigel. We unexpectedly observed that all the non-malignant lung cells moved significantly faster than cells derived from lung tumors regardless of growth media used. Given the paradigm-shifting nature of our discovery, we pursued possible mechanisms responsible. Neither mass, cell doubling, nor volume, accounted for the individual speed and track length of the normal cells. Non-malignant cells had higher levels of ATP at premigratory-wound induction stages. Meanwhile, cancer cells also increased ATP at premigratory-wound induction – but not to the levels of the normal cells, indicating the possibility for further therapeutic investigation.

Oral Squamous Cell Carcinoma is one among the most common cancer and early detection is the main key to avoid deaths. Automated diagnostic tools that process the histopathological images of a patient to detect abnormal oral lesions will be very much useful for the clinicians. A deep learning framework have been designed with an intermediate layer between feature extraction layers and classification layers for classifying the histopathological images into two categories, namely normal and oral squamous cell carcinoma. The intermediate layer is constructed using the proposed Swarm Intelligence technique called Modified Gorilla Troops Optimizer. Various optimization algorithms are implemented in literature for optimal parameter identification, weights updating and feature selection in deep learning models, but this work focuses on usage of optimization algorithm as intermediate layer that transforms the extracted features into the features that are more suitable for classification. Three datasets totally comprising 2784 normal and 3632 oral squamous cell carcinoma subjects are considered in this work. Three popular CNN architectures namely InceptionV2, MobileNetV3, and EfficientNetB3 are investigated as feature extraction layers. Two fully connected Neural Network layers along with batch normalization and dropout are used as classification layers. Among the investigated feature extraction models, MobileNetV3 performs well in all the three datasets with the highest accuracy of 0.89. Usage of the proposed Modified Gorilla Troops Optimizer as an intermediate layer boosts this accuracy to 0.95.

Background and Aim: Pancreatic cancer (PC) is a highly aggressive malignancy associated with low survival rates. Many chemotherapeutic regimens have been investigated for advanced unresectable and metastatic PC, but with only minimal improvement in survival and prognosis. The present study aimed to investigate the anti-cancer function of free and nano-encapsulated hydroxytyrosol (Hyd) and curcumin (Cur), and its combinations (Hyd-Cur) on the PANC-1 cell line.Methods: The poly lactide-co-glycolide-co-polyacrylic acid (PLGA-co-PAA) nano-encapsulated Hyd and Cur were synthesized, and MTT assay was performed to evaluate cytotoxic effects of free and nano-encapsulated Hyd, Cur, and Hyd-Cur. Moreover, effects of free and nano-encapsulated Hyd, Cur, and Hyd-Cur were evaluated on viability, migration, morphological alterations, colony formation, and apoptosis on PANC-1 cell line. The mRNA expression levels of MMP2, MMP9, BAX, BCL-2, and Cas9 genes were assessed after treated PANC-1 cells with free and nano-encapsulated Hyd, Cur, and Hyd-Cur.Results: The obtained results showed that free and nano-encapsulated Hyd, Cur, and Hyd-Cur treatments significantly decreased the viability, migration, and colony formation in the PANC-1 cells. Furthermore, apoptosis rates in PANC-1 cells were increased in a concentration and time dependent manner in all of the treatment groups. Moreover, anti-proliferative activity of nano-encapsulated Hyd-Cur was significantly more than other treatments.Conclusion: According to our results, Hyd-Cur combination and nano-encapsulation therapy exerts more profound apoptotic and anti-proliferative effects on PANC-1 cell line than free Hyd or Hyd monotherapy.

Mammary neoplasm affects a population of intact and elderly female dogs and 50% are malignant. In order to study this disease, cell culture is as a promising preclinical model, creating the opportunity to deposit cell lines at a cell bank, allowing a great reproducibility of the assays and making the validation of the results more reliable. Another important aspect is the possibility to establish models for better understanding tumour characteristics, such as vasculogenic mimicry. Due the importance of cancer cell lines in preclinical models, this study aimed to establish and characterize primary cell lines from canine mammary gland tumours according to immunophenotype and tumorigenicity, and with its ability to form vasculogenic mimicry-like structures in vitro and in vivo. Cell cultures were evaluated for morphology, phenotype, vasculogenic mimicry and tumorigenicity abilities. We collected 17 primary mammary carcinoma and 3 metastasis and had a satisfactory result in 10 of them. All cell lines presented spindle shape or polygonal morphology and expressed concomitant pan-cytokeratin and cytokeratin 8/18. Four cell lines had vasculogenic mimicry ability in vitro and two of them showed in vivo tumorigenic potential and forming VM in the xenotransplant tumour. Cell characterization of those lines will help to create a database for more knowledge of mammary carcinomas in dogs, including studies of tumour behaviour and new therapeutic targets.

Breast cancer is the most common malignancies in women and the second leading cause of cancer death in women. Triple negative breast cancer (TNBC) subtype is a breast cancer subset without ER, PR and HER2 expression, limiting treatment options and presenting a poorer survival rate. Thus, we investigated whether HDACi would be used as potential anti-cancer therapy on breast cancer cells. In this study, we found TNBC and HER2-enrich breast cancers are extremely sensitive to Panobinostat, Belinostat of HDACi via experiments of cell viability assay, apoptotic marker identification and flow cytometry measurement. On the other hand, we developed a bioluminescence based live cell non-invasive apoptosis detection sensor (IADS) detection system to evaluate the quantitative and kinetic analyses of apoptotic cell death by HDAC treatment on breast cancer cells. In addition, the use of HDACi may also be accompanied with chemotherapeutic agent such as doxorubicin to synergic drug sensitivity on TNBC cell (MDA-MB-231), but not in breast normal epithelia cells (MCF-10A), providing therapeutic benefits against breast tumor in clinic.

Chemical combinations are believed to reduce drug toxicity, delay cancer cell growth, and achieve enhanced efficacy compared with single active drugs. This research investigated the synergistic effect of DOX and Zm-093, a new sulfonamide derivative, on improving the potential for inducing apoptosis in breast cancer (BC) cell lines. First, the Zm-093 compound was synthesized and its structure was confirmed by FT-IR and NMR. Then, the IC50 values for DOX and Zm-093 were calculated to be 1.21 and 51.24 μM, respectively. To investigate the synergistic effect, Compusyn software was utilized to calculate the combination index (CI). Different methods, including western blotting, flow cytometry, and TUNEL, were used to evaluate the potential synergistic effects of these compounds on inducing apoptosis in MCF-7 cells. Combining the indexes obtained at all concentrations revealed synergistic results. The proapoptotic proteins Bax, tBid, and caspase-3, however, increased 2.4, 3.3, and 5.7 times more than those in the control group. Flow cytometry analysis and the TUNEL method in cells treated with DOX and Zm-093 showed that apoptosis was significantly higher than in other groups. The results confirmed the synergistic effect of DOX and ZM-093 on apoptotic factors expression in MCF-7 cells.

There exists a variety of studies about tumor-infiltrating lymphocytes (TILs) in cervical cancer, but their prognostic value in correlation to the histopathological subtype was never investigated. Therefore, the aim of this study was to quantify TILs in a panel of 250 sporadic cervical cancers and investigate the correlation with cervical cancer subtype and patient survival. TIL levels were significantly increased in the subgroup of squamous cell carcinomas in comparison to adenocarcinomas. In squamous cell carcinomas, TIL infiltration shows a negative correlation to age, FIGO stage and to the histone protein modification H3K4me3. Moreover, in adenocarcinomas, it was positively correlated to p16 and to the glucocorticoid receptor and inversely correlated to the MDM2 protein and to H3K4me3. Interestingly, immune infiltration was an independent positive prognosticator for disease free survival (DFS) in patients with squamous cell carcinomas, those bearing tumors with the strongest TIL infiltration showing the better DFS. Altogether, the present study provides a differentiated overview of the relations between TIL levels and prognosis in patients with cervix squamous cell carcinomas vs patients with cervix adenocarcinomas.

The survival analysis of the Cancer Genome Atlas (TCGA) dataset is a well-known method to discover the gene expression-based prognostic biomarkers of head and neck squamous cell carcinoma (HNSCC). A cutoff point is usually used in survival analysis for the patients' dichotomization in the continuous gene expression. There is some optimization software for cutoff determination. However, the software's predetermined cutoffs are usually set at the median or quantiles of gene expression value to perform the analyses. There are also few clinicopathological features available on their pre-processed data sets. We applied an in-house workflow, including data retrieving and pre-processing, feature selection, sliding-window cutoff selection, Kaplan-Meier survival analysis, and Cox proportional hazard modeling for biomarker discovery. In our approach for the TCGA HNSCC cohort, we scanned human protein-coding genes to find optimal cutoff values. After adjustment with confounders, the clinical tumor stage and the surgical margin involvement are independent risk factors for patients' prognosis. According to the resulting tables with Bonferroni-adjusted P value under the optimal cutoff and the hazard ratio, three biomarker candidates, CAMK2N1, CALML5, and FCGBP, are significantly associated with the patients' overall survival. We validated this discovery by using the other independent HNSCC dataset (GSE65858). Thus, we suggest the transcriptomic analysis could help for biomarker discovery.

The MAP kinase ERK5 contains an N-terminal kinase domain and a unique C-terminal tail including a nuclear localization signal and a transcriptional activation domain. ERK5 is activated in response to growth factors and stresses, and regulates transcription at the nucleus by either phosphorylation or interaction with transcription factors. MEK5-ERK5 pathway plays an important role regulating cancer cell proliferation and survival. Therefore, it is important to define the precise molecular mechanisms implicated in ERK5 nucleo-cytoplasmic shuttling. We previously described that the molecular chaperone Hsp90 stabilizes and anchors ERK5 at the cytosol, and that ERK5 nuclear shuttling requires Hsp90 dissociation. Here, we show that MEK5 or Cdc37 overexpression -mechanisms that induce nuclear ERK5- induced ERK5 SUMO-2 modification at residues Lys6/Lys22 in cancer cells. We also show that overexpression of the SUMO protease SENP2 completely abolished endogenous ERK5 nuclear localization in response to EGF stimulation. Furthermore, mutation of these SUMO sites abolished the ability of ERK5 to translocate to the nucleus and to promote prostatic cancer PC-3 cell proliferation. These results allow us to propose a more precise mechanism: in response to MEK5 activation, ERK5 SUMOylation favors the dissociation of Hsp90 from the complex, allowing ERK5 nuclear shuttling and activation of transcription.

