Hepatocellular carcinoma (HCC) is a heterogeneous malignancy with complex carcinogenesis. Although there has been significant progress in the treatment of HCC over the past decades, drug resistance to chemotherapy remains a major obstacle in its successful management. In this study we were able to reduce chemoresistance in cisplatin-resistant HepG2 cells by either silencing the expression of transglutaminase type 2 (TG2) using siRNA or by pre-treatment of cells with the TG2 enzyme inhibitor cystamine. Further analysis revealed that, whereas the full-length TG2 isoform (TG2-L) was almost completely cytoplasmic in its distribution, the majority of the short TG2 isoform (TG2-S) was membrane-associated in both parental and chemoresistant HepG2 cells. Following induction of cisplatin toxicity in non-chemoresistant parental cells, TG2-S together with cisplatin quickly relocated to the cytosolic fraction. Conversely, no cytosolic relocalisation of TG2-S or nuclear accumulation cisplatin was observed following identical treatment of chemoresistant cells, where TG2-S remained predominantly membrane-associated. This suggests that deficient subcellular relocalisation of TG2-S from membranous structures into the cytoplasm may limit the apoptic response to cisplatin toxicity in chemoresistant cells. Structural analysis of TG2 revealed the presence of binding motifs for interaction of TG-S with the membrane scaffold protein LC3/LC3 homologue that could contribute to a novel mechanism of chemotherapeutic resistance in HepG2 cells.

A key component of efforts to identify the biological and drug-specific aspects that contribute to therapeutic failure or unexpected exposure-associated toxicity is the study of drug-intestinal barrier interactions. While methods supporting such assessments are widely described for human therapeutics, there is relatively little information available for similar evaluation in support of veterinary pharmaceuticals. There is, therefore, a critical need to develop novel approaches for evaluating drug-gut interactions in veterinary medicine. Three-dimensional (3D) organoids can address these difficulties in a reasonably affordable system that circumvents the need for more invasive in vivo assays in live animals. However, a first step in the development of such systems is understanding organoid interactions in a 2D monolayer. Given the importance of orally administered medications for meeting the therapeutic need of companion animals, we demonstrate growth conditions under which canine colonoid-derived intestinal epithelial cells survive, mature, and differentiate into confluent cell systems with high monolayer integrity. We further examine the applicability of this canine colonoid-derived 2D model to assess the permeability of three structurally diverse, passively absorbed β-blockers (e.g., propranolol, metoprolol, and atenolol). Both absorptive and secretive apparent permeability (Papp) of these drugs at two different pH conditions were evaluated in canine colonoid-derived monolayers and were compared with that of Caco-2 cells. This proof-of-concept study provides promising preliminary results with regard to the utility of canine-derived organoid monolayers for species-specific assessments of therapeutic drug passive permeability.

G‐quadruplexes (G4) are structures formed at the ends of the telomere, these are rich in guanines and were stabilized by molecules that bind to specific sites. TMPyP4 and Thymoquinone (TQ) are small molecules that bind to the G4, they have drawn attention because of their role as telomerase inhibitors. The aim of this study was to evaluate the effects of telomerase inhibitors on cellular proliferation, senescence, and death. Two cell lines LC‐HK2 (NSCLC) and RPE‐1 were treated with TMPyP4 (5μM) and TQ (10μM). Both inhibitors were effective in decreasing telomerase activity. TMPyP4 increased the percentage of cells with membrane damage associated with cell death and decreased the frequency of cells in the S‐phase. TMPyP4 changed the cell adhesion ability and modified the pattern of focal adhesion. TQ acted in a dose‐dependent manner, increasing the frequency of senescent cells, and inducing cell cycle arrest in the G1. In conclusion, the effects of both drugs on LC-HK2 and RPE-1 cell lines were different although both are telomerase inhibitors, because TMPyP4 decreased proteins of cell adhesion and TQ induces a decrease in cell viability.

High hepcidin is linked to low-grade inflammation and lower iron levels. The consequence of testosterone replacement therapy (TRT) on inflammation and risk of cardiovascular disease (CVD) is undetermined. We investigate the effect of TRT on the inflammatory cardiovascular risk markers hepcidin-iron, fibroblast growth factor 23 (FGF23)-phosphate-klotho, and calprotectin pathways. Methods: A randomized, placebo-controlled, double-blinded study at an academic tertiary-care medical center. Interventions were testosterone gel (TRT, n=20) or placebo gel (n=19) for 24 weeks. We included 39 men (50─70 years) with type 2 diabetes (T2D) on metformin monotherapy with bioavailable testosterone levels <7.3 nmol/L. Body composition was assessed by DXA- and MRI-scans; main study outcomes were serum hepcidin-iron, FGF23, phosphate, klotho, and calprotectin. Results: Hepcidin levels decreased during TRT (β=-9.5 ng/mL, P<0.001), lean body mass (β=1.9 kg, P=0.001) increased, and total fat mass (β=-1.3 kg, P=0.009) decreased compared to placebo. Delta hepcidin was not associated with changes in lean body mass or fat mass. Iron and the pathways of FGF23-phosphate-klotho and calprotectin were unchanged during TRT. Conclusions: During TRT, the reduction in hepcidin was not associated with circulating iron levels, lean body mass, or fat mass; these findings suggested a direct anti-inflammatory effect of TRT and no indirect effect mediated through these factors.

Hypercholesterolemia is a major risk for the development of cardiovascular diseases (CVDs), the main cause of mortality worldwide, and it is characterized by high levels of circulating cholesterol. The drugs currently available for hypercholesterolemia control have several side effects, so it is necessary to develop new effective and safer therapies. Seaweeds serve as sources of several bio-active compounds with claimed beneficial effects. Eisenia bicyclis (Aramé) and Porphyra tenera (Nori) are edible seaweeds which were previously recognized as rich in bioactive compounds. In the present study, we aim to evaluate the anti-hypercholesterolemia effect of these two seaweeds ex-tracts and their health potential. Both extracts, but more efficiently Aramé extract demonstrated to have liver 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) inhibitory activity and to reduce approximately 30 % cholesterol permeation through human Caco-2 cells simulating the intestinal lining, targets for hypercholesterolemia treatments. An untargeted metabolomic assay on human intestinal Caco-2 and liver Hep-G2 cells lines exposed to Aramé and Nori extracts revealed changes in the cell’s metabolism as indicators of the extract’s health beneficial effects. The metabolic pathways affected by exposure to both extracts were associated to lipid metabolism, such as phospholipids, and fatty acid metabolism, pathways of amino acid, cofactors and vitamins and cellular respiration metabolism. More profound for Aramé treated cells, but also seen for Nori ex-posed cells, the metabolites modifications were associated with the protection against CVDs and other diseases and, to the improvement of cells oxidative stress tolerance. The results obtained for the anti-hypercholesterolemia properties, in addition to the revelation of the positive impact on cells metabolism, are an important contribution for further evaluation of these seaweeds extracts as functional foods or for CVDs prevention.

High blood cholesterol levels are one of the main risks for atherosclerotic disease. A purified aqueous extract of Fucus vesiculosus, characterized as rich in phlorotannins and peptides, was described as having the capacity to inhibit cholesterol biosynthesis and intestinal absorption. In this work, the effect of this extract on intestinal cells metabolites and proteins was analysed, aiming to expand the knowledge about its mode of action targeting cholesterol metabolism, in particular exogenous cholesterol absorption and transport. Caco-2 cells differentiated into enterocytes were exposed to the purified aqueous extract of F. vesiculosus and analysed by undirected metabolomics and proteomics. The results of the metabolomic analysis showed only statistically significant differences in glutathione content of the cells exposed to the extract relatively to the control cells, with a decreased glutathione expression in exposed cells. The proteomic analysis showed an increased expression for cells exposed to the extract of NPC1, an important protein known to be involved in cholesterol transport. To extent of our knowledge this is the first study using untargeted metabolomics and proteomic analysis to study the effect of F. vesiculosus on differentiated Caco-2 cells, which aims to provide some insight about the molecular mechanism of extract compounds on intestinal cells.

In the present study, linear novel polymer poly(1-(2-((3-amino-2-hydroxypropyl)amino)ethyl)-1'-ethyl-[4,4'-bipyridine]-1,1'-di-ium) (poly(AHAEBD)) and its complex with iron (ΙΙΙ) ([Fe(poly(AHAEBD)2].Na3) were synthesized and then their anticancer effects on A375 human malignant melanoma cells line were evaluated. The structure of the synthesized compounds was confirmed using Fourier transform infrared spectroscopy (FT-IR), nuclear magnetic resonance spectroscopy (1HNMR), field emission scanning electron microscopy (FE-SEM), X-ray energy diffraction analysis (EDS) and gel permeation chromatography (GPC). Also, the cytotoxicity of cisplatin as a reference, on A375 melanoma cell line was tested. The IC50 of polymer-complex [Fe(poly(AHAEBD)2].Na3 (0.71 µg/mL), cisplatin (4.58 µg/mL) and poly(AHAEBD) (1.73 µg/mL) were obtained. Our results revealed that the polymer-complex [Fe(poly(AHAEBD)2].Na3 exhibited better performance compared to cisplatin. Furthermore, the coordination with iron (III) enhanced the cytotoxicity levels of poly(AHAEBD). According to these findings, the synthesized polymer-complex demonstrates remarkable potential as an anti-cancer agent. This study could provide the basis for future research focused on employing this new polymer-complex for in vivo testing, highlighting its potential for therapeutic applications.