Background: Factors that could predict which patients will benefit from Immune Checkpoint Inhibitors (ICIs) are not fully understood. This study aimed to investigate the prognostic value of KRAS biomarker in patients with advanced non-small cell lung cancer (NSCLC) in relation to clinical characteristics, treatment response and PDL1 expression. Patients and methods: The study included 100 patients with NSCLC who received immunotherapy with or without chemotherapy as 1st line treatment. In biopsy samples, the PDL1 biomarker expression rate and somatic mutations of KRAS gene were determined. Results: The mean age of the patients was 67 ± 8 years. Patients were all male and 66% were found with adenocarcinoma whereas 34% with squamous cell carcinoma. The KRAS G12C mutation was found with the highest percentage (73%). In the Kaplan-Meier survival analysis, patients with PDL1>49% in combination with a negative KRAS result had a median survival of 40 months compared to patients with a positive KRAS result (9 months, p<0.05). In addition, patients diagnosed with adenocarcinoma, PDL1<49% and negative KRAS result had a median survival of 39 months compared to patients with a positive result (28 months, p<0.05). Conclusions: Our study suggests that the presence of KRAS mutations in advanced NSCLC patients has a poor prognostic value, regardless of their PDL1 expression values, after receiving immunotherapy as first-line treatment.

Background Cancer is one of the most concerning public health issues in the world. One of cancer hallmarks wildly accepted is sustaining proliferative signaling, which involved most of the cell cycle biological activities. Centromeric histone, Centromere Protein A (CENPA), a variant of canonical histone H3, plays an essential role in selective chromosome segregation in the cell cycle. However, so far, a systematic pan-cancer bioinformatic analysis has not been done yet. Methods We accessed genome, transcriptome, and clinical information from open databases. The genetic alteration, mRNA expression, functional enrichment, stemness, mutation association, expression in cell populations and cellular locations, cell cycle association, survival association of CENPA, and immune association were analyzed. A prognostic model for glioma patients was constructed as an example application of CENPA as a biomarker. Drugs targeting CENPA in cancer cells were also screened and predicted by the CENPA correlation of drug sensitivity and protein-ligand docking. Results CENPA had low gene mutation in cancers. CENPA was overexpressed in almost all cancer types in TCGA compared to their normal control. CENPA was highly expressed in the nucleus of malignant cells. CENPA was associated with the cell cycle of cancer cells. CENPA is a biomarker for the cell cycle G2 phase in cancer cells. CENPA was a diagnostic and prognostic biomarker across multiple cancer types. The prognosis of glioma with CENPA was reliable and can be applied with other prognostic factors. CENPA was associated with the immune microenvironment. Drugs CD-437, 3-Cl-AHPC, Trametinib, BI-2536, and GSK461364 were predicted to target CENPA in cancer cells. Conclusion CENPA was a cell cycle biomarker in cancers with diagnostic and prognostic value.

Glioblastomas (GBM) are most common, primary brain tumors in adults. Despite advances in neurosurgery, radio- and chemotherapy, the median survival of GBM patients is 15 months. Recent large-scale genomic, transcriptomic and epigenetic analyses have shown the cellular and molecular heterogeneity of GBMs, which hampers the outcomes of standard therapies. We have established 13 GBM-derived cell cultures from fresh tumor specimens and characterized them molecularly using RNAseq, immunoblotting and immunocytochemistry. Evaluation of proneural (OLIG2, IDH1R132H, TP53 and PDGFRα), classical (EGFR) and mesenchymal markers (CHI3L1/YKL40, CD44 and phospho-STAT3), as well as expression of pluripotency (SOX2, OLIG2, NESTIN) and differentiation (GFAP, MAP2, β-Tubulin III) markers revealed the striking inter-tumor heterogeneity of primary GBM cell cultures. Upregulated expression of VIMENTIN, N-CADHERIN and CD44 at mRNA/protein levels suggested increased epithelial to mesenchymal transition (EMT) in most studied cell cultures. The effects of temozolomide (TMZ) or doxorubicin (DOX) were tested in three GBM-derived cell cultures with different methylation status of the MGMT promoter. Amongst TMZ- or DOX-treated cultures the strongest accumulation of apoptotic markers: caspase 7 and PARP were found in WG4 cells with methylated MGMT suggesting that its methylation status predicts vulnerability to both drugs. As many GBM-derived cells showed high EGFR levels, we tested the effects of AG1478, an EGFR inhibitor, on downstream signaling pathways. AG1478 caused decreased levels of phospho-STAT3, thus inhibition of active STAT3 augmented antitumor effects of DOX and TMZ in cells with methylated and intermediate status of MGMT. Altogether, our findings show that GBM-derived cell cultures mimic the considerable tumor heterogeneity and identifying patient-specific signaling vulnerabilities can assist in overcoming therapy resistance, by providing personalized combinatorial treatment recommendations.

Papillomaviruses infect the skin and mucosal surfaces of diverse animal hosts with consequences ranging from asymptomatic colonization to highly malignant epithelial cancers. Increasing evidence suggests a role for papillomaviruses in the most common cutaneous malignancy of domestic cats, squamous cell carcinoma (SCC). Using total DNA sequencing we identified a novel feline papillomavirus in a nasal biopsy taken from a cat presenting with both nasal cavity lymphoma and recurrent squamous cell carcinoma affecting the nasal planum. We designate this novel virus as Felis catus papillomavirus 6 (FcaPV6). The complete FcaPV6 7453 bp genome was similar to those of other feline papillomaviruses and phylogenetic analysis revealed that it was most closely related to FcaPV3, although was distinct enough to represent a new viral species within the genus Taupapillomavirus. Archived excisional biopsy of the SCC, taken 20 months prior to presentation, was intensely positive on p16 immunostaining. FcaPV6, amplified using virus-specific, but not consensus, PCR was the only papillomavirus detected in DNA extracted from the SCC. Conversely, renal lymphoma, sampled at necropsy two months after presentation, tested negative on FcaPV6-specific PCR. In sum, using metagenomics we demonstrate the presence of a novel feline papillomavirus in association with cutaneous squamous cell carcinoma.

Ovarian cancer poses a significant therapeutic challenge owing to the lack of specific targets for treatment. New treatment strategies are needed to improve patient outcomes and reduce the toxicity of existing therapies. This study aimed to investigate the synergistic effects of recombi-nant human apurinic/apyrimidinic endonuclease 1/redox factor 1 (rhAPE1/Ref-1) and aspirin on PEO14 and CAOV-3 ovarian cancer cells and human umbilical vein endothelial cells (HUVECs). Specifically, this study examined the mechanisms underlying the effect of rhAPE1/Ref-1 and as-pirin on cell death and the associated pathways. Cell viability was assessed using the MTT assay, and flow cytometry analysis and caspase-3/7 activity assays were conducted to determine apop-tosis. Western blotting was performed to evaluate the cleavage of poly(ADP-ribose) polymerase (PARP). Exposure to aspirin (3 mM) for 24 h did not affect cell viability in PEO14. Co-incubation of aspirin with rhAPE1/Ref-1 in PEO14 cells led to rhAPE1/Ref-1 acetylation and intracellular hyperacetylation. Co-treatment with aspirin (3 mM) and rhAPE1/Ref-1 induced a rhAPE1/Ref-1 concentration-dependent increase in cell death, particularly in PEO14 cells, as well as apoptosis, caspase-3/7 activation, and PARP cleavage. Furthermore, this combination treatment significantly increased paclitaxel-induced PEO14 cell death. Therefore, co-administration with rhAPE1/Ref-1 and aspirin is a potential strategy for ovarian cancer treatment.

High-grade gliomas are the most common and aggressive adult primary brain tumors with a median survival of only 12-15 months. Current standard therapy consists of maximal safe surgical resection followed by DNA-damaging agents, such as irradiation and chemotherapy that can delay but not prevent inevitable recurrence. Some have interpreted glioma recurrence as evidence of glioma stem cells which persist in a relatively quiescent state after irradiation and chemotherapy, before the ultimate cell cycle re-entry and glioma recurrence. Conversely, latent cancer cells with a therapy-induced senescent phenotype have been shown to escape senescence, giving rise to more aggressive stem-like tumor cells than those present in the original tumor. Therefore, approaches are needed to either eliminate or keep these glioma-initiating cells in a senescent state for a longer time to prolong survival. In our current study, we demonstrate that the radiation-induced cell cycle inhibitor P21 can provide a powerful route to induce cell death in short-term explants of PDXs derived from three molecularly diverse human gliomas. Additionally, cells not killed by P21 overexpression were maintained in a stable senescent state for longer than control cells. Collectively, these data suggest that P21 activation may provide an attractive therapeutic target to improve therapeutic outcomes.

(1) Background: Colon cancer is one of the leading causes of cancer morbidity and mortality globally. It is a multi-step process that involves genetic and epigenetic modifications leading to histological and morphological changes. Several complementary therapeutic options have been analyzed, shedding light on plant-based medication as a potential treatment for colon cancer. Flavonoids such as quercetin are known to have anti-cancer and anti-inflammatory properties. This in vitro study examines quercetin's anti-inflammatory, anti-apoptotic, anti-angiogenesis effects and antioxidant properties in colon cancer cells. (2) Methods: The antioxidant capacity of quercetin-treated cells was investigated using biochemical assays, and angiogenesis and cytokine levels were assessed using enzyme-linked immunosorbent assay (ELISA). The epigenetic modulation and differential expression of aging, apoptotic, and proliferation genes, and Histone deacetylases (HDACs) were also investigated. (3) Results: In this study, the quercetin-treated group significantly reduced the antioxidant enzymes, cytokines, and VEGF levels, altering the expression of epigenetic factors. Quercetin also induced significant senescence in colon cancer cells. Moreover, a considerable increase was observed in the apoptotic and hTERT genes. In contrast, a decrease in p53, proliferation genes, and HDACs was observed, providing a basis for the clinical use of quercetin in cancer treatment. (4) Conclusion: In vitro studies showed that quercetin treatment efficiently induces senescence and apoptosis in colon cancer cells. We also found that quercetin effectively modulated the expression of p53, Wnt1, CTNNB1, and HDACs, indicating that it could be used to treat colon cancer.