The probiotic bacterial strain Lactobacillus plantarum ZS2058 has been proved to manifest comprehensive functions, which were due to ability to synthesise conjugated fatty acids (CFAs). To investigate the specific functions of CFAs produced by this probiotic bacterium, α-linolenic acid was isomerized by Lactobacillus plantarum strain ZS2058, and two different conjugated α-linolenic acid (CLNA) isomers were successfully isolated. These isoforms, CLNA1 (c9, t11, c15-CLNA, purity 97.48%) and CLNA2 (c9, t11, t15-CLNA, purity 99.00%), both showed the ability to inhibit the growth of three types of colon cancer cells in a time- and concentration-dependent manner. In addition, the expression of MDA in Caco-2 cells was increased by CLNA1 or CLNA2, which indicated lipid peroxidation was related to the antiproliferation activity of CLNAs. Examination of the key protein of pyroptosis showed that CLNA1 induced the cleavage of caspase-1 and gasdermin-D, while CLNA2 induced the cleavage of caspase-4, 5 and gasdermin-D. The addition of relative inhibitors could alleviate the pyroptosis by CLNAs. CLNA1 and CLNA2 showed no effect on caspase-3, 7, 9 and PARP-1, which were key proteins associated with apoptosis. And no sub-diploid apoptotic peak appeared in the result of PI single staining test. In conclusion, CLNA1 activated caspase-1 and induced Caco-2 cell pyroptosis, whereas CLNA2 induced pyroptosis through the caspase-4/5-mediated pathway. The inhibition of Caco-2 cells by the two isomers was not related to apoptosis. This is the first report showing the ability of CLNAs to activate antioxidant defenses resulting in pyroptosis.

IIAEK (Ile-Ile-Ala-Glu-Lys, lactostatin) is a novel pentapeptide from bovine milk β-lactoglobulin which lowers cholesterol levels. However, the molecular mechanisms underlying the suppression of intestinal cholesterol absorption by IIAEK are unknown. Therefore, we evaluated the effects of IIAEK on intestinal cholesterol metabolism in Caco-2 cells in a human intestinal model. We found that IIAEK significantly reduced the expression of intestinal cholesterol metabolism-associated genes, particularly that of the ATP-binding cassette transporter A1 (ABCA1) protein. Subsequently, we chemically synthesized a novel molecular probe, IIXEK, which can visualize a complex of target proteins interacting with photoaffinity-labeled IIAEK by fluorescent substances. Photoaffinity labeling and MS analysis with IIXEK for the rat small intestinal mucosa and intestinal lipid raft fractions of Caco-2 cells, we identified intestinal alkaline phosphatase (IAP) as a specific molecule interacting with IIAEK and discovered IIAEK common binding amino acid sequence, GFYLFVEGGR. Transfection of IAP siRNA counteracted the decrease in ABCA1 mRNA levels in Caco-2 cells. IIAEK significantly increased IAP mRNA and protein levels, and significantly decreased ABCA1 mRNA and protein levels in Caco-2 cells. In conclusion, we found that IIAEK targets IAP to improve cholesterol metabolism via a novel signaling pathway with a specific activation of IAP and down-regulation of intestinal ABCA1.

Iron and zinc are essential micronutrients required for growth and health. Deficiencies of these nutrients are highly prevalent among populations, but can be alleviated by supplementation. Cross-sectional studies in humans showed positive association of serum zinc levels with hemoglobin and markers of iron status. Dietary restriction of zinc or intestinal specific conditional knock out of ZIP4 (SLC39A4), an intestinal zinc transporter, in experimental animals demonstrated iron deficiency anemia and tissue iron accumulation. Similarly increased iron accumulation has been observed in cultured cells exposed to zinc deficient media. These results together suggest a potential role of zinc in modulating whole body iron metabolism. Studies in intestinal cell culture models demonstrate that zinc induces iron uptake and transcellular transport via induction of divalent metal iron transporter-1 (DMT1) and ferroportin (FPN) expression, respectively. It is interesting to note that intestinal cells are exposed to very high levels of zinc through pancreatic secretions, which is a major route of zinc excretion from the body. Therefore, zinc appears to be modulating the iron metabolism possibly via regulating the DMT1 and FPN1 levels. Herein we critically reviewed the available evidence to hypothesize novel mechanism of Zinc-DMT1/FPN axis in regulating intestinal iron absorption and tissue iron accumulation to facilitate future research aimed at understanding the yet elusive mechanisms of iron and zinc interactions.

This study aimed to compare three different extracts of Saco sweet cherry, namely non-coloured fraction, coloured fraction and total extract concerning phenolic composition, antioxidant and antidiabetic potential, erythrocytes’ protection and effects on Caco-2 cells. A total of 22 phenolic compounds were identified by LC-DAD. Hydroxycinnamic acids were the most predominant in both non-coloured fraction and total extract, while cyanidin-3-O-rutinoside was the main anthocyanin found in the coloured fraction. The total extract was the most effective against DPPH, nitric oxide and superoxide radicals, and in the inhibition of α-glucosidase enzyme. Finally, the protective effect of the extracts to prevent oxidative damage in human erythrocytes was assessed. The coloured fraction revealed the best activity against hemoglobin oxidation and hemolysis. Regarding to Caco-2 cells, the coloured extract exhibited the most cytotoxic effects, while the total extract was the most efficient in protecting these cells against oxidative damage induced by t-BHP.

(1) Background: In this work, a series of benzimidazole derivatives containing colchicine-like and cathechol-like moieties with methyl group substitution in the benzimidazole ring were evaluated for their in vitro antiproliferative, pro-apoptotic and antioxidative activity against highly invasive breast cancer cell line MDA-MB-231 and related impairment of tubulin dynamics; (2) Methods: MTT assay was used to evaluate the antiproliferative activity. In vitro tubulin polymerization assay as well as docking analysis was applied to prove the alterations in tubulin polymerization. Immunofluorescent and DAPI staining reveal the pro-apoptotic potential of benzimidazole derivatives and the effect on tubulin’s dynamics in living cells. The antioxidant activity was evaluated by scavenging of H2O2 and hypochlorite ion and ortho-phenanthroline tests; (3) Results: The compounds containing colchicine-like moiety displayed significant growth inhibitory effect against cancer cell line as was highlighted the role of methyl functional group on the tubulin aggregation and blockage of mitosis. All compounds showed an ability to scavenge H2O2, while the compounds with cathecol-like moiety were more effective against hypochlorite ion and chelation of iron; (4) Conclusions: The benzimidazole derivative containing colchicine-like moiety and methyl group substitution in benzimidazole ring is a potential antiproliferative and microtubule destabilizing agent.

The Coronavirus disease 2019 (COVID-19) pandemic began in Jan. 2020 in Wuhan, China with a new coronavirus designated SARS-CoV-2. The principle cause of death from COVID-19 disease quickly emerged as Acute Respiratory Distress Syndrome (ARDS). A key ARDS pathogenic mechanism is the “Cytokine Storm”. This is a dramatic increase in the blood of inflammatory cytokines. In the last 2 years of the pandemic new pathology has emerged in COVID-19 survivors in which a variety of long-term symptoms emerge. This condition is called “Long COVID”. The spike protein on the surface of the virus (target for the new mRNA/DNA vaccines) is composed of joined S1-S2 subunits. Upon S1 bind-ing to the human ACE2 receptor on cells, the S1 subunit is cleaved and the S2 subunit me-diates entry of the virus. The S1 protein is then released into the blood, which might be one of the pivotal triggers for initiation and/or perpetuation of the cytokine storm. In this study, we tested the hypothesis that the spike S1 protein may activate inflammatory sig-naling and cytokine production independent of the virus. Our data support a potential role for spike S1 activation of inflammatory signaling and cytokine production in human lung and intestinal epithelial cells in culture. These data support a potential role for the SARS-CoV-2 spike S1 protein in COVID-19 pathogenesis.

Escherichia coli and Shigella are common diarrhea-causing pathogens in children and adults. Enteroinvasive Escherichia coli (EIEC) shares a similar pathogenic mechanism with Shigella. However, EIEC are less virulent than Shigella. The aim of this work was to get a better understanding of the virulence differences between EIEC and S. flexneri. We investigated i) the bacterial gene co-expression networks (GCNs) and ii) the the transcriptional modules (WGCNA) of Caco-2 cells infected with EIEC or with S. flexneri during a three-hour period of bacterial infection. The GCN analysis showed that EIEC and S. flexneri networks presented different topologies. Additionally, the EIEC network revealed that pINV genes are not connected with chromosomal genes. WGCNA and eigengene analysis showed enterocyte gene expression variation along the three-hour bacterial post-infection period. Additionally, at one-hour post-infection EIEC induced a higher number of gene expression changes in Caco-2 cells than S. flexneri. Several of these genes are involved in autophagy. This study showed that the lower virulence of EIEC is associated with a lack of functional cooperation between pINV and chromosomal genes, differently from what was observed in S. flexneri. Consequently, EIEC becomes less efficient in subverting host-cell bacterial recognition as well as defense mechanisms such as autophagy.