Cannabidiol (CBD) is an active diterpenoid compound that is extracted from the leaves and stem of Cannabis sativa. Previous studies show that CBD is a non-psychotropic compound with significant anti-cancer effects. This study determines its cytotoxic effect on oral cancer cells and OECM1 cells and compares the outcomes with a chemotherapeutic drug, cisplatin. This study determines the effect of CBD on the viability, apoptosis, morphology and migration of OECM1 cells. Electric cell-substrate impedance sensing (ECIS) is used to measure the change in cell impedance for cells that are treated with a series concentration of CBD for 24 hours. AlamarBlue and annexin V/7-AAD staining assays show that CBD has a cytotoxic effect on cell viability and induces cell apoptosis. ECIS analysis shows that CBD decreases the overall resistance and morphological parameters at 4 kHz in a concentration-dependent manner. There is a significant reduction in the wound-healing recovery rate for cells that are treated with 30 μM CBD. This study demonstrates that ECIS can be used for in vitro screening of anticancer drugs and is more sensitive, functional and comprehensive than traditional biochemical assays. CBD also increases cytotoxicity on cell survival and the migration of oral cancer cells, so it may be a therapeutic drug for oral cancer

Background: Interleukin (IL)-33 is a member of interleukin (IL)-1 family of cytokines which has been linked to the development of inflammatory conditions and cancer in the gastrointestinal tract. This study is designed to investigate whether IL-33 has direct effect on human gastric epithelial cells (GES-1) and on human gastric adenocarcinoma cell line (AGS) and gastric carcinoma cell line (NCI-N87), assessing its role in regulation of cell proliferation and cell cycle, apoptosis and necrosis. Cell cycle regulation was also determined in ex vivo gastric cancer samples obtained during endoscopy and surgical procedures. Methods: cell lines and tissue samples underwent stimulation with rhIL-33. Proliferation was assessed by XTT and CFSE assay, we also evaluated apoptosis by Caspase 3/8 Activity assay and Annexin V assays. Cell cycle were analyzed by means of Propidium Iodine assay and gene expression regulation was assessed by RT-PCR Profiling. Results: we found that IL-33 has an antiproliferative and proapoptotic effect on cancer cell line, while it can stimulate proliferation and reduce apoptosis in normal epithelial cell line. These effects are also confirmed by the analysis of cell cycle gene expression which showed a reduced expression of proproliferative genes in cancer cells, in particular genes involved in G0/G1 and G2/M checkpoint. These results are confirmed by the gene expression analysis on surgical and bioptic specimens. Conclusions: the aforementioned results indicate that IL-33 may be involved in cell proliferation in an environment- and cell type-dependent fashion.

Aims TRAIL is a promising anticancer agent that has the potential to sensitize a wide variety of cancer or transformed cells by inducing apoptosis. However, resistance to TRAIL is a growing concern. Current manuscript aimed to employing combination treatment to investigate resveratrol induced TRAIL sensitization in NSCLC. Method A549 and HCC-15 cells were used in experimental design. Cell viability was determined by morphological image, crystal violet staining and MTT assay. Apoptosis was evaluated by LDH assay, Annexin V and DAPI staining. Autophagy and apoptosis indicator protein were examined by western blotting. TEM and puncta assay were carried out to evaluate the autophagy. MTP and ROS activity were evaluated by JC-1 and H₂DCFDA staining. Findings Resveratrol is a polyphenolic compound capable of activation of tumor suppressor p53 and its pro-apoptotic modulator PUMA. Herein, we showed the p53-independent apoptosis by decrease the expression of phosphorylated Akt-mediated suppression of NF-κB that is also substantiated with the downregulation of anti-apoptotic factors Bcl-2 and Bcl-xl in NSCLC, resulting in an attenuation of TRAIL resistance in combined treatment. Furthermore, apoptosis was induced in TRAIL-resistant lung cancer cells with a co-treatment of resveratrol and TRAIL assessed by the loss of MMP, ROS generations which resulting the translocation of cytochrome c from the mitochondria into the cytosol due to mitochondrial dysfunction. Moreover, autophagy flux was not affected by resveratrol-induced TRAIL-mediated apoptosis in NSCLC. Significance Overall, targeting the NF-κB (p65) pathway via resveratrol attenuates TRAIL resistance and induces TRAIL-mediated apoptosis which could be the effective TRAIL-based cancer therapy regimen.

Biomarker directed selection of targeted anti-neoplastic agents such as immune check-point inhibitors, small molecule inhibitors and monoclonal antibodies form an important aspect of cancer treatment. Immunohistochemistry (IHC) analysis of the tumor tissue is the method of choice to evaluate the presence of these biomarkers. However, a significant barrier to biomarker testing on tissue is the availability of an adequate amount of tissue and need for repetitive sampling due to tumor evolution. Also, tumor tissue testing is not immune to inter- and intra-tumor heterogeneity. We describe the analytical and clinical validation of a Circulating Tumor Cell (CTC) assay to accurately assess the presence of PD-L1 22C3 and PD-L1 28.8, ER, PR and HER2, from patients with solid tumors to guide the choice of suitable targeted therapies. Analytically, the test has high sensitivity, specificity, linearity and precision. Based on a blinded case control study, the clinical sensitivity and specificity for PD-L1 (22C3 and 28.8) was determined to be 90% and 100% respectively. The clinical sensitivity and specificity was 83% and 89% for ER; 80% and 94% for PR; 63% and 89% for HER2 (by ICC); and 100% and 92% for HER2 (by FISH), respectively. The performance characteristics of the test support its suitability and adaptability for routine clinical use.

Epidemiological and clinical evidence have extensively documented the role of obesity in the develop-ment of endometrial cancer. However, the effect of fatty acids on cell growth in endometrial cancer has not been widely studied. Here we reported that palmitic acid significantly inhibited cell proliferation of endometrial cancer cells and primary cultures of endometrial cancer, and reduced tumor growth in a transgenic mouse model of endometrial cancer, in parallel with increased cellular stress and apoptosis and decreased cellular adhesion and invasion. Inhibition of cellular stress by N-acetyl-L-cysteine effec-tively reversed the effects of palmitic acid on cell proliferation, apoptosis and invasive capacity in the endometrial cancer cells. Palmitic acid increased the intracellular formation of lipid droplets in a time- and dose-dependent manner. Depletion of lipid droplets by blocking DGAT1 and DGAT2 effectively increased the ability of palmitic acid to inhibit cell proliferation and induce cleaved caspase 3 activity. Collectively, this study provides new insight into the effect of palmitic acid on cell proliferation, inva-sion and the formation of lipid droplets that may have potential clinical relevance in the treatment of obesity-driven endometrial cancer

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

HAX1 is a multifunctional protein involved in the antagonism of apoptosis in cellular response to oxidative stress. In the present study we identified HAX1 as novel binding partner for Che-1/AATF, a pro-survival factor which plays a crucial role in fundamental processes, including response to multiple stresses and apoptosis. HAX1 and Che-1 proteins show extensive colocalization in mitochondria and we demonstrated that their association is strengthened after oxidative stress stimuli. Interestingly, in MCF-7 cells, resembling luminal estrogen receptor (ER) positive breast cancer, we found that Che-1 depletion correlates with decreased HAX1 mRNA and protein levels, and this event is not significantly affected by oxidative stress induction. Furthermore, we observed an enhancement of the previously reported interaction between HAX1 and estrogen receptor alpha (ERα) upon H2O2 treatment. These results indicate the two anti-apoptotic proteins HAX1 and Che-1 as coordinated players in cellular response to oxidative stress with a potential role in estrogen sensitive breast cancer cells.

Waddington’s epigenetic landscape, a famous metaphor in developmental biology, depicts how a stem cell progresses from an undifferentiated phenotype to a differentiated one. The concept of “landscape” in the context of dynamical system theory represents a high-dimensional cell state space, in which each cell phenotype is considered as an “attractor” that is determined by interactions among multiple variables (molecular players), and is buffered against environmental fluctuations. Further, biological noise is thought to play an important role during these cell-fate decisions and in fact controls transitions between different phenotypes. Here, we discuss these phenotypic transitions in cancer from a dynamical systems perspective and invoke the concept of “cancer attractors” – hidden stable states of the underlying regulatory network that are not occupied by normal cells. Using epithelial-to-mesenchymal transition (EMT), cancer stem-like properties, metabolic reprogramming and the emergence of drug/hormone resistance as examples, we illustrate how phenotypic plasticity in cancer cells enables them to acquire hybrid phenotypes (such as hybrid epithelial/mesenchymal and hybrid metabolic phenotypes) that tend to be more aggressive and notoriously resilient to drug/hormone treatment. Furthermore, we highlight multiple factors that may give rise to phenotypic plasticity in cancer cells, such as (a) multi-stability or oscillatory behaviors governed by underlying regulatory networks involved in cell-fate decisions in cancer cells, and (b) network rewiring due to conformational dynamics of intrinsically disordered proteins (IDPs) that are highly enriched in cancer cells. We conclude by discussing why a therapeutic approach that promotes ‘recanalization’, i.e. the exit from “cancer attractors” and re-entry into “normal attractors”, is more likely to succeed rather than a conventional approach that targets individual molecules/pathways.

Cyclin E2, a member of the cyclin family, is a key cell cycle-related protein. This protein plays essential roles in cancer progression, and as such, an inhibitor of cyclin E2 has been approved to treat several types of cancers. Even so, mechanisms underlying how to regulate cyclin E2 expression in cancer remain largely unknown. The current study found that miR-3687 is up-regulated in clinical bladder cancer (BC) tumor tissues, TCGA database and human BC cell lines. Inhibition of miR-3687 expression significantly reduces human BC cell proliferation in vitro and tumor growth in vivo, which are concurrently with the induction of G0/G1 cell cycle arrest and downregulation of cyclin E2 protein expression. Interestingly, overexpression of cyclin E2 reversed the inhibition of BC proliferation induced by miR-3687. Mechanistic studies suggest that miR-3687 could bind to the 3'-UTR of foxp1 mRNA, downregulates FOXP1 protein expression, and in turn promotes the transcription of cyclin E2, thereby promoting the growth of BC cells. Collectively, the current study not only establishes a novel regulatory axis of miR-3687/FOXP1 in regard to regulation of cyclin E2 expression in BC cells, but also provides strong suggestive evidence that miR-3687 and FOXP1 may be potentially promising targets in therapeutic strategies of human BC.

The present work encompasses an application-oriented perspective to the possible employment of gold nanoparticles as nanomedicine in cancer therapeutics. The rationale of the work lies in the growing needs for assessment of advanced alternative treatment of cancer employing functionalized nanoparticles as nanomedicine. Gold nanoparticles fabricated via green chemistry methods by leaves of a time-honored medicinal plant, Piper betle were ascertained for their synthesis and properties under the umbrella of characterization of nanoparticles, through various techniques like UV-vis spectroscopy, FTIR spectroscopy, X-ray diffraction, and scanning electron microscopy. The cytotoxicity assay of well-characterized gold nanoparticles was monitored against lung cancer cell line (A549) by metabolic and imaging assays. MTT assay or the metabolic assay was performed for a range of nanoparticles’ concentrations. The results were promising and proved to be a leading-edge venture, envisaging the possibility of gold nanoparticles for cancer therapeutics.