This study investigated the roles of low-molecular-weight fucoidan (LMWF) in enhancing the anti-cancer effects of fluoropyrimidine-based chemotherapy. HCT116 and Caco-2 cells were treated with LMWF and 5-FU. Cell viability, cell cycle, apoptosis, and migration were analyzed in both cell types. Potential mechanisms underlying how LMWF enhances the anti-cancer effects of fluoropyrimidine-based chemotherapy were also explored. The cell viability of HCT116 and Caco-2 cells was significantly reduced after treatment with a LMWF-5-FU combination. In HCT116 cells, LMWF enhanced the suppressive effects of 5-FU on cell viability through the 1) induction of cell cycle arrest in the S phase and 2) late apoptosis mediated by the Jun-N-terminal kinase (JNK) signaling pathway. In Caco-2 cells, LMWF enhanced the suppressive effects of 5-FU on cell viability through both c-mesenchymal–epithelial transition (MET)/ Kirsten Rat Sarcoma virus (KRAS)/ extracellular signal-regulated kinase (ERK) and c-MET/ phosphatidyl-inositol 3-kinases (PI3K)/ protein kinase B (AKT) signaling pathways. Moreover, LMWF enhanced the suppressive effects of 5-FU on tumor cell migration through the c-MET/ matrix metalloproteinase (MMP)-2 signaling pathway in both HCT116 and Caco-2 cells. Our results demonstrated that LMWF is a potential complementary therapy for enhancing the efficacies of fluoropyrimidine-based chemotherapy in colorectal cancers (CRCs) with the wild-type or mutated KRAS gene through different mechanisms. However, in vivo studies and in clinical trials are required to validate the results of the present study.

Prebiotic oligosaccharides are widely used as human and animal feed additives for their beneficial effects on the gut microbiota. However, there are limited data to assess the direct effect of such functional foods on the transcriptome of intestinal epithelial cells. The purpose of this study is to describe the differential transcriptomes and cellular pathways of colonic cells directly exposed to galacto-oligosaccharides (GOS) and fructo-oligosaccharides (FOS). We have examined the differential gene expression of polarized Caco-2 cells treated with GOS or FOS and their respective mock-treated cells using mRNA sequencing (RNA-seq). A total of 89 significant differentially expressed genes were identified between GOS and mock-treated groups. For FOS treatment, a reduced number of 12 significant genes were observed to be differentially expressed relative to the control group. KEGG and Gene Ontology functional analysis revealed that genes up-regulated in the presence of GOS were involved in digestion and absorption processes, fatty acids and steroids metabolism, potential antimicrobial proteins, energy-dependent and -independent transmembrane trafficking of solutes and amino acids. Using our data, we have established complementary non-prebiotic modes of action for these frequently used dietary fibers.

Biofilm formation and lipopolysaccharide (LPS) are implicated in the pathogenesis of gastrointestinal (GI) diseases caused by Gram-negative such as Escherichia coli and Salmonella enterica serovar Typhimurium. Grape seeds, wine industry by-products, have antioxidant, antimicrobial, and anti-inflammatory activities. In the present study, the protective effect of procyanidin-rich grape seed extract (prGSE), from unfermented pomace of Vitis vinifera cv Bellone, on bacterial LPS-induced oxidative stress and epithelial barrier integrity damages has been studied in a model of Caco-2 cells. The in vitro activity of prGSE against formation of biofilm of S. Typhimurium and E. coli, has been investigated. In vivo, prGSE activity using infected Galleria mellonella larvae has been evaluated. The results showed that the prGSE, if administered with LPS, can significantly reduce the LPS-induced permeability alteration. Moreover, the ability of the extract to prevent Reactive Oxygen Species (ROS) production induced by LPS treatment of Caco-2 cells has been demonstrated. prGSE inhibited the biofilm formation of E. coli and S. Typhimurium. In in vivo activity, increased survival of infected G. mellonella larvae after treatment with prGSE has been demonstrated. In conclusion, grape seed extracts could be used in the reduction of GI damage caused by bacterial endotoxin and biofilm of Gram-negative bacteria.

Background/methods: For mechanistic studies, in vitro human B cell differentiation and generation of plasma cells are invaluable techniques. However, the heterogeneity of both T cell-dependent (TD) and T cell-independent (TI) stimuli and the disparity of culture conditions used in existing protocols makes interpretation of results challenging. The aim of the present study was to achieve the most optimal B cell differentiation conditions using isolated CD19⁺ B cells and PBMC cultures. We addressed multiple seeding densities, different durations of culturing and various combinations of TD stimuli and TI stimuli including B cell receptor (BCR) triggering. B cell expansion, proliferation and differentiation was analyzed after 6 and 9 days by measuring B cell proliferation and expansion, plasmablast and plasma cell formation and immunoglobulin (Ig) secretion. In addition, these conditions were extrapolated using cryopreserved cells and differentiation potential was compared. Results: This study demonstrates improved differentiation efficiency after 9 days of culturing for both B cell and PBMC cultures using CD40L and IL-21 as TD stimuli and 6 days for CpG and IL-2 as TI stimuli. We arrived at optimized protocols requiring 2500 and 25.000 B cells per culture well for TD and TI assays, respectively. The results of the PBMC cultures were highly comparable to the B cell cultures, which allows dismissal of additional B cell isolation steps prior to culturing. In these optimized TD conditions, the addition of anti-BCR showed little effect on phenotypic B cell differentiation, however it interferes with Ig secretion measurements. Addition of IL-4 to the TD stimuli showed significantly lower Ig secretion. The addition of BAFF to optimized TI conditions showed enhanced B cell differentiation and Ig secretion in B cell but not in PBMC cultures. With this approach, efficient B cell differentiation and Ig secretion was accomplished when starting from fresh or cryopreserved samples. Conclusion: Our methodology demonstrates optimized TD and TI stimulation protocols for more indepth analysis of B cell differentiation in primary human B cell and PBMC cultures while requiring low amounts of B cells, making them ideally suited for future clinical and research studies on B cell differentiation of patient samples from different cohorts of B cell-mediated diseases.

Clonal evolution and cellular plasticity are the genetic and non-genetic driving forces of tumor heterogeneity that in turn determines the tumor cell response towards therapeutic drugs. Sever-al lines of evidence suggest that therapeutic interventions foster the selection of drug resistant neural crest stem-like cells (NCSCs) that establish minimal residual disease (MRD) in melano-ma. Here we established a dual reporter system enabling the tracking of NGFR expression and mRNA stability, providing insights into the maintenance of NCSC-states. We observed that the transcriptional reporter that contained a 1kb fragment of the human NGFR promoter was acti-vated only in a minor subset (0.72±0.49%, range 0.3-1.5) and ~2-4% of A375 melanoma cells re-vealed stable NGFR mRNA. The combination of both reporters provided insights into pheno-type switching and revealed that both cellular subsets gave rise to cellular heterogeneity. Moreover, whole transcriptome profiling and gene set enrichment analysis (GSEA) of the minor cellular subset revealed hypoxia-associated genes serving as potential drivers of a NGFR-associated phenotype switching in vitro and in relapsed, post-BRAF inhibitor treated tu-mors. Concordantly, we observed that the minor cellular subset increased in response to dabrafenib over time. In summary, our reporter-based approach provided insights into plastici-ty and identified a cellular subset that might be responsible for the establishment of MRD in melanoma.

The present study aimed to analyze novel mechanisms underlying Nrf2-mediated anti-apoptosis in periodontal ligament stem cells (PDLSCs) in the periodontitis oxidative microenvironment. We created an oxidative stress model with H2O2-treated PDLSCs. Herein, we used real-time PCR, western blotting, TUNEL staining, fluorogenic assay and transfer genetics to confirm the degree of oxidative stress and apoptosis as well as the Nrf2 function. Surprisingly, we demonstrated that with up-regulated ROS and MDA levels, the effect of oxidative stress was obvious under H2O2 treatment. Anti-oxidative molecules were changed after the H2O2 exposure, whereby the anti-oxidative signaling of Nrf2 was activated with the increase of its downstream effectors, HO-1, NQO1 and γ-GCS. Additionally, the apoptosis levels gradually increased with oxidative stress and changes in the caspase-9, caspase-3, Bax and c-Fos levels, but not with caspase-8 and down-regulated Bcl-2. The enhanced antioxidant effect could not resist the occurrence of apoptosis. Furthermore, Nrf2 overexpression effectively improved the anti-oxidative levels and increased cell proliferation. At the same time, overexpression effectively restrained TUNEL staining and decreased the molecular levels of caspase-9, caspase-3, et al, but not that of caspase-8. By contrast, silencing the expression Nrf2 levels had the opposite effect. Collectively, Nrf2 alleviates PDLSCs via its effects on anti-oxidative and anti-intrinsic apoptosis by the activation of anti-oxidative enzymes.

The treatment of viral infections is challenging owing to the intricate structure and metabolism of the viruses. In addition, they can highjack host cellular metabolism, mutate and adapt to harsh environmental conditions. The novel coronavirus (SARS-CoV-2) displays further resilient attributes, making its eradication even more difficult. SARS-CoV-2 is an enveloped virus whose replication can be targeted by limiting the substrates available for structural incorporation. One such molecule that limits substrate availability and has received much attention lately is 2-Deoxy-d-glucose (2-DG). SARS-CoV-2 infection induces glycolysis, impairs mitochondrial function, and damages the infected cells. Administration of 2-DG can inhibit increased glycolytic flux and some other metabolic processes to cause the cessation of viral replication. This article provides a review of the mechanism of action and safety concerns associated with administering 2-DG in the treatment of COVID-19. The drug can have adverse effects on normal cell metabolism since it targets cells non-selectively, possibly in a dose-dependent manner. In addition, the drug has limited use in SARS-CoV-2 infection associated with stroke, hypoxic-ischemic encephalopathy, and critical illness.

Praeruptorin A(PA), a naturally existing pyranocumarin, is isolated from the dried root of Peucedanum praeruptorum Dunn. So far the anti-cancer effect and molecular mechanism behind Praeruptorin A action in human cervical cancer HeLa cells remain unknown. In the present study, we find that PA reduces cell proliferation and colony formation of human cervical cancer HeLa cells through inducing cell cycle arrest at G0/G1 phase. PA-upregulated p21 and p27 proteins are observed, accompanied with inhibition of cyclin D1 and S-phase kinase-associated protein 2(Skp2) proteins expression. PA could significantly inhibit migration and invasion of human HeLa cells. Meanwhile, PA significantly reduces invasive protein expression of matrix metalloproteinase-2 (MMP-2), and increases protein expression of tissue inhibitor of metalloproteinase-2 (TIMP-2). PA is observed to possess the capacity in suppressing ERK1/2 activation. PD98059 (ERK specific inhibitor) significantly enhances PA-induced downregulation of MMP-2 expression, and upregulation of TIMP-2 expression. Moreover, we found that PA treatment notably inhibits 12-O-tetradecanoylphorbol-13-acetate(TPA)-upregulated ERK1/2 activation, MMP-2 expression, cellular migration and invasion in human HeLa cells. Taken together, these findings are the first to demonstrate the anti-cancer activity of PA, which may act as a promising therapeutic agent for the treatment of human cervical cancer.

Proprotein convertases activate various envelope glycoproteins and participate in cellular entry of many viruses. We recently showed that the convertase furin is critical for the infectivity of SARS-CoV-2. This study investigated the implication of the two cholesterol-regulating convertases SKI-1 and PCSK9 in SARS-CoV-2 entry. We used cell-to-cell fusion assays in HeLa cells and pseudoparticle entry into Calu-3 cells. SKI-1 increases cell-to-cell fusion by enhancing the activation of SREBP-2, whereas PCSK9 reduces cell-to-cell fusion by promoting the cellular degradation of ACE2. Metalloprotease activation is sensitive to enhanced cholesterol levels resulting from SKI-1-activated SREBP-2 that leads to enhanced S2’ formation. However, high metalloprotease activity results in S2’ shedding into a new C-terminal fragment (S2”), leading to reduced cell-to-cell fusion. Indeed, S-mutants that increase S2’’ formation, abolish S2’ and cell-to-cell fusion, as well as pseudoparticles entry, indicating that the formation of S2’’ prevents SARS-CoV-2 cell-to-cell fusion and entry. We next demonstrated that PCSK9 enhanced the cellular degradation of ACE2, thereby reducing cell-to-cell fusion. However, different from the LDLR, a canonical target of PCSK9, the C-terminal CHRD domain of PCSK9 is dispensable for the PCSK9-induced degradation of ACE2. Molecular modeling suggested binding of ACE2 to the Pro/Catalytic domains of mature PCSK9. Thus, both cholesterol-regulating convertases SKI-1 and PCSK9 can modulate SARS-CoV-2 entry via two independent mechanisms.

Following ischemic stroke, the degradation of myelin and other cellular membranes surpasses the lipid-processing capabilities of resident microglia and infiltrating macrophages. This imbalance leads to foam cell formation in the infarct and areas of secondary neurodegeneration, instigating sustained inflammation and furthering neurological damage. Given that mitochondria are the primary sites of fatty acid metabolism, augmenting mitochondrial biogenesis (MB) may enhance lipid processing, curtailing foam cell formation and post-stroke chronic inflammation. Previous studies have shown that the pharmacological activation of the β2-adrenergic receptor (β2-AR) stimulates MB. Consequently, our study sought to discern the effects of intensified β2-AR signal-ing on MB, the processing of brain lipid debris, and neurological outcome using a mouse stroke model. To achieve this goal, aged mice were treated with formoterol, a long-acting β2-AR ago-nist, daily for two and eight weeks following stroke. Formoterol increased MB in the infarct re-gion, modified fatty acid metabolism, and reduced foam cell formation. However, it did not re-duce markers of post-stroke neurodegeneration or improve recovery. Our findings suggest that boosting MB in myeloid cells is one component of a therapeutic avenue for improving brain lipid debris processing after stroke.

The KRAS mutant population has been undruggable for 40 years. G12C inhibitors and immunotherapy are the beginning of success. It is necessary to summarize the successful experience of the existing treatment model and explore the direction of the next treatment. In this review, we discuss the latest developments in targeted therapy and immunotherapy for KRAS-mutation NSCLC, aiming to provide direction or enlightenment for future treatment strategies.

Zika virus (ZIKV) is an emerging human mosquito-transmitted pathogen of global concern, known to be associated with complications such as congenital defects and neurological disorders in adults. ZIKV infection is associated with induction of cell death. However, previous studies suggest that the virally-induced apoptosis occurs at a slower rate compared to the course of viral production. In this present study, we investigated the capacity of ZIKV to delay host cell apoptosis. We provide evidence that ZIKV has the ability to interfere with apoptosis whether it is intrinsically or extrinsically induced. In cells expressing viral replicon-type constructions, we show that this control is achieved through replication. Finally, our work highlights an important role for anti-apoptotic Bcl-2 family protein in the ability of ZIKV to control apoptotic pathways, avoiding premature cell death and thereby promoting virus replication in the host-cell.

In this review, we discuss the insulin resistance (IR) and its development in the insulin target tissues that leads to diabetes. Also, we highlight the use of induced pluripotent stem cells (iPSCs) to understand the mechanisms underlying the development of IR. IR is associated with several metabolic disorders, including type 2 diabetes (T2D). The development of IR in insulin target tissues involves genetic and acquired factors. Persons at genetic risk for T2D tend to develop IR several years before glucose intolerance. Although there are currently several mouse models for both IR and T2D that had provided a lot of information about the disease, these models cannot recapitulate all the aspects of this complex disease as seen in each individual. Patient-specific iPSCs can overcome the hurdles faced with the classical mouse models for studying IR. iPSC technology can generate cells genetically identical to IR individuals, which can help in distinguishing between genetic and acquired defects in insulin sensitivity. Combining the technologies of the genome editing and iPSCs may provide important information about the inherited factors underlying the development of different forms of IR. Further studies are required to fill the gaps in understanding the pathogenesis of IR and diabetes.

Infection by the Severe Acute Respiratory Syndrome-Coronavirus-2 (SARS-CoV-2) results in the novel coronavirus disease COVID-19, which has posed a serious threat globally. Infection of SARS-CoV-2 during pregnancy is associated with complications like preterm labor and premature rupture of membranes; a proportion of neonates born to the infected mothers are also positive for the virus. During pregnancy, the placental barrier protects the fetus from pathogens and ensures healthy development. However, whether or not SARS-CoV-2 can infect the placenta is unknown. Herein, utilizing single-cell RNA-seq data, we report that the SARS-CoV-2 binding receptor ACE2 and the S protein priming protease TMPRSS2 are co-expressed by a subset of syncytiotrophoblasts (STB) in the first trimester and extra villous trophoblasts (EVT) in the second trimester human placenta. The ACE2- and TMPRSS2-positive (ACE2+TMPRSS2+) placental subsets express mRNA for proteins involved in viral budding and replication. These cells also express mRNA for proteins that interact with SARS-CoV-2 structural and non-structural proteins in the host cells. We also discovered unique signatures of genes in ACE2+TMPRSS2+ STBs and EVTs. The ACE2+TMPRSS2+ STBs are highly differentiated cells and express genes involved mitochondrial metabolism and glucose transport. The second trimester ACE2+TMPRSS2+ EVTs are enriched for markers of endovascular trophoblasts. Further, both these subtypes abundantly expressed genes in Toll like receptor pathway, the second trimester EVTs (but not first trimester STBs) are also enriched for component of the JAK-STAT pathway that drive inflammation. To conclude, herein we uncovered the cellular targets for SARS-CoV-2 entry and show that these cells can potentially drive viremia in the developing human placenta. Our results provide a basic framework towards understanding the paraphernalia involved in SARS-CoV-2 infections in pregnancy.

Inflammatory bowel diseases, which consist of chronic inflammatory conditions of the colon and the small intestine, are considered a global disease of our modern society. Recently, the interest toward the use of herbal therapies for the management of inflammatory bowel diseases has increased because of their effectiveness and favorable safety profile, compared to conventional drugs. Boswellia serrata Roxb. and Curcuma longa L. are amongst the most promising herbal drugs, however, their clinical use in inflammatory bowel diseases is limited and little is known on their mechanism of action. The aim of this work was to investigate the effects of two phytochemically characterized extracts of B. serrata and C. longa in an in vitro model of intestinal inflammation. Their impact on cytokine release and reactive oxygen species production, as well as the maintenance of the intestinal barrier function and on intestinal mucosa immune cells infiltration, has been evaluated. The extracts showed a good protective effect on the intestinal epithelium at 1 µg/ml, with TEER values increasing by approximately 1.5 fold, compared to LPS-stimulated cells. C. longa showed an anti-inflammatory mechanism of action, reducing IL-8, TNF-α and IL-6 production by approximately 30%, 25% and 40%, respectively, compared to the inflammatory stimuli. B. serrata action was linked to its antioxidant effect, with ROS production being reduced by 25%, compared to H₂O₂-stimulated Caco-2 cells. C. longa and B. serrata resulted to be promising agents for the management of inflammatory bowel diseases by modulating in vitro parameters which have been identified in the clinical conditions.

A distinctive feature of the SARS-CoV-2 spike protein is its ability to efficiently fuse cells, thus producing syncytia found in COVID-19 patients. This commentary proposes how this ability enables spike to cause COVID-19 complications as well as side effects of COVID-19 vaccines, and suggests how these effects can be prevented..