Our recent studies showed that the treatment of human ovarian tumor cells with NCX4040 resulted in significant depletions of cellular glutathione, formation of reactive oxygen/nitrogen species and cell death. NCX4040 is also cytotoxic to several human colorectal cancer cells (CRC) in vitro and in vivo. Here, we have examined ferroptosis-dependent mechanism(s) of cytotoxicity of NCX4040 in HT-29 and K-RAS mutant HCT116 colon cell lines. Ferroptosis is characterized by accumulation of reactive oxygen species (ROS) within the cell, leading to an iron-dependent oxidative stress-mediated cell death. However, its relevance in the mechanism of NCX4040 cytotoxicity in CRC is not known. We found that NCX4040 generated ROS in CRC cells without any depletion of cellular GSH. Combinations of NCX4040 with erastin (ER) or RSL3 (RAS-selective lethal 3), known inducers of ferroptosis, enhanced CRC death. In contrast, ferrostatin-1, an inhibitor of ferroptosis, significantly inhibited NCX404-induced cell death. Treatment of CRC cells with NCX4040 resulted in induction of lipid peroxidation in a dose- and time-dependent manner. NCX4040 treatment induced several genes related to ferroptosis (e.g., CHAC1, GPX4 and NOX4) in both cell lines. Metabolomic studies also indicated significant increases in both lipid and energy metabolism following the drug treatment in HT-29 and HCT116 cells. These observations strongly suggest that NCX4040 causes ferroptosis-mediated cell death of CRC cells. Furthermore, combinations of NCX4040 and ER or RSL3 may contribute significantly for the treatment of CRC, including those that are difficult to treat due to the presence of Ras mutation in the clinic. NCX4040 induced ferroptosis may also be a dynamic form of cell death for the treatment of other cancers.

Chickpea is an essential legume, a staple food in many cultures and contains nutrients with potential health benefits. The chickpea water (CPW) leached out after cooking is usually discarded, which may potentially have significant anti-cancer and other health beneficial properties. This study compared the in-vitro bioactivity of CPW with chickpea polyphenol extract (CPPE) to evaluate its impact on pathways of colorectal cancer progression and development. Morphological observation by APOPercentage, cell viability detection using a cytotoxic assay and cell migration-scratch assay points to measure rate of metastasis were employed. Overall antioxidant activity of CPW and CPPE were measured using ABTS and DPPH free-radical assays. At 50 µg/mL concentration and above, both CPW and CPPE extracts significantly reduce cell viability in HT-29 colon cancer cell lines (p < 0.05). Moreover, a quantitative analysis of the extent of apoptosis demonstrated that at 250 and 500 μg/mL concentrations, both extracts induced significant apoptosis compared to the untreated control. Meanwhile, the cell migration scratch area decreases by 34.42% and 15.27% when treated with CPW and CPPE, respectively. In summary, CPW demonstrated comparable in vitro anti-cancer properties and antioxidant activity in colorectal cancer cells to CPPE. Further, in vivo studies are warranted to evaluate the physiological bioactivity of CPW and CPPE in targeting pathways of cancer development and progression

Does cell clustering influence intrinsic and acquired multi-drug resistance (MDR) differently? To address this question, we studied cultured monolayers (representing individual cells) and cultured spheroids (representing clusters) formed by drug-naïve (intrinsic MDR) and drug-exposed (acquired MDR) lines of ovarian cancer A2780 cells by cytometry of reaction rate constant (CRRC). MDR efflux was characterized by accurate and robust “cell number vs. MDR efflux rate constant (kMDR)” histograms. Both drug-naïve and drug-exposed monolayer cells presented unimodal histograms; the histogram of drug-exposed cells was shifted towards higher kMDR value suggesting greater MDR activity. Spheroids of drug-naïve cells presented a bimodal histogram indicating the presence of two subpopulations with different MDR activity. In contrast, spheroids of drug-exposed cells presented a unimodal histogram qualitatively similar to that of the monolayers of drug-exposed cells but with a moderate shift towards greater MDR activity. The observed greater effect of cell clustering on intrinsic than on acquired MDR can help guide the development of new therapeutic strategies targeting clusters of circulating tumor cells.

Fanconi anemia (FA) patients have an exacerbated risk of head and neck squamous cell carcinoma (HNSCC). Treatment is challenging as FA patients display enhanced toxicity to standard treatments, including radio/chemotherapy. Therefore better therapies as well as new disease models are urgently needed. We have used CRISPR/Cas9 editing tools in order to interrupt the human FANCA gene by the generation of insertions/deletions (indels) in exon 4 in two cancer cell lines from sporadic HNSCC having no mutation in FA-genes: CAL27 and CAL33 cells. Our approach allowed efficient editing, subsequent purification of single-cell clones, and Sanger sequencing validation at the edited locus. Clones having frameshift indels in homozygosis did not express FANCA protein and were selected for further analysis. When compared with parental CAL27 and CAL33, FANCA-mutant cell clones displayed a FA-phenotype as they i) are highly sensitive to DNA interstrand crosslink (ICL) agents such as mitomycin C (MMC) or cisplatin, ii) do not monoubiquitinate FANCD2 upon MMC treatment and therefore iii) do not form FANCD2 nuclear foci, and iv) they display increased chromosome fragility and G2 arrest after diepoxybutane (DEB) treatment. These FANCA-mutant clones display similar growth rates as their parental cells. Interestingly, mutant cells acquire phenotypes associated with more aggressive disease, such as increased migration in wound healing assays. Therefore, CAL27 and CAL33 cells with FANCA mutations are phenocopies of FA-HNSCC cells.

Background: Penile squamous cell carcinoma (PSCC) is classified into two prognostically distinct types: human papillomavirus (HPV)-associated and HPV-independent. Conversely, the impact of p53 status on prognosis remains controversial. We correlated HPV and p53 status with prognosis in a large series of PSCC patients. p53 was analysed according to a recently described immunohistochemical (IHC) pattern-based framework that includes two normal (scattered, mid-epithelial) and four abnormal patterns (diffuse, basal overexpression, cytoplasmic and null) and closely correlates with TP53 mutational status. Methods: A total of 122 patients with surgically treated PSCC in three hospitals in Barcelona, Spain, were included. Based on HPV in situ hybridization and p16 and p53 IHC expression, the tumors were classified into three molecular types: HPV-associated, HPV-independent/p53 normal, and HPV-independent/p53 abnormal. All patients were followed for at least 22 months (median 56.9 months), and disease-specific survival (DSS) was analysed. Results: Thirty-six tumors (29%) were HPV-associated, 35 (29%) were HPV-independent/p53 normal, and 51 (42%) were HPV-independent/p53 abnormal. Disease-related deaths were observed in 3/36 (8%), 0/35 (0%) and 14/51 (27%) of the patients, respectively (p&lt;0.001). A total of 7/14 deaths in the latter group were patients with tumors showing p53 patterns not recognized in the classical p53 IHC interpretation (basal, null, cytoplasmic). According to our multivariate analysis, HPV-independent/p53 abnormal tumors and advanced stage were associated with impaired DSS (hazard ratio=23.4, 95% confidence interval [CI]= 2.7-3095.3; p=0.001 and 16.3, 95% CI=1.8-2151.5; p=0.008, respectively). CONCLUSION: Compared with patients with HPV-associated and HPV-independent/p53-normal PSCC, patients with HPV-independent/p53 abnormal PSCC have worse clinical outcomes. p53 IHC results define two prognostic categories in HPV-independent PSCC: HPV-independent/p53-normal tumors as low-risk tumors, whereas HPV-independent/p53-abnormal tumors as aggressive neoplasms.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (&gt;2-fold, p&lt;0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (&gt;2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Lung cancer is the leading cause of cancer death worldwide, with non-small cell lung cancer (NSCLC) making up 80% of cases. Some genetic factors leading to NSCLC development include genetic mutations and PD-L1 expression. PD-L1 proteins are targeted in an NSCLC treatment called targeted gene therapy. However, this treatment is effective in a low percentage of patients. This study aimed to create machine learning models to use features like the number of mutations and the level of PD-L1 proteins in cancer cells, along with others, to predict whether a patient will receive clinical benefit from gene therapy treatment. This was done by downloading and merging datasets from cbioportal.org to create a sample size for the model. Features with high correlations to clinical benefit were identified. Three machine-learning models were created using these features to predict clinical benefits in patients, and each model’s accuracy was evaluated. All three models were accurate between 55-85%, with two of the models averaging an accuracy around 75%. Doctors can use these models to more accurately predict whether gene therapy treatment is likely to work in a patient before prescribing it to them.

Chondroitin sulfate (CS) proteoglycan 4 (CSPG4) is a cell surface proteoglycan that is currently under investigation as a marker of cancer malignancy, and as a potential target of anticancer drug treatment. CSPG4 acts as a driver of tumourigenesis by regulating turnover of the extracellular matrix (ECM) to promote tumour cell invasion, migration as well as inflammation and angiogenesis. While CSPG4 has been widely studied in certain malignancies, such as melanoma, evidence is emerging from global gene expression studies, which suggests a role for CSPG4 in squamous cell carcinoma (SCC). While relatively treatable, lack of widely agreed upon diagnostic markers for SCCs is problematic, especially for clinicians managing certain patients, including those who are aged or infirm, as well as those with underlying conditions such as epidermolysis bullosa (EB), for which a delayed diagnosis is likely lethal. In this review, we have discussed the structure of CSPG4, and quantitatively analysed CSPG4 expression in the tissues and pathologies where it has been identified. The aim of this review has been to collate the information available from functional studies and recent transcriptome analysis to determine the usefulness of CSPG4 expression as a diagnostic marker and therapeutic target in management of malignant SCC.

Brain cancer is the tenth leading cause of death in the U.S. Glioblastoma multiforme (GBM) is the most lethal primary malignant central nervous system tumor in adults. The present study employed samples from 1985-2014 to discover the difference in prognosis among glioblastoma subtypes after the evolution of treatment modalities over the past few years. The current study aims to find the differences between Glioblastoma multiforme (GBM) and giant cell glioblastoma (GCG) in terms of prognosis among adults and elderly patients in the U.S. This study is a historical cohort type of study and is conducted on adults and elderly individuals with GBM or GCG from the years 1985-2014 in the U.S. Data were collected from the Surveillance, Epidemiology, and End Results Program (SEER) database. The study exposure was GBM or GCG and the outcome was mortality. The potential confounders were age, sex, race, ethnicity, year of diagnosis, primary site, and surgery. A chi-square test was used for categorical data. A univariate analysis was used for variables having a p-value < 0.05. Potential confounders were selected and evaluated using multivariate logistic regression models to calculate the odds ratio with stepwise selection. The study sample was 25,117. The incidences of GBM and GCG were not similar in relation to age group. Also, Spanish-Hispanic ethnicity was independently protective of GBM and GCG as compared to Non-Spanish-Hispanic ethnicity patients with GBM have a higher mortality rate than do GCG patients. The mortality rate was higher among patients diagnosed before 2010. In conclusion, GCG was not statistically significant in association to reduced mortality. Non-Spanish-Hispanics with GBM or GCG had a higher mortality rate than did Spanish-Hispanics. Factors such as being female, being age >59, and having a year of diagnosis before 2010 were independently associated with increased mortality.

The delivery of Cytochrome c (Cyt c) to the cytosol stimulates apoptosis in cells were its release from mitochondria and apoptosis induction is inhibited. We developed a drug delivery system consisting of Cyt c nanoparticles decorated with folate-poly(ethylene glycol)-poly(lactic-co-glycolic acid)-thiol (FA-PEG-PLGA-SH) to deliver Cyt c into cancer cells and test their targeting in the Lewis Lung Carcinoma (LLC) mouse model. Cyt c-PLGA-PEG-FA nanoparticles (NPs) of 253 ± 55 and 354 ± 11 nm were obtained by Cyt c nanoprecipitation, followed by surface decoration with the co-polymer SH-PLGA-PEG-FA, and compared to a nanoparticle-free formulation. Overexpression of FA in LLC cells and internalization of Cyt c-PLGA-PEG-FA nanoparticles (NPs) was confirmed by confocal microscopy. Caspase activation assays show NPs retain 88-96% Cyt c activity. The NP formulations were more efficient in decreasing LLC cell viability than the NP-free formulation, with IC50: 49.2 to 70.1 μg/ml versus 129.5 μg/ml, respectively. Our NP system is thrice as selective towards cancerous than normal cells. In-vivo studies using tagged nanoparticles show accumulation in mouse LLC tumor 5 min post-injection. In conclusion, our NP delivery system for Cyt c shows superiority over the NP-free formulation and reaches a folic acid-overexpressing tumor in an immune-competent animal model.

Importance: The COVID-19 pandemic is currently accelerating. Patients with locally advanced non-small cell lung cancer (LA-NSCLC) may require treatment in locations where resources are limited and the prevalence of infection is high. Patients with LA-NSCLC frequently present with comorbidities that increase the risk for severe morbidity and mortality from COVID-19. These risks may be further increased by treatments for LA-NSCLC. Observation: We present expert thoracic oncology multidisciplinary (radiation oncology, medical oncology, surgical oncology) consensus of alternative strategies for the treatment of LA-NSCLC during a pandemic. The overarching goals of these approaches are to reduce the number of visits to a healthcare facility, reduce the risk of SARS-CoV-2 exposure, and attenuate the immunocompromising effects of lung cancer therapies. Patients with resectable disease can be treated with definitive non-operative management if surgical resources are limited or the risks of perioperative care are high. Non-operative options include chemotherapy, chemoimmunotherapy, and radiation therapy with sequential schedules. The order of treatments may be based on patient factors and clinical resources. Whenever radiation therapy is delivered without concurrent chemotherapy, hypofractionated schedules are appropriate. For patients who are confirmed to have COVID-19, usually cancer therapies may be withheld until symptoms have resolved with negative viral test results. Conclusions and Relevance: The risk of severe treatment-related morbidity and mortality is significantly elevated for patients undergoing treatment for LA-NSCLC during the COVID-19 pandemic. Adapting alternative treatment strategies as quickly as possible may save lives and should be implemented through communication with the multidisciplinary cancer team.

Recent advancements in molecular diagnostics have highlighted the potential of circulating cell-free DNA (ccfDNA) as a biomarker in various diseases. This study aims to explore the role of ccfDNA in the early diagnosis, prognosis, and therapeutic monitoring of diseases, with a focus on oncology. We conducted a comprehensive review and analysis of current literature, combined with experimental approaches involving advanced genomic sequencing and bioinformatics techniques. Our research systematically characterizes the molecular composition of ccfDNA, including its origins, size distribution, and methylation patterns, across different disease states. Furthermore, we investigate the dynamics of ccfDNA release and clearance in the bloodstream, elucidating mechanisms that could influence its diagnostic accuracy. In the context of cancer, we analyze the correlation between tumor-derived ccfDNA and disease progression, response to therapy, and overall survival. Our findings indicate that ccfDNA holds promise as a non-invasive biomarker for early disease detection, real-time monitoring of treatment efficacy, and potentially, predicting relapse. This study contributes to the growing field of liquid biopsies and opens new avenues for personalized medicine, emphasizing the need for standardized protocols in ccfDNA analysis to maximize its clinical utility. The implications of our findings extend beyond oncology, suggesting potential applications of ccfDNA in other pathological conditions.

Lung cancer is one of the most important health risks worldwide for human. Non-small cell lung cancer (NSCLC) is the most common cause of premature death from malignant disease. This study provides in-depth insights from systems biology analyses to identify molecular to inform systemic drug targeting in NSCLC. Gene expression profiles from non small cell lung cancer were analyzed with genome-scale biomolecular networks (I,e., protein-protein interaction, transcriptional and post transcriptional regulatory networks). The aim of the study was to determine the pathways and expression profile of the genes to discover molecular signature at RNA and protein levels which could serve as potential drug targets for therapeutics innovation and the identification of novel targets. Eight proteins, six TFs and seven miRNAs came into prominence as potential drug targets. The differential expression profiles of these reporter biomolecules were cross-validated by independent RNA-Seq and miRNA-Seq. Risk discrimination performance of the reporter biomolecules NPR3, JUN, PPARG, TP53, CKMT1A, SP3 and TFAP2A were also evaluated. Total 213 drugs and 7 proteins were found for non small cell lung cancer through dgidb. Among these identified drugs seven drugs such as- Gemcitabine, Carboplatin, paclitaxel, Docetaxel, Crizotinib, Bevacizumab and Gemcitabine is used for NSCLC which is approved by National Cancer Institute. The molecular signatures and repurposed drugs presented here permit further attention for experimental studies which are offer significant potential as biomarkers and candidate therapeutics for precision medicine approaches to clinical management of NSCLC.

The CCAAT/enhancer-binding protein β (C/EBPβ) is a transcription factor that regulates cellular proliferation, differentiation, apoptosis and tumorigenesis. Although the pro-oncogenic roles of C/EBPβ have been implicated in various human cancers, how it contributes to tumorigenesis or tumor progression has not been determined. Immunohistochemistry with human non-small cell lung cancer (NSCLC) tissues revealed that higher levels of C/EBPβ protein are expressed compared to normal lung tissues. Knockdown of C/EBPβ by siRNA reduced the proliferative capacity of NSCLC cells by delaying G₂/M transition of the cell cycle. In C/EBPβ-knockdown cells, a prolonged increase in phosphorylation of cyclin dependent kinase 1 at tyrosine 15 (Y15-pCDK1) was displayed with increased Wee1 and decreased Cdc25B expression, simultaneously. ChIP analysis showed that C/EBPβ bound to distal promoter regions of WEE1 and repressed WEE1 transcription through the interaction with histone deacetylase 2. Treatment of C/EBPβ-knockdown cells with a Wee1 inhibitor induced a decrease in Y15-pCDK1 and recovered cells from G₂/M arrest. In the xenograft tumors, the depletion of C/EBPβ significantly reduced tumor growth. Taken together, these results indicate that Wee1 is a novel transcription target of C/EBPβ that is required for the G₂/M phase of cell cycle progression, ultimately regulating proliferation of NSCLC cells.

Despite the recent availability of immune checkpoint inhibitors, not all patients affected by Non-Small Cell Lung Cancer (NSCLC) benefit from immunotherapy. The reason for this variability relies to a variety of factors which may allow the identification of novel biomarkers. Presently, a variety of biomarkers are under investigation, including the PD1/PDL1 axis, the tumor mutational burden, and the Microbiota. This latter is made by all bacteria and other microorganisms hosted in our body. The gut microbiota is the most represented and has been involved in different physiological and pathological events, including cancer. In this light, it appears that all conditions modifying gut microbiota can influence cancer, its treatment, and its treatment-related toxicities. The aim of this review is to analyze all conditions influencing the gut microbiota and, therefore, affecting response to immunotherapy, iRAEs and their management in NSCLC patients. The investigation of the landscape of these biological events can allow novel insights for optimal management of NSCLC immunotherapy.

The present studies were undertaken to address the role of fetuin-A in the growth and invasion potential in a triple negative breast cancer (TNBC) cell line, MDA-MB-468. Basal like TNBC that express high levels of ectopic fetuin-A have poorer prognosis for the patients compared to those that express low levels of the protein. We overexpressed fetuin-A in MDA-MB-468 and then determined the invasive potential of fetuin-A overexpressing cells vs controls transfected with empty vector. We also determined the adhesion and growth potential of the cells in the presence of only fetuin-A in serum free medium and also in complete medium. Our data suggest that fetuin-A overexpression significantly enhances the invasive potential of the cells and also the expression of Toll like receptor 4 (TLR4) on these cells. More importantly, the cells rely on fetuin-A-TLR4 signaling network for growth and invasion because the specific TLR4 inhibitor CLI-095 (resatorvid) abrogates fetuin-A mediated growth and invasion. Taken together, the data suggest that fetuin-A-TLR4 signaling network plays a significant role in the growth and invasion potential of TNBC.

We previously found a novel a new sirtuin (SIRT) inhibitor MHY2256 that exerts anticancer activity through p53 acetylation in MCF-7 human breast cancer cells. Here, we investigated the anticancer activity of MHY2256 against hormone-related cancer, which is an endometrial cancer with poor prognosis. We found that MHY2256 markedly reduced cellular proliferation at low concentrations against Ishikawa endometrial cancer cells. The IC50 values of MHY2256 were much lower than that of salermide. Furthermore, MHY2256 significantly reduced the protein expression and activities of SIRT1, 2, and 3 with similar effects as salermide, a well-known SIRT inhibitor. Particularly, MHY2256 markedly inhibited tumor growth in a tumor xenograft mouse model of Ishikawa cancer cells. During the experimental period, there was no significant change in the body weight of mice treated with MHY2256. Detailed analysis of the sensitization mechanisms of Ishikawa cells revealed that late apoptosis was largely increased by MHY2256. Additionally, MHY2256 increased G1 arrest and reduced cell cyclic-related proteins, suggesting that apoptosis by MHY2256 was achieved by cellular arrest. Particularly, p21 was greatly increased by MHY225656, suggesting that cell cycle arrest by p21 is a major factor in MHY2256 sensitization in Ishikawa cells. We also detected a significant increase in acetylated p53, a target protein of SIRT1, in Ishikawa cells after MHY2256 treatment. In a mouse xenograft model, MHY2256 significantly reduced tumor growth and weight without apparent side effects. These results suggest that MHY2256 exerts its anticancer activity through p53 acetylation in endometrial cancer and can be used for targeting hormone-related cancers.