Extracellular vesicles (EVs) have been identified as novel mediators of intercellular communication. They work via delivering the sequestered cargo to cells in close vicinity as well as distant sites in the body, regulating pathophysiological processes. Cell death and inflammation are biologically crucial processes in both normal physiology and pathology. These processes are indistinguishably linked with their effectors modulating the other process. For instance, during an unresolvable infection, the upregulation of specific immune mediators leads to inflammation causing cell death and tissue damage. EVs have gained considerable interest as mediators of both cell death and inflammation during conditions such as sepsis. This review summarizes the types of extracellular vesicles known to date and their roles in mediating immune responses leading to cell death and inflammation with specific focus on sepsis and lung inflammation.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) infection triggers various events from molecular to tissue level, which in turn is given by the intrinsic characteristics of each patient. Given the molecular diversity characteristic of each cellular phenotype, the possible cytopathic, tissue and clinical effects are difficult to predict, which determines the heterogeneity of COVID-19 symptoms. The purpose of this article is to provide a comprehensive review of the cytopathic effects of SARS-CoV-2 on various cell types, focusing on the development of COVID-19, which in turn may lead, in some patients, to a persistence of symptoms after recovery from the disease, a condition known as long COVID. We describe the molecular mechanisms underlying virus-host interactions, including alterations in protein expression, intracellular signaling pathways, and immune responses. In particular, the article highlights the potential impact of these cytopathies on cellular function and clinical outcomes, such as immune dysregulation, neuropsychiatric disorders, and organ damage. The article concludes by discussing future directions for research and implications for the management and treatment of COVID-19 and Long-COVID.

Evidence was brought forward in England and the USA that Black, Asian, Latino and Minority Ethnic people exhibit higher mortality risk from COVID-19 than White people. While socioeconomic factors were suggested to contribute to this trend, they arguably do not explain the range of the differences observed, allowing for possible genetic implications. Almost concurrently, the analysis of a cohort in Chinese COVID-19 patients proposed an association between the severity of the disease and the presence of the minor allele of rs12252 of the Interferon-induced transmembrane protein 3 (IFITM3) gene. This SNP, together with rs34481144, are the two most studied polymorphisms of IFITM3 and have been associated in the past with increased severity in Influenza, Dengue, Ebola, and HIV viruses. IFITM3 is an immune effector protein that is pivotal for the restriction of viral replication, but also for the regulation of cytokine production. Following up to these two developments in the ongoing SARS-CoV-2 pandemic, the present study investigates a possible association between the differences in mortality of ethnic groups in England and the combined haplotypes of rs12252 and rs34481144. The respective allele frequencies were collected for 26 populations from 1000 Genomes Project and subgroups were pooled wherever possible to create correspondences with ethnic groups in England. A significant correlation (r=0.9687, p= 0.0003) was observed between the reported Standardized Mortality Ratios and the frequency of the combined haplotype of both reference alleles, suggesting that the combination of reference alleles of the specific SNPs may be implicated in more severe outcomes of COVID-19. This study calls for further focus on the role of IFITM3 variants in the mechanism of cellular invasion of SARS-CoV-2, their impact in COVID-19 severity and their possible implications in vaccination efficacy.

In this study, we investigated the features of co-infection with SARS-CoV-2 and nonpathogenic strain LEV8 of coxsackievirus A7 or enterovirus A71 for Vero E6 cells and Syrian hamsters. The investigation of co-infection with SARS-СoV-2 and LEV-8 or EV-A71 in the cell model was shown that a competitive inhibitory effect for these viruses were especially significant against SARS-CoV-2. Pre-infection with enteroviruses in animals caused more than a 100-fold decrease in the levels of SARS-CoV-2 virus replication in the respiratory tracts and more rapid clearance of the lower respiratory tract from infectious SARS-CoV-2. Co-infection with SARS-CoV-2 and LEV-8 or EV-A71 also reduced the severity of clinical manifestations of the SARS-CoV-2 infection for animals. Additionally, the histological data illustrated that co-infection with nonpathogenic coxsackievirus decreased the level of pathological changes by SARS-CoV-2 in the lungs. Research into the chemokine/cytokine profile demonstrated that the studied enteroviruses efficiently triggered this part of antiviral immune response, which can be associated with significant inhibition of SARS-CoV-2 infection. These results demonstrate that there exists a strong viral interference between the studied nonpathogenic strain of coxsackievirus A7 or enteroviruses A71 and SARS-CoV-2 pathogenic for humans in vitro and in vivo.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Water-soluble and cytocompatible polymers were investigated to enhance a transporting efficiency of biomolecules into cells in vitro. The polymers composed of 2-methacryloyloxyethyl phosphorylcholine (MPC) unit, a hydrophobic monomer unit, and a cationic monomer unit bearing an amino group were synthesized for complexation with model biomolecules, siRNA. The cationic MPC polymer was shown to interact with both siRNA and the cell membrane and was successively transported siRNA into cells. When introducing 20 − 50 mol% hydrophobic units into the cationic MPC polymer, transport of siRNA into cells. The MPC units (10 − 20 mol%) in the cationic MPC polymer were able to impart cytocompatibility, while maintaining interaction with siRNA and the cell membrane. The level of gene suppression of the siRNA/MPC polymer complex was evaluated in vitro and it was as the same level as that of a conventional siRNA transfection reagent, whereas its cytotoxicity was significantly lower. We concluded that these cytocompatible MPC polymers may be promising complexation reagent for introducing biomolecules into cells, with the potential to contribute to future fields of biotechnology, such as in vitro evaluation of gene functionality, and the production of engineered cells with biological functions.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Lactic acid bacteria (LAB) have an extracellular proteolytic system that includes a multi-domain, cell envelope protease (CEP) with a subtilisin homologous protease domain. These CEPs have different proteolytic activities despite having similar protein sequences. Structural characterization has previously been limited to CEP homologs of dairy and human derived LAB strains, excluding CEPs of plant derived LAB strains. CEP structures are a challenge to determine experimentally due to their large size and attachment to the cell envelope. This study aims to clarify the prevalence and structural diversity of CEPs by using the structure prediction software AlphaFold 2. Domain boundaries are clarified based on a comparative analysis of 21 three-dimensional structures, revealing novel domain architectures of CEP homologs that are not necessarily restricted to specific LAB species or ecological niches. The C-terminal flanking region of the protease domain is divided into fibronectin type-III-like domains with various structural traits. The analysis also emphasizes the existence of two distinct domains for cell envelope attachment that are preceded by an intrinsically disordered cell wall spanning domain. The domain variants and their combinations provide CEPs with different stability, proteolytic activity and potentially adhesive properties, making CEPs targets for steering proteolytic activity with relevance for both food development and human health.

Importance: The COVID-19 pandemic is currently accelerating. Patients with locally advanced non-small cell lung cancer (LA-NSCLC) may require treatment in locations where resources are limited and the prevalence of infection is high. Patients with LA-NSCLC frequently present with comorbidities that increase the risk for severe morbidity and mortality from COVID-19. These risks may be further increased by treatments for LA-NSCLC. Observation: We present expert thoracic oncology multidisciplinary (radiation oncology, medical oncology, surgical oncology) consensus of alternative strategies for the treatment of LA-NSCLC during a pandemic. The overarching goals of these approaches are to reduce the number of visits to a healthcare facility, reduce the risk of SARS-CoV-2 exposure, and attenuate the immunocompromising effects of lung cancer therapies. Patients with resectable disease can be treated with definitive non-operative management if surgical resources are limited or the risks of perioperative care are high. Non-operative options include chemotherapy, chemoimmunotherapy, and radiation therapy with sequential schedules. The order of treatments may be based on patient factors and clinical resources. Whenever radiation therapy is delivered without concurrent chemotherapy, hypofractionated schedules are appropriate. For patients who are confirmed to have COVID-19, usually cancer therapies may be withheld until symptoms have resolved with negative viral test results. Conclusions and Relevance: The risk of severe treatment-related morbidity and mortality is significantly elevated for patients undergoing treatment for LA-NSCLC during the COVID-19 pandemic. Adapting alternative treatment strategies as quickly as possible may save lives and should be implemented through communication with the multidisciplinary cancer team.

The uneven immunogenicity of the attenuated tetravalent dengue vaccine has created the diffi-culty to achieve a balanced protection against all four serotypes of dengue virus (DENV). To overcome this problem, non-replicative-based vaccines have come into focus as their immuno-genicity is adjustable. This approach is excellent for multivalent vaccines but commonly faces the issue of low immunogenicity. In this present study, we developed a non-replicating dengue vaccine composing of UV-inactivated dengue-2 virus (UV-DENV2) and DENV-2 NS1-279 protein encapsidated within nanoparticles. This vaccine candidate was administered in the presence of BCG cell wall cytoskeleton (BCG-CWS) as an adjuvant. We revealed, here, that encapsidated immunogens with BCG-CWS exerted potent activities on both B and T cells and elicited Th-1/Th-2 responses in mice. This was evidenced by strong neutralizing antibody activity with an unde-tectable antibody enhancing activity in a group of mice receiving encapsidated immunogens with BCG-CWS. Importantly, BCG-CWS significantly augmented antibody-mediated comple-ment-fixing activity, strongly stimulated the antigen-specific polyfunctional T cell responses as well as activated mixed Th-1/Th-2 responses specific to DENV2- and NS1-279 antigens. In conclu-sion, BCG-CWS potently adjuvanted the inactivated DENV-2 and subunit DENV immunogens. The mechanism of adjuvanticity remains unclear. This study revealed the potential use of BCG-CWS in vaccine development.

SARS-CoV-2 is the Coronavirus responsible for the COVID-19 pandemic. Even though we are no more in a pandemic situation, people are getting infected some of them needing hospitalization, and a few of them die. Methods: We did a retrospective study including 445 patients who accessed the Emergency Section of Policlinico Umberto I, Rome, Italy, where they had routine blood exams. In this study, we concentrated on the complete blood count, creatinine, and azotemia. The data was analyzed using ANOVA, Spearman correlation, and ROC analysis. They were divided into four groups based on their outcome: (1) the emergency group (patients with mild forms who were quickly discharged); (2) the hospital ward group (patients who after admission to the emergency section were hospitalized in a COVID-19 ward); (3) the intensive care unit (ICU) group (patients that after the admission in the emergency section required intensive assistance); (4) the deceased group (patients that after the admission in the emergency section had a fatal outcome). Results: We found significant changes for creatinine, azotemia, hematocrit, mean corpuscular hemoglobin concentration, basophils, monocytes, red blood cell distribution width, hemoglobin, hematocrit, and red blood cell numbers by ANOVA according to their outcomes, particularly for the deceased group. Also, we found outcome correlations for eosinophils, hemoglobin, hematocrit, mean corpuscular hemoglobin concentration, lymphocyte, neutrophil, platelet, and red blood cell number and red blood cell distribution width. Conclusions: This study discloses an association between “classical” routine blood biomarkers and the severity of outcomes in Omicron patients.

Background: The monocyte-phagocyte system (MPS), including monocytes/macrophages and dendritic cells (DCs), plays a key role in anti-viral immunity. We aimed to analyze the prognostic value of the MPS components on in-hospital mortality in a cohort of 58 patients (M/F ; mean ageSD years) with COVID-19 pneumonia and 22 age- and sex-matched healthy controls. Methods: We measured frequencies and absolute numbers of peripheral blood CD169+ monocytes, conventional CD1c+ and CD141+ (namely cDC2 and cDC1), and plasmacytoid CD303+ DCs by means of multi-parametric flow cytometry. A gene profile analysis of 770 immune-inflammatory related human genes and 20 SARS-CoV-2 genes was also performed. Results: Median frequencies and absolute counts of CD169-expressing monocytes were significantly higher in COVID-19 patients than in controls (p 0.04 and p 0.01, respectively). Conversely, percentages and absolute numbers of all DC subsets were markedly depleted in patients (p

Background: Green synthesis of silver (Ag) nanoparticle was performed with the fruit extract of Scindapsus officinalis and test against HepG-2, MCF-7 cancer cell lines. These biosynthesized metal nanoparticles have a potential of therapeutic use as an alternative medicine for the treatment of hepatic & breast cancer cases. Results : AgNPs were identified by change of color & their absobtion at 340 nm measured by UV-visible spectroscopy, FTIR spectral analysis confirmed phenolic compounds presence, morphology & size visualized in SEM, TEM used for determination of size, shape & light scattering analysis. Synthesized silver nanoparticles were spherical in shape and size less than 50 nm. XRD analysis was affirmed the crystalline nature of metal particles. In-vitro cytotoxic result showed an excellent IC50 value of 155.81μg/ml and 114.74 μg/ml against HepG-2 & MCF-7 cell lines. Conclusion: The current study reveals green synthesized AgNPs possess high cytotoxic action against HepG-2 & MCF-7 cell lines which suggested the use of silver nanoparticles as a medicine to treat hepatic & breast cancer.

Based on screening in computational biology and biological in vitro assays, five natural products isolated from extracts of the herbal medicine toad skin, such as cinobufagin (CBFi), bufalin (BFi), arenobufagin (ABFi), telocinobufagin (TBFi), bufotalin (BFTi), were subjected to molecular docking calculations with the use of SARS-CoV-2 main protease (PDB 6LU7 and 7BTF) and top-scoring ligand-receptor complexes were obtained. The results showed that the binding energy of ABFi to the 3CL protein was -17.044kcal/mol, which was higher than CBFi and TBFi. However, the binding energy of ABFi to the RdRp protease was -23.250 kcal/mol, which was much lower than that of CBFi and TBFi, EVEN lower than that of ABFi to the 3CL protein. ABFi also has polar interactions with amino acids such as Glu811, Ser814, Ser681 and Thr680 of RdRp enzyme. The results revealed that ABFi had a moderate inhibitory effect on the cell proliferation of SARS-CoV-2 in vitro, with an inhibition rate of 61.12%, even weaker than Remdesivir. This new discovery provides us with new ideas for in-depth studies on the development of natural products with this class of structural generalizations as inhibitors of SARS-CoV-2, and provides an experimental basis for the next step of mechanistic studies.

A pattern of NK cell heterogeneity in each individual determines proliferative and functional responses of NK cells to activating stimuli. Obtaining the progeny of a single cell by cloning original population is one of the ways to study the NK cell heterogeneity. In this work, we used single cell sorting into a plate and stimulation by IL-2 and gene-modified K562 feeder cells expressing membrane-bound IL-21 (K562-mbIL21) that led to generation of phenotypically confirmed and functionally active NK cell clones. We applied two models of clone cultivation, which differently affected their phenotype, lifespan and functional activity. The first model, which included weekly restimulation of clones with K562-mbIL21 and IL-2, resulted in the generation of relatively short-lived (5-7 weeks) clones of highly activated NK cells. HLA-DR expression in the expanded NK cells correlated strongly with IFN-γ production. The second model, in which NK cells were restimulated mainly with IL-2 alone, produced long-lived clones (8-14 weeks) that expanded up to 10⁷ cells with lower ability to produce IFN-γ. Our method is applicable for studying variability in phenotype, proliferative and functional activity of the certain NK cell progeny in response to the stimulation, which may help in selecting NK cells best suited for clinical use.

COVID-19 was an inflammatory pneumonia caused by a respiratory infection with a coronavirus named SARS-CoV-2. Severely ill COVID-19 patients could die of acute pulmonary and systemic inflammation. Thus, there was a theory that long COVID-19 shared many similarities with systemic autoimmune diseases. There was also a theory that the SARS-CoV-2 virus could infect many cell- and tissue-types distributed throughout multiple organ systems of the body. I aim to review the above theories using unbiased high-throughput datasets cataloguing gene expression. Studies reviewed used the technology of next generation sequencing, either as bulk tissue RNA sequencing, or as single-cell RNAs sequencing; ingenious methods for signal deconvolution were then used to identify individual cell types. Datasets reviewed suggested that severe COVID-19 induced expression of genes associated with pro-inflammatory signaling, tissue development or remodeling, scarring, or cell death. The datasets also provided evidence for several inflammatory syndromes associated with COVID-19, such as neuronal COVID, acute respiratory disease syndrome, vascular inflammation, or multisystem inflammatory syndrome. Indeed, inflammatory signal during severe COVID-19 was reported in many cell types, for example in structural cells, in infiltrating immune cells, in the vascular system, or in circulating cells in the blood. There was also frequently a change in proportions of immune cell-types in the blood, epithelial cells in the lungs, or among infiltrating immune cells.

Since the spread of the deadly virus SARS-CoV2 in late 2019, researchers have restlessly been seeking for unraveling how the virus factually enters the host cells. Some proteins on each side of the interaction between the virus and the host cells are involved as the major contributors to this process: 1- the nano-machine Spike protein on behalf of the virus, 2- angiotensin converting enzyme II, the mono-carboxypeptidase and the key component of renin angiotensin system on behalf of the host cell, 3- some host proteases and proteins exploited by SARS-CoV2, In this review, the complex process of SARS-CoV2 entrance into the host cells with the contribution of the involved host proteins as well as the sequential conformational changes in the Spike protein tending to increase the probability of complexification of the latter with angiotensin converting enzyme II, the receptor of the virus on the host cells, are discussed. Besides, the release of the catalytic ectodomain of angiotensin converting enzyme II as its soluble form in the extracellular space and its positive or negative impact on the infectivity of the virus are considered.

Chronic lymphocytic leukemia (CLL) is characterized by dysfunctional B cells. Immune checkpoint molecules such as cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), and programmed death-1 (PD-1) are upregulated in patients with CLL and may correlate with prognostic markers such as beta-2 microglobulin (B2M). The aim of this study was to evaluate the levels of immune checkpoints on B-cell subsets and to further correlate them with B2M levels in patients with CLL. We recruited 21 patients with CLL and 12 controls. B cell subsets and the levels of immune checkpoint expression were determined using conventional multi-color flowcytometry. Basal levels of B2M in patients with CLL were measured using an Enzyme-linked immunosorbent assay. Patients with CLL had increased levels of activated B cells when compared to the control group, p< 0.001. The expression of PD-1 and CTLA-4 were increased on activated B cells and memory B cells, p< 0.05. There were no associations between B2M levels and the measured immune checkpoints on B cell subsets, after adjusting for sex and age. African patients with CLL express elevated levels of PD-1 and CTLA-4 immune checkpoints on activated and memory B cell subsets. However, there is no correlation between these immune checkpoint expressions and B2M levels.