Praeruptorin A(PA), a naturally existing pyranocumarin, is isolated from the dried root of Peucedanum praeruptorum Dunn. So far the anti-cancer effect and molecular mechanism behind Praeruptorin A action in human cervical cancer HeLa cells remain unknown. In the present study, we find that PA reduces cell proliferation and colony formation of human cervical cancer HeLa cells through inducing cell cycle arrest at G0/G1 phase. PA-upregulated p21 and p27 proteins are observed, accompanied with inhibition of cyclin D1 and S-phase kinase-associated protein 2(Skp2) proteins expression. PA could significantly inhibit migration and invasion of human HeLa cells. Meanwhile, PA significantly reduces invasive protein expression of matrix metalloproteinase-2 (MMP-2), and increases protein expression of tissue inhibitor of metalloproteinase-2 (TIMP-2). PA is observed to possess the capacity in suppressing ERK1/2 activation. PD98059 (ERK specific inhibitor) significantly enhances PA-induced downregulation of MMP-2 expression, and upregulation of TIMP-2 expression. Moreover, we found that PA treatment notably inhibits 12-O-tetradecanoylphorbol-13-acetate(TPA)-upregulated ERK1/2 activation, MMP-2 expression, cellular migration and invasion in human HeLa cells. Taken together, these findings are the first to demonstrate the anti-cancer activity of PA, which may act as a promising therapeutic agent for the treatment of human cervical cancer.

Background: Prostate cancer (PCa) is characterized by significant heterogeneity in its molecular, genomic, and immunologic characteristics. Methods: Whole transcriptome RNAseq data from The Cancer Genome Atlas of prostate adenocarcinomas (n=496) was utilized. The immune microenvironment was characterized using the CIBERSORTX tool to identify immune cell type composition. Unsupervised hierarchical clustering was performed based on immune cell type content. Analyses of progression-free survival (PFS), distant metastases, and overall survival (OS) were performed using Kaplan-Meier estimates and Cox-regression multivariable analyses. Results: Four immune clusters were identified, largely defined by plasma cell, CD4+ Memory Resting T Cells (CD4 MR), M0 and M2 macrophage content (CD4 MRHighPlasma CellHighM0LowM2Low, CD4 MRLowPlasma CellHighM0LowM2Low, CD4 MRHighPlasma CellLowM0HighM2Low, and CD4 MRHighPlasma CellLowM0LowM2High). The two macrophage-enriched/plasma cell non-enriched clusters (3&4) demonstrated worse PFS (HR 2.24, 95% CI 1.46–3.45, p=0.0002) than the clusters 1&2. No metastatic events occurred in the non-macrophage-enriched clusters. Comparing clusters 3 vs 4, in patients treated by surgery alone, cluster 3 had zero progression events (p<0.0001). However, cluster 3 patients had worse outcomes after post-operative radiotherapy (p=0.018). Conclusion: Distinct tumor immune clusters with a macrophage-enriched phenotype and reduced plasma cell enrichment independently characterize an aggressive phenotype in localized prostate cancer that may differentially respond to treatment.

Ovarian cancer is the common cause of death among gynecological cancers. Although ovarian cancer initially responds to chemotherapy, the frequent recurrence in patients remains a therapeutic challenge. Pyruvate kinase M2 (PKM2) plays a pivotal role in regulating cancer cell survival. However, its therapeutic roles remain unclear. Here, we investigated the anticancer effects of compound 3K, a specific PKM2 inhibitor, on autophagic and apoptotic pathway regulation in SK-OV-3 (PKM2-overexpressing human ovarian adenocarcinoma cell line). The anticancer effect of compound 3K was examined using the MTT and colony formation assay in SK-OV-3. The results of tissue microarray showed that PKM2 expression positively correlated with the severity of the tumor. Moreover, the expression of pro-apoptotic proteins increased in SK-OV-3 following compound 3K treatment. Compound 3K induced AMPK activation, which was accompanied by the inhibition of mTOR. Additionally, this compound inhibited glycolysis, resulting in reduced proliferation in SK-OV-3. Compound 3K treatment suppressed tumor progression in vivo xenograft model. Our findings suggest that the inhibition of PKM2 by compound 3K affected Warburg effects and induced autophagic cell death. Therefore, the use of specific PKM2 inhibitors to block the glycolytic pathway and target cancer cell metabolism represents a promising therapeutic approach for treating PKM2-overexpressing ovarian cancer.

Background. Currently, most of the research in breast cancer has been carried out in conventional two-dimensional (2D) cell culture due to its practical benefits, however, the three-dimensional (3D) cell culture is becoming the model of choice in cancer research because it allows cell-cell and cell-extracellular matrix (ECM) interactions, mimicking the native microenvironment of tumors in vivo. Methods. in this work, we evaluated the effect of 3D cell organization on the expression pattern of miRNAs (by Small-RNAseq) and mRNAs (by microarrays) in the breast cancer SKBR3 cell line and analyzed the biological processes and signaling pathways regulated by the differ-entially expressed protein-coding genes (DE-mRNAs) and miRNAs (DE-microRNAs) found in the organoids. Results. We obtained well-defined cell-aggregated organoids with a grape cluster-like morphology with a size up to 9.2×105 μm3. The transcriptomic assays showed that cell growth in organoids significantly affected (all p < 0.01) the gene expression patterns of both, miRNAs and mRNAs, finding 20 upregulated and 19 downregulated DE-microRNAs, as well as 49 upregulated and 123 downregulated DE-mRNAs. In silico analysis showed that a subset of 11 upregulated DE-microRNAs target 70 downregulated DE-mRNAs. These genes are involved in 150 gene on-tology (GO) biological processes such as regulation of cell morphogenesis, regulation of cell shape, regulation of canonical Wnt signaling pathway, morphogenesis of epithelium, regulation of cy-toskeleton organization, as well as in the MAPK and AGE-RAGE signaling KEGG-pathways. In-terestingly, hsa-mir-122-5p (Fold Change (FC)=15.4), hsa-mir-369-3p (FC=11.4), and hsa-mir-10b-5p (FC=20.1) regulated up to the 81 % of the 70 downregulated DE-mRNAs. Conclu-sion, the organotypic 3D cell-organization architecture of breast cancer SKBR3 cells impacts the expression pattern of miRNAs-mRNAs network mainly through overexpression of hsa-mir-122-5p, hsa-mir-369-3p, and hsa-mir-10b-5p. All these findings suggest that the interaction between cell-cell and cell-ECM as well as the change in the culture architecture impacts gene ex-pression, and therefore, support the pertinence of migrating breast cancer research from conven-tional cultures to 3D models.

Cancer immunotherapy reaches a remarkable achievement in various cancer types and brings new possibilities to improve cancer patients’ long-term survival. However, outcomes vary from case to case, and the present protocol benefits a small fraction of patients. One notable factor is the tumor microenvironment, especially the immune cell components, that may reflect the immune response's status quo on site. Thus, understanding the content of infiltrating immune cells in tumors is not only for research interesting but also a crucial subject toward precision medicine. We implement an algorithm for resolving relative proportions of twenty-one immune cell subclasses from a human tissue profiled transcriptome by microarray technology to reach the goal above. By selecting gene features and then adopting ?-Support Vector Regression, we can construct a deconvolution model and resolve the immune cell context. The excellent consistency between the estimated values and the correct immune-cell composition further demonstrates this approach provides a more natural alternative to revealing samples' immune cell content and reliable results like recent single-cell technologies. Based on this algorithm, the web-based deconvolution tool implemented named mySORT provides a user-friendly interface for estimating the immune cell content by uploading gene expression profiling. We also present comprehensive visualization 2D/3D plots in mySORT so that users can easily make a comparison between different samples. Finally, we synthesized pseudo-bulk expression data from single-cell transcriptomic datasets of 17 melanoma and 16 head and neck cancer patients. The deconvolution results of microarray-based data in the previous study and synthetic pseudo-bulk data all proved the excellent performance of mySORT. We believe that mySORT can help researchers in all fields easily understand complex immune microenvironment. The website of mySORT is freely accessible on https://symbiosis.iis.sinica.edu.tw/mySORT/.

The increased expression of β4-galactosyltransferase (β4GalT) 4 was closely associated with poor prognosis of colon cancer. Recently, we showed that the expression of the β4GalT4 gene is regulated by the 0.17 kb core promoter region containing one binding site for Specificity protein 1 (Sp1). To develop a novel screening method for anti-colon cancer drugs, two sensor cell lines having the luciferase gene under the control of two β4GalT4 gene promoters that differed in length were established from SW480 human colon cancer cells. The hGT4-0.17-sensor cells possessed the luciferase reporter driven by the 0.17 kb promoter, while the hGT4-0.3-sensor cells possessed the luciferase reporter driven by the 0.3 kb promoter containing one binding site each for colon cancer-related transcription factors including activator protein 2, E2F, caudal-related homeobox transcription factors, and Runt-related transcription factors besides Sp1. Upon treatment with mitogen-activated protein kinase inhibitor U0126, the promoter activities of the hGT4-0.3-sensor cells decreased significantly, while those of the hGT4-0.17-sensor cells unchanged. These results suggest that the responsiveness to U0126 differs between two sensor cell lines due to the different regulation of the luciferase reporters. This study provides the novel screening method for anti-colon cancer drugs by the combination of two sensor cell lines.

The aim of this research was to evaluate the essential oil of Cymbopogon schoenanthus (L.) Spreng. (C. schoenanthus) from Burkina Faso in cytotoxic activity against LNCaP cells, derived from prostate cancer, and HeLa cells, derived from cervical cancer. Antioxidant activities were evaluated in vitro. Essential oil (EO) was extracted by hydrodistillation and analyzed by GC / FID and GC / MS. Thirty-seven compounds were identified, the major compounds being piperitone (49.9%), alpha terpinene isomer (24.02%), elemol (5.79%) and limonene (4.31%). EO exhibited a poor antioxidant activity, as shown by the inhibition of DPPH radicals (IC50 =1730 ± 80 µg/mL) and ABTS+. (IC50 = 2890 ± 26.9 µg/mL). Conversely, EO decreased the proliferation of LNCaP and HeLa cells with respective IC50s of 135.53 ± 5.27 µg/mL and 146.17 ± 11 µg/mL. EO also prevented LNCaP cell migration and led to the arrest of their cell cycle in the G2/M phase. Altogether, this work points out for the first time that EO of C. schoenanthus from Burkina Faso could be an effective natural anticancer agent.