Dengue is a viral mosquito-borne disease that rapidly spreads in tropical and subtropical countries, including the Philippines. One of its most distinguishing characteristics is the ability of the Dengue Virus (DENV) to easily surpass the innate responses of the body, thus activating B cells of the adaptive immunity to produce virus-specific antibodies. Moreover, Dengvaxia® is the only licensed vaccine for DENV, but recent studies showed that seronegative individuals become prone to increased disease severity and hospitalization. Owing to this limitation of the dengue vaccine, this study determined and compared consensus and unique B cell epitopes among each DENV (1-4) Philippine isolate to identify potential areas of interest for future vaccine studies and therapeutic developments. An in silico-based epitope prediction of forty (40) DENV 1-4 strains, each serotype represented by ten (10) sequences from The National Center for Biotechnology Information (NCBI), was conducted using Kolaskar and Tongaonkar antigenicity, Emini surface accessibility, and Parker hydrophilicity prediction in Immune Epitope Database (IEDB). Results showed that five (5) epitopes were consensus for DENV-1 with no detected unique epitope, one (1) consensus epitope for DENV-2 with two (2) unique epitopes, one (1) consensus epitope for DENV-3 plus two (2) unique epitopes, and two (2) consensus epitopes and one (1) unique epitope for DENV-4. The findings of this study would contribute to determining potential vaccine and diagnostic marker candidates for further research studies and immunological applications against DENV (1-4) Philippine isolates.

Coronavirus disease (COVID-19) is a new discovered strain where WHO officially declares the disease as COVID-19 while the virus responsible for it called Severe Acute Respiratory Syndrome Coronavirus 2 or SARS-CoV-2. The incubation period of this disease is between 14 days. Ordinary clinical symptoms that reported around the world include fever, cough, fatigue, diarrhoea and vomiting as well as asymptomatic for certain people. Infection is spread mainly through broad droplets. In early March 2020, WHO again has announced that COVID-19 is a pandemic with currently no specific treatment. The potential use of SARS-COV-2 proteome as a vaccine candidate by analysing through B-cell and T-cell antigenicity by using a immunoinformatics approach as a vaccine development early stage. In this study, we used consensus sequence for SARS-COV-2 proteome that was retrieved from NCBI database. VaxiJen 2.0 was mainly used to identify the antigenic property of SARS-COV-2 proteins. IEDB then used to analyse the B-cell epitope, the presence of T cell immunogenic epitope in SARS-COV-2 proteins was obtained by using compromise method of MHC class I and II tools that accessible respectively using ProPred-1 server and MHC II Binding Prediction in IEDB database. The best epitopes of B and T-cell epitopes were predicted with high antigencity and the information is disseminated through web-based database resource (https://covid-19.omicstutorials.com/epitopes/). This study will be useful to find a new epitope-based candidate for SARS-COV-2. However, further study needs to be done for the next stages of vaccine development.

Abstract: DNA fragmentation factors 40 and 45 (DFF40 and DFF45) and B-cell lymphoma 2 (Bcl-2) expression were evaluated in the normal human endometrium and myometrium. DFF40, DFF45, and Bcl-2 expression was assessed via immunohistochemistry in the proliferative, secretory, and atrophic endometrium and myometrium collected postmenopausally and premenopausally during the proliferative and secretory phases of the menstrual cycle. The endometrium showed significantly higher DFF40 and DFF45 expression than that in the uterine myometrium; compared to the stroma, endometrial glands showed the highest expression in pre- and postmenopausal specimens. Glandular expression of DFF45 was dependent on the menstrual cycle, reaching its highest level in the secretory endometrium. The glandular expression of DFF40 and DFF45 was significantly lower in postmenopausal specimens than that in premenopausal tissue. No cycle-dependent changes were reported for stromal or myometrial DFF40 or DFF45 expression. Compared to the endometrial stroma and myometrium, Bcl-2 showed the highest expression in the glandular proliferative endometrium and the lowest expression in the stromal secretory endometrium and myometrium during the secretory phase of the cycle. DFF45 and Bcl-2 showed menstrual cycle-dependent expression, which was limited to the glandular layer of the endometrium.

The recurrent coronavirus outbreaks in China (SARS-CoV and its relative, SARS-CoV-2) have raised speculations that perhaps Asians are somehow more susceptible to these coronaviruses. Here, we test this possibility based on an analysis of the lung-specific expression of ACE2, which encodes the known cell-entry receptor of both SARS-CoV and SARS-CoV-2. We show that ACE2 expression is not affected during tumorigenesis, supporting that the abundant transcriptomes in cancer genomic studies can be informatively used to study ACE2 expression among diverse individuals without cancer. We find that ACE2 expression in the lung increases with age, but is not associated with sex. Further, Asians do not differ from other populations for ACE2 expression and do not harbor unique genetic polymorphisms in the ACE2 locus. Thus, beyond illustrating an innovative method for assessing the potential impacts of demographic factors for non-cancer diseases from large-scale cancer sample datasets, our statistically robust findings emphasize that individuals of all races require the same level of personal protection against SARS-CoV-2.

Sickle cell disease (SCD) is a pathophysiological condition of chronic hemolysis, oxidative stress, and elevated inflammation. The transcription factor Nrf2 is a master regulator of oxidative stress. Here we reported that the FDA-approved, oral agent simvastatin, an inhibitor of hydroxymethyl-glutaryl coenzyme A reductase, significantly activates the expression of Nrf2 and antioxidant enzymes. Simvastatin also induces fetal hemoglobin expression in SCD patient erythroid progenitors and a transgenic mouse model. Simvastatin alleviates SCD symptoms by decreasing hemoglobin S sickling, oxidative stress, and inflammation stress in erythroblasts. Particularly, simvastatin increases cellular levels of cystine, the precursor for the biosynthesis of antioxidant reduced glutathione and decreases the iron content in SCD mouse spleen and liver tissues. Mechanistic studies suggest that simvastatin suppresses the expression of critical histone methyltransferase, Enhancer of zeste homolog 2 to reduce both global and gene-specific histone H3 lysine 27 trimethylation. These chromatin structural changes promote the assembly of transcription complexes to fetal γ-globin and antioxidant genes regulatory regions, in an antioxidative response element-dependent manner. In summary, our findings suggest that simvastatin activates fetal hemoglobin and antioxidant protein expression and modulates iron and cystine/reduced glutathione levels to improve the phenotype of SCD and represents a therapeutic strategy for further development.

People with sickle cell disease (SCD) are at greater risk of severe illness and death from respiratory infections, including COVID-19 than people without SCD (Centers for Disease Control and Prevention, USA). Vaso-occlusive crises (VOC) in SCD and severe SARS-CoV-2 infection are both characterized by thrombo-inflammation mediated by endothelial injury, complement activation, inflammatory lipid storm, platelet activation, platelet-leukocyte adhesion, and activation of the coagulation cascade. Notably, lipid mediators, including thromboxane A2, significantly increase in severe COVID-19 and SCD. In addition, the release of thromboxane A2 from endothelial cells and macrophages stimulates platelets to release microvesicles which are harbingers of multicellular adhesion and thrombo-inflammation. Currently, there are limited therapeutic strategies targeting platelet-neutrophil activation and thrombo-inflammation in either SCD or COVID-19 during acute crisis. However, due to many similarities between the pathobiology of thrombo-inflammation in SCD and COVID-19, therapies targeting one disease may likely be effective in the other. Therefore, the preclinical and clinical research spurred by the COVID-19 pandemic, including clinical trials of anti-thrombotic agents, are potentially applicable to VOC. Here, we first outline the parallels between SCD and COVID-19; second, review the role of lipid mediators in the pathogenesis of these diseases and lastly, examine the therapeutic targets and potential treatments for the two diseases.

In vitro glucose uptake in yeast cell facilitated by Abelmoschus esculentus L. (okra seed) for management of type 2 diabetes was studied. Plant material was collected, identified, processed, and stored for further use. 80% methanol was employed for extraction and sonicated to release antidiabetic-bioactive component in solution and was filtered, concentrated, freeze-dried, and fractionated using standard techniques. Glucose uptake at an initial concentration of 5mM/L and 10mM/L by the crude extract was consistent to that of the known standard drug while at 25mM/L glucose concentration was equivalent with the crude extract. Also, at 0.625 mg/mL the linear equations, and R2 demonstrations that the crude extract was higher in dose predictability than the standard drug as presented by the equation; y = 35.754x - 57.822, and R² = 0.9502 (95%). The extract-fractions were employed to evaluate the ability of yeast cell line culture to take up glucose from the system through DPPH, FRAP, lipid peroxidation and anti-diabetes effect of extract-fraction assays. Extract-fractions were found to poses antioxidant activity high enough to inhibit stress-related diseases. The extract fractions were active as drug candidates both at low and high concentrations and were better compared with the standard drug and standard antioxidant was comparable. The high bioactive extract fractions require encapsulation with a nanoparticle as a drug candidate for type 2 diabetes patients. And an animal trial of the drug candidate may be necessary to monitor the in vivo performances of the extract fractions and subsequent human volunteered trial.

Emerging viruses description have grown at an unprecedented rate since the beginning of the 21^st century. The emergence of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) and its related illness, Coronavirus Disease 2019 (COVID-19) has been reported as the third highly pathogenic coronavirus introducing itself into human population in the current era after the SARS-CoV and Middle East Respiratory Syndrome (MERS-CoV). Molecular and cellular studies considering the pathogenesis of this novel coronavirus are still in the early stages of research, however, regarding the similarity of SARS-CoV-2 and other coronaviruses, it could be hypothesized that the NF-κB, Cytokine regulation, ERK, and TNF-α signaling pathways are the more likely causes of inflammation upon onset of COVID-19. There are several drugs prescribed and used to alleviate the activity of these inflammatory cellular signaling pathways which might be beneficial for developing novel therapeutic modalities against COVID-19. In this review, we briefly summarized the alteration of cellular signaling pathways affected by coronavirus infection, particularly SARS-CoV and MERS-CoV and tabulated the current therapeutic agents approved for previous human diseases.