Locally advanced rectal cancer (LARC) has traditionally been treated with trimodality therapy consisting of neoadjuvant radiation +/- chemotherapy, surgery and adjuvant chemotherapy. There is currently a clinical need for biomarkers to predict treatment response and outcomes, especially during neoadjuvant therapy. Liquid biopsy in the form of circulating tumour cells (CTCs) and circulating nucleic acids in particular microRNAs (miRNA) are novel, highly stable and clinically relevant regulators of disease. We studied a prospective cohort of 52 patients with LARC, and obtained samples at baseline, during treatment, and post-treatment. We enumerated CTCs during chemoradiation at these three time-points, using the IsofluxTM CTC Isolation and detection platform. We then subjected the isolated CTCs to miRNA expression analyses, using a panel of 106 miRNA candidates. We identified CTCs in 73% of patients at baseline, and numbers fell during treatment and miRNA expression profiles also changed during treatment. Between baseline and during treatment (week 3) time-points three microRNAs (hsa-miR-95, hsa-miR-10a and hsa-miR-16-1*) were highly differentially expressed. Importantly, hsa-miR-19b-3p and hsa-miR-483-5p were found to correlate with good response to treatment. The latter (hsa-miR-483-5p) was also found to be differentially expressed between good responders and poor responders. They represent potential predictive biomarkers and a potential miRNA-based treatment strategy. In this study, we demonstrate that CTCs are present and can be isolated in the non-metastatic early stage cancer setting, and their associated miRNA profiles can potentially be utilized to predict treatment response.

The advent of immunotherapy has revolutionized the treatment of advanced non-small cell lung cancer (NSCLC), improving the prognosis of this disease and becoming a key part of the treatment, especially in the population without an oncogenic driver mutation. Two different groups of immune checkpoint inhibitors (ICIs) are used in lung cancer: Anti- Cytotoxic T-lymphocyte antigen-4 (Anti-CTLA 4) and Anti- T-cell receptor programmed cell death-1 or its ligand (Anti-PD-1 and Anti PD-L1). Here in, we review an uptodate on the use of immunotherapy for advanced NSCLC.

Significant recent advances in cancer immunotherapeutics include the vaccination of cancer patients with tumor antigen-associated peptide-pulsed dendritic cells (DCs). DC vaccines with homogeneous, mature, and functional activities are required to achieve effective acquired immunity; however, the yield of autologous monocyte-derived DCs varies in each patient. Priming with a low dose of recombinant human granulocyte colony-stimulating factor (rhG-CSF) 16–18 h prior to apheresis resulted in 50% more harvested monocytes, with a significant increase in the ratio of CD11c+CD80+ DCs/apheresed monocytes. The detection of antigen-specific cytotoxic T lymphocytes after Wilms’ tumor 1-pulsed DC vaccination was higher in patients treated with rhG-CSF than those who were not, based on immune monitoring using tetramer analysis. Our study is the first to report that DC vaccines for cancer immunotherapy primed with low-dose rhG-CSF are expected to achieve higher acquired immunogenicity.

Background: One of the most astounding discoveries of recent times is the recognition that cancer embodies a transition from a higher level of metazoan cell organization to a more foundational pre-metazoic state. This shift is steered by genes housed within the ancestral genome compartment, pervasive across all metazoan genomes, encompassing humans, and governed by a pre-metazoic gene regulatory mechanism (aGRN). This work aims to highlight the emerging field of evolutionary cancer cell biology (ECCB), which points to the deep homology between cancer and protist life cycles tracing back to the common ancestor of amoebozoans, metazoans, and fungi (AMF). The ECCB analysis reveals the essence of the non-gametogenic germline of the AMF ancestor, which serves as a blueprint for all metazoan germlines and stem cell lineages and controls the life cycle of cancer. Every germ and stem cell lineage of humans and metazoans traces its lineage back to this Urgermline, transmitting crucial processes such as asymmetric cell cycling, differentiation, stemness, and phenomena like GST and SGT (aka EMT and MET) to their subsequent evolutionary descendants. Oxygen-sensitive germline and stem cells suffer DNA-DSB due to stress and oxygen ranges reminiscent of ancestral hyperoxia, leading to cell senescence. Cells that can overcome senescence can proliferate as DSCD cells with defective symmetric cell division, paving the way for malignancy and PGCC cancers. Conclusions: Understanding cancer from its evolutionary origins may help break some of the logjams in cancer prevention and open up new therapeutic pathways.

Head and neck squamous cell carcinoma (HNSCC) takes the sixth place among the most common cancers in the world. Abnormal methylation can be one of the reasons for this cancer. The aim of this study was to investigate the DNA promotor methylation status of cancer-associated genes (ATM, APC, CDO1, RB1, TP53, WIF1) in patients with HNSCC. Bisulfite Conversion and Methylation-Sensitive High-Resolution Melting was used for analysis of the DNA methylation level of normal and tumor tissues in 44 patients. There were significant differences in DNA methylation level between patient’s tumor and normal tissues for CDO1 and WIF1 genes in all subjects and subgroups (p<0.05). In T3 subgroup there was significant correlation between CDO1 gene methylation and age in the normal tissue. The same correlation was detected also for the WIF1 gene methylation in tumor tissue samples in the subgroup with T3 and in normal tissue samples in the subgroup with T4 (p<0,05). In all genes no significant differences were found between the subgroups (T2, T3, T4 stage, primary/recurrent lesion, non-keratinizing/keratinizing SCC, age before/ after 50, smokers/non-smokers) of the patients. Thus, changes in the expression of the CDO1 and WIF1 genes can affect mechanisms of the occurrence and development of HNSCC.

Abstract: (1) Background: Cancer immune escape is associated with the metabolic reprogramming of TME, and combining metabolic targets with immunotherapy has great potential to improve clinical outcomes. Among all metabolic processes, lipid metabolism, especially fatty acid (FA) metabolism, has a huge role in cancer cell survival, migration, and proliferation, but its mechanism and role in the tumor immune microenvironment remain to be investigated. (2) Methods: We comprehensively analyzed 309 fatty acid-related genes, screened 121 different genes, and used one-way COX regression to select 15 genes with prognostic impact. Systematically evaluated the correlation between FMGs modification patterns and Tumor Microenvironment Infiltration, prognosis, and Immunotherapy. The FMGs-Score was constructed to quantify the FMGs modification patterns using principal component analysis. (3) Results: Three clusters based on FMGs-related genes were demonstrated in breast cancer, with three patterns of distinct immune cell infiltration and biological behavior. An FMGsScore signature was constructed to reveal that patients with a low FMGsScore had higher immune checkpoint expression, higher immune checkpoint inhibitor (ICI) scores, increased immune microenvironment infiltration, better survival advantage, and were more sensitive to immunotherapy than those with a high FMGsScore. Finally, the expression and function of the signature key gene NDUFAB1 were examined by in vitro experiments. (4) Conclusions: This study significantly demonstrates the non-negligible role of FMGs in the immune microenvironment of breast cancer, and that FMGsScores can be used to guide the prediction of immunotherapy in breast cancer patients. In in vitro experiments, knockdown of the NDUFAB1 gene resulted in reduced proliferation and migration of MCF-7 cell lines.

RAD51 is a recombinase that plays a pivotal role in homologous recombination. Although the role of RAD51 in homologous recombination has been extensively studied, it is unclear whether RAD51 can be involved in gene regulation as a co-factor. In this study, we found in silico evidence that RAD51 may contribute to the regulation of genes involved in the autophagy pathway through interaction with E-box proteins such as USF1, USF2, and/or MITF in GM12878, HepG2, K562, and MCF-7 cell lines. The canonical USF binding motif (CACGTG) was significantly identified at RAD51 binding sites in all four cell lines. In addition, genome-wide USF1, USF2, and/or MITF-binding regions significantly coincided with the RAD51-binding sites in the same cell line. Interestingly, the promoters of genes associated with the autophagy pathway were significantly occupied by RAD51 in all four cell lines. Taken together, these results predicted a novel role of RAD51 that had not been addressed previously, and provided evidence that RAD51 could possibly be involved in regulating genes associated with the autophagy pathway, through interaction with E-box binding proteins.

In patients with presumed pancreatic ductal adenocarcinoma (PDAC), biomarkers that may open for personalised, risk-adapted treatment are lacking. The study analysed the impact of circulating tumour cells (CTCs) on the patterns of recurrence and survival in 98 patients resected for PDAC with 5-10 years of follow-up. Preoperative samples were analysed by the CellSearch® system for EpCAM+/DAPI+/CK+/CD45- CTCs. CTCs were detected in 7 of the 98 patients. CTCs predicted a significantly shorter median DFS of 3.3 vs. 9.2 months and a median CSS of 6.3 vs. 18.5 months. Relapse status was confirmed by imaging for 87 patients. Of these, 58 developed distant metastases (DM) and 29 cases isolated local recurrence (ILR) as first event. All patients with CTCs experienced DM. pN-status and histological grade &gt;2 were other independent risk factors for DM, but only CTCs predicted significantly shorter cancer-specific, disease-free and post-recurrence survival. We conclude that CTC presence in resected PDAC patients predicted early distant metastasis and impaired survival. The impact of CTCs was comparable to that of histopathological risk factors and exceeded the effect size of other preoperative parameters. Thus, preoperative CTCs alone or in combination with histopathological factors may guide initial treatment decisions in patients with resectable PDAC in the future.

Background: Cutaneous squamous skin cell carcinoma (SCC) is the second most frequent type of non- melanoma skin cancer and the second cause of death by skin cancer in caucasian population. However, at present it is difficult to predict patients with worst SCC prognosis. Objective: To identify proteins whose expression level could predict SCC infiltration in SCC arising from actinic keratosis (AC). Methods: A total of 20 biopsies of 20 different patients were studied, 10 were from SCC-AK samples and 10 from normal skin. Early infiltrated SCC-AK were selected on histological examination and to determine the expression of proteins fresh skin samples were processed by 2DE-electrophoresis Results: The expression levels of three proteins namely alpha-hemoglobin, heat shock protein (Hsp)-27 and 70 were significantly increased in SCC-AK samples with respect to normal control skin. However, only the expression level of Hsp70 protein positively correlated with the level of SCC-AK dermis infiltration. Immnunohistological examination suggested that the increased expression of Hsp70 proteins seems to mainly occur in the keratinocytes cytoplasm. The increased cytoplasmic Hsp70 expression in SCC-AK was confirmed by Western-blot experiments. Conclusion: Cytoplasmic expression of Hsp70 could be potential biomarker of early infiltration of SCC arising from an AK. Keywords: actinic keratosis, cutaneous squamous cell carcinoma; cytoplasm, skin cancer; heat shock protein.