Mangrove creeks adjoining typical riverine mangrove forests is known to be a net source of CO2 and dissolved inorganic carbon (DIC) to the ocean due to the decomposition of rich organic carbon in the soil; such information is limited in fringe mangroves. This study aims to clarify the difference in carbonate processes between the two types of mangrove forests. We conducted continuous monitoring of the partial pressure of carbon dioxide (pCO2) and measured carbonate chemistry parameters (total alkalinity (TA) and DIC) in two types of mangrove areas located in Okinawa, Japan. The result showed that the maximum pCO2 reached 5242 µatm in the Fukido River estuary (a riverine mangrove), whereas it was only 765 µatm on the Yubu coast (a fringe mangrove). The measured maximum TA and DIC values were 3285 µM and 3283 µM in the Fukido River estuary and 3162 µM and 2977 µM on the Yubu coast. These indicate that pCO2 on the Yubu coast was maintained at low values by the carbonate buffering capacity even when TA and DIC increased rapidly. The mangroves on the Yubu coast grow on dead corals and coral soils. It was suggested that the DIC/TA ratio was constantly kept at approximately 0.9 due to TA production by the dissolution of calcium carbonate (CaCO3), which resulted in lower pCO2.

Inactivated SARS-CoV-2 vaccine (CoronaVac) is commonly used in national immunization programs. However, the immune response significantly declined within a few months. Our study assessed the immune response against SARS-CoV-2 after receiving booster shots of BNT162b2 or ChAdOx1 among health care workers who previously received CoronaVac as their primary immunization. Fifty-six participants received ChAdOx1 and forty-two participants received BNT162b2 were enrolled into this study which evaluated the immune responses including anti-SARS-CoV-2 spike total antibodies (Elecsys®), surrogated viral neutralization test (sVNT) to ancestral strain (cPass™; GenScript) and five variants of concern (Alpha, Beta, Gamma, Delta, and Omicron) (Luminex; multiplex sVNT) and the ELISpot with spike (S1 and S2) peptide pool against the ancestral SARS-CoV-2 strain. The samples were analyzed at baseline, 4, and 12 weeks after primary immunization as well as 4 and 12 weeks after receiving the booster. This study showed a significantly higher B-cell response among the BNT162b2 than the ChAdOx1 booster group, particularly against the Omicron variant, as well as a trend of good T-cell immune response in the BNT162b2 group. Moreover, the immune response rapidly declined at 12 weeks after the booster. A fourth dose or a second booster should be recommended, especially for reducing Omicron severity.

Purpose: Acute kidney injury (AKI) is a severe symptom of the 2019 novel coronavirus disease (COVID-19), especially for patients in a critical condition.This study explored the potential mechanism of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) on AKI at the single-cell level. Methods: 15 normal human kidney samples were collected and analyzed using single-cell RNA sequencing (scRNA-seq). Subsequently, we analyzed the components and proportions of kidney cells expressing the host cellular receptor ACE2 and the key protease TMPRSSs family, and analyzed the expression differences in Occidental and Asian populations. Results: We drafted the currently available world's largest human kidney cell atlas with 42,589 cells and identified 19 clusters through unsupervised hierarchical clustering analysis. ACE2 and TMPRSSs genes were significantly co-expressed in podocytes and proximal convoluted tubules as potential host cells targeted by SARS-CoV-2. Comparative analysis showed that ACE2 expression in kidney cells was no less than that in the lung, esophagus, small intestine and colon, suggesting that the kidney may be an important target organ for SARS-CoV-2. In addition, given the high expression of ACE2 and kidney disease-related genes in Occidental donors relative to Asian donors, Occidental populations with SARS-CoV-2 infection might be a higher risk of of kidney injury.

Tocilizumab against interleukin-6 receptor (IL-6R) has been demonstrated to inhibit the progression of diverse cancers in vitro and in vivo. Nonetheless, evidence regarding the anti-tumor effects of Tocilizumab on human colorectal carcinoma (CRC) corresponding to IL-6R expression levels re-mains scarce. To investigate the influence of IL-6R expression, SW480 and HT-29 cells inoculated subcutaneously into NU/NU mice were used as our human CRC xenograft models with anti-IL-6R antibody (Tocilizumab) therapy. IL-6R expression levels, the histology of CRC growth/ invasiveness and tumor growth-related signaling pathway were estimated by H&E and immunohistochemical staining. SW480 tumor cells with higher IL-6R expression levels exerted better responsiveness in Tocilizumab therapy than the treated HT-29 group. Likewise, therapeutic effects of Tocilizumab on the proliferative ability with mitotic index and Ki-67 expressions, the invasiveness with MMP-9 proteinase expressions, ERK 1/2 and STAT3 signaling transduction in SW480 treatment group were superior to HT-29 treatment group. In light of our results, IL-6R is the key indicator for the efficacy of Tocilizumab treatment in CRC xenografts. From the perspective of precision medicine, tumor response to anti-IL-6R antibody therapy could be predicted on the basis of IL-6R expression levels. In this manner, Tocilizumab may serve as a targeted and promising anti-CRC therapy.

The targeting-Her-2/neu therapy by passive application with trastuzumab is associated with acquired resistance and subsequent metastasis development, attributed to upregulation of tumoral PD-L1 expression and downregulation of Her-2/neu. We aimed to investigate this association, following active immunization with our recently constructed B cell–peptide based Her-2/neu vaccines in both preclinical and clinical settings. Immunohistochemistry (IHC), fluorescence in situ hybridization (FISH), and combined positive score (CPS), were applied to evaluate Her-2/neu and PD-L1 expression using a murine syngeneic tumor model for Her-2/neu lung metastases, and tumor biopsies from a gastric cancer patient with disease progression. A significant and concomitant reduction of Her-2/neu and upregulation of PD-L1 expression was observed in the vaccinated mice, after 7 but not after 4 weeks of metastases development. A significant increase of tumor-infiltrating B lymphocytes was observed at both time points. Downregulation of Her-2/neu and upregulation of PD-L1 were observed in a patient’s primary tumor at the disease progression time point but not prior to vaccination (Her-2/neu IHC: 3 to 0, FISH: 4.98 to 1.63; PD-L1 CPS: 0% to 5%). Our results further underline the need for combination therapy by targeting PD-L1 to prevent metastasis formation and immune evasion of Her-2/neu positive and PD-L1 negative tumor cells.

The present study was aimed to evaluate the levels of oxidative stress markers in breast diseases by measuring the 8-hydoxy-2-deoxyguanosine (8-OHdG), vitamin A, vitamin C, vitamin E and total antioxidant status (TAS) alterations in relation to cell proliferation activity and disease progression. Significant increases in the level of oxidative damage marker 8-OHdG and cell proliferation activity were observed in breast carcinoma patients in comparison to benign and normal controls, which were accompanied by significant decrease in non enzymatic antioxidants and TAS concentrations. 8-OHdG and cell proliferation level were negatively correlated with non enzymatic antioxidants viz., Vitamin A, Vitamin C, vitamin E level and total antioxidant activity. Altered levels of biomarkers of oxidative stress and cell proliferation activity amongst the malignant, benign and controls suggest a correlation of increased oxidative stress and cell proliferation activity in the progression of disease in breast carcinoma patients. Among the oxidative stress markers and cell proliferation index, decreased level of vitamin A, vitamin C, vitamin E, TAS and increased level of 8-OHdG, cell proliferation index emerged as best predicted biomarkers for subjects with malignancy and benign breast disease.

Dietary vitamin A/all-trans retinol/ROL plays a critical role in human vision. ROL circulates bound to the plasma retinol-binding protein (RBP4) as RBP4-ROL. In the eye, the STRA6 membrane receptor binds to circulatory RBP4 and internalizes ROL. STRA6 is however not expressed in systemic tissues, where there is high-affinity RBP4 binding and ROL uptake. We tested the hypothesis, that the second retinol-binding protein 4 receptor 2 (Rbpr2) which is highly expressed in systemic tissues of zebrafish and mouse, contains a functional RBP4 binding domain, critical for ROL transport. As for STRA6, modeling and docking studies confirmed three conserved RBP4 binding residues in zebrafish Rbpr2. In cell culture studies, disruption of the RBP4 binding residues on Rbpr2 almost completely abolished uptake of exogenous vitamin A. CRISPR generated rbpr2-RBP4 domain zebrafish mutants showed microphthalmia, shorter photoreceptor outer segments, and decreased opsins, that were attributed to impaired ocular retinoid content. Injection of WT-Rbpr2 mRNA into rbpr2 mutant or all-trans retinoic acid treatments rescued the mutant eye phenotypes. In conclusion, zebrafish Rbpr2 contains a putative extracellular RBP4-ROL ligand-binding domain, critical for yolk vitamin A transport to the eye for ocular retinoid production and homeostasis, for photoreceptor cell survival.

Lung cancer is a common malignant tumor of the lung and the leading cause of cancer mortality worldwide. Non-small-cell lung cancer (NSCLC) accounts for 80%–85% of lung cancer, 40% of NSCLCs will have spread beyond the lungs by the time it is diagnosed. Long non-coding RNA (LncRNA) prostate androgen-regulated transcript 1 (PART-1) was reported that promote the development of several cancers. In