Vascular cell adhesion molecule-1 (VCAM-1) is closely associated with tumor progression and metastasis. However, the relevance and role of VCAM-1 in lung cancer have not been clearly elucidated. In this study, we found that VCAM-1 was highly overexpressed in lung cancer tissue compared with that of normal lung, and high VCAM-1 expression correlated with poor survival of lung cancer patients. VCAM-1 knockdown reduced invasion in A549 human lung cancer cells, and competitive blocking experiments targeting the Ig-like domain 6 of VCAM-1 (VCAM-1-D6) demonstrated that the VCAM-1-D6 domain was critical for VCAM-1-mediated A549 cell invasion. Next, we developed a human monoclonal antibody specific to human and mouse VCAM-1-D6 (VCAM-1-D6 huMab), which was isolated from a human synthetic antibody library using phage display technology. Finally, we showed that VCAM-1-D6 huMab had a nanomolar affinity for VCAM-1-D6 and that it potently suppressed invasion in A549 and NCI-H1299 lung cancer cell lines. Taken together, these results suggest that VCAM-1-D6 is a novel therapeutic target in VCAM-1-mediated lung cancer invasion and that our newly developed VCAM-1-D6 huMab will be a useful tool for inhibiting VCAM-1-expressing lung cancer cell invasion.

Keywords: head-and-neck cancer; chemoradiation; cisplatin; carboplatin; loco-regional control; metastases-free survival; overall survival; toxicity.

Abstract: Epigenetic approaches in direct correlation with assessment of critical genetic mutations in non-small cell lung cancer (NSCLC) are currently very intensive, as the epigenetic components in NSCLC development and progression have attained high recognition. In this level of research, established human NSCLC cell lines as well as experimental animals are widely used to detect novel biomarkers and pharmacological targets to treat NSCLC. The epigenetic background of NSCLC is highly complex and requires precise definition as these phenomena are variable between NSCLC subtypes and systems origin. We engaged an in-depth characterization of non-coding (nc)RNAs prevalent in human KRAS-mutant NSCLC cell lines A549 and H460 and mouse KRAS-mutant NSCLC tissue by Next Generation Sequencing (NGS) and quantitative Real Time PCRs (qPCRs). Also, the effect of transcription factor (TF) LRF, a known epigenetic silencer, was examined on the epigenome modulation. Finally, interacting networks underlying epigenetic variations in NSCLC subtypes were created. Data derived from our study highlights the divergent epigenetic profiles of NSCLC of human and mouse origin, as well as the significant contribution of 12qf1: 109,709,060-109,747,960 mouse chromosomal region to micro-RNA upregulated species. Fur-thermore, the novel epigenetic miR-148b-3p/PVT1/ZBTB7A axis was identified, which differentiates lung adenocarcinoma from large cell lung carcinoma, two characteristic NSCLC subtypes. The detailed recording of epigenetic events in NSCLC and combinational studies including networking between ncRNAs and TFs validate the identification of significant epigenetic features, prevailing in NSCLC subtypes and among experimental models. Our results enrich knowledge in the field and empower research on the epigenetic prognostic biomarkers of the disease and patient-tailored treatments.

Patient-derived tumor organoids (PDTOs) are a novel preclinical model of non-small cell lung cancer (NSCLC) for studying tumor biology and precision medicine, which recapitulates tumor morphology and gene expression profile. However, some issues such as low establishment rates, long-term production, and the loss of the immune microenvironment have hindered their widespread practical use. In this study, we investigated the efficacy of a recently introduced free-floating organoid production method to address these issues. The free-floating approach provided PDTO establishment success rate of over 90 % resulting in organoid formation within a short period of one week. These organoids retained the elements of the parental tumor morphology and contained stroma and immune cell populations, as confirmed by flow cytometry analysis. Importantly, we found that the cytokine and growth factor expression profiles of the free-floating organoids correlated with those of the original tumors in 58 % of cases, indicating the preservation of tumor-associated signaling pathways. Obtained organoids exhibited different responses to anticancer chemotherapeutics that might be a result of variable expression of drug resistance-associated genes. Considering the high establishment rate and short time of free-floating organoid production, this technique provides a valuable tool for a more accurate evaluation of therapeutic strategies and cancer biology studies.

Background: PD1 and its ligand PD-L1 are related to the prognosis in many solid tumors, whether its role in oral squamous cell carcinoma (OSCC) remains unclear. Methods: Retrospective monocentric study including all patients with OSCC diagnosed and treated between 01/2020 and 05/2022. PD-L1 expression was assessed by combined positive score (CPS), considering CPS > or equal to 1 as positive (1-20 “low expression”, and ≥20 “high”). Descriptive analysis of patient cohort and tumors was performed, including tumor size, stage, lymph node involvement, recur-rence and survival. Results: 65 patients (65 tumors) were analyzed. 66.15% of tumors were ad-vanced stages (III-IV), of them, 97.67% PD-L1+ versus 71.42% within early stages (I-II). T4 tumors expressed PD-L1 in 100% of cases, compared with 54’54% in T1 tumors. 50.79 % of tumors showed lymph node involvement (pN+), 100% of them showing PD-L1+. Prevalence of pN+ was 59.38% for PD-L1 high expression versus 40.63% for low expression. Patients' follow-up ranged from 2 to 34.5 months. No significant difference was seen between overall survival (OS) and PD-L1 +/- (CPS ≥1 vs CPS <1) neither PD-L1 high (CPS ≥20) vs low CPS <20) (p 0.97 and 0.64, re-spectively). Conclusions: The method used to measure (laboratory test with Dako 22C3 an-ti-PD-L1 primary antibody) PD-L1 was reliable and accurate, with a correlation coefficient be-tween the PD-L1 expression in the biopsy and surgical piece of 0.83 (p 0.0001). CPS≥1 was ob-served in large tumors (p<0.001), and was correlated with of lymph node metastases (p<0.004). Further analysis of PD-L1 expression and its relevance in tumor biology and prognosis is needed.

Objective: The aim of our study was to perform a retrospective analysis of the volume of cervical screening tests, the number of patients treated with an excision method, and the incidence of invasive and non-invasive cervical during a pandemic and pre-pandemic period of 24 months. Results: There was a statistically significant age difference between the two study periods, both by the average age of patients and by age group. The mean difference was 32 years before the pan-demic and 35 years during the pandemic (p-value >0.05). The majority of patients presenting for investigations before and during the pandemic were in the 30-39-year-old age group (31.95%, respectively; 34.2% (p-value = 0.003). The biggest patient loss ratio identified by age group was in the 50–59 years: 14,53% in the pre-pandemic period and 9,1% in the pandemic period. In the pan-demic period, patients from rural areas presented in the clinical trial with a lower rate of 39.52% (83 patients) vs. 60.47% (127 patients) in urban areas. A higher percentage of patients experiencing cervicorrhagia as a clinical manifestation in the pandemic period vs. the prepandemic period, with an increase in more severe lesions in the pandemic period, has a statistical significance of 8% more newly diagnosed compared to the pre-pandemic period. Conclusion: The addressability of the patients during the COVID period was not affected in a drastic way in our study. We encountered a decrease in appointments in the age group 50–59 years and a decrease in patients with rural residence. In our study, we found an increase in cervicorrhagia as a reason for consultation in the pandemic period with a higher lesion degree, both on a pap smear and on a cervical biopsy.

Different prognostic scores have been applied to identify patients with non-small cell lung cancer who have a higher probability of poor outcome. In this study we evaluated whether Naples Prognostic Score, a novel index which considers both inflammatory and nutritional values, was associated with long-term survival. The study is a retrospective propensity score matching analysis of patients who underwent curative surgery for non-small cell lung cancer from January 2016 to December 2021. The score considered four pre-operative parameters: neutrophil to lymphocyte ratio, lymphocyte to monocyte ratio, serum albumin and total cholesterol. Kaplan-Meier method and Cox regression analysis were performed to evaluate the relation between the score and disease-free survival, overall survival and cancer-related survival. A total of 260 patients were selected for the study, reduced to 154 after propensity score matching. Post-propensity Kaplan-Meier analysis showed a significant correlation between Naples Prognostic Score and overall survival (p=0.018) and cancer-related survival (p=0.007). Multivariate Cox regression analysis further validated the score as an independent prognostic indicator for both these survivals (p=0.007 and p=0.010 respectively). Naples Prognostic Score proved to be an easily achievable prognostic factor of long-term survival in patients with non-small cell lung cancer after surgical treatment.

Non-Small Cell Lung Cancer (NSCLC) is the most common pulmonary malignancy, most frequently diagnosed at an advanced stage (III/IV). Patients in the Locally-Advanced Stage Subgroup (IIIA) are relatively few, yet compose of heterogenic phenotypes posing a diagnostic and treating challenge, leading to lack of clinical guidelines regarding the optimal standard of care. Several approaches exist, with a general agreement that a combined oncological and surgical modality approach is required. In this current retrospective descriptive study, operable Stage IIIA NSCLC patients who underwent surgery between 2013-2020 were evaluated on several aspects, including initial diagnosis, neoadjuvant regimens, outcomes of surgical intervention, overall survival at 2-years and 5-years following treatment. A total of 35 patients had neoadjuvant oncological treatment (mostly chemoradiation therapy) prior to surgery, out of which 28 patients were diagnosed with Stage IIIA NSCLC. In post-operative assessment of pathological staging, downstaging was reported in 20 patients, of which 7 (25%) cases were defined as complete pathological response. The 2-years overall survival rate was 65% and the 5-years overall survival rate was 60%. The main pattern of disease recurrence was distant metastasis.

Testicular granulosa cell tumors (TGCTs) are rare tumors of sex cord stromal origin. TGCTs can be classified into the adult type and the juvenile type. The adult type is extremely rare with only 93 known cases reported in the literature. We, herein, present a report of a case of a 30 year old male patient who presented with a testicular mass, underwent radical inguinal orchiectomy and the pathology examination revealed an adult type granulosa tumor. We additionally review the literature to summarize the scientific knowledge of an entity barely described worldwide.

In this study, we propose a radiomics-clinical probability weighted model for the prediction of prognosis for NSCLC. The model combines radiomics features extracted from RT planning images with clinical factors such as age, gender, histology, and tumor stage. CT images with radiotherapy structures of 422 NSCLC patients were retrieved from The Cancer Imaging Archive (TCIA). Radiomic features were extracted from gross tumor volume (GTV). Five machine learning algorithms, namely decision trees (DT), random forests (RF), extreme boost (EB), support vector machine (SVM) and generalized linear model (GLM), were optimized by a voted ensemble machine learning (VEML) model. A probabilistic weighted approach is used to incorporate the uncertainty associated with both radiomic and clinical features and to generate a probabilistic risk score for each patient. The performance of the model is evaluated using a receiver operating characteristic (ROC). Radiomic model, clinical factors model and combined radiomic-clinical probability weighted model demonstrated good performance in predicting NSCLC survival with AUC of 0.941, 0.856 and 0.949 respectively. The combined radiomics-clinical probability weighted enhanced model achieved significantly better performance than radiomic model in 1-year survival prediction (chi-square test, p<0.05). The proposed model has the potential to improve NSCLC prognosis and facilitate personalized treatment decisions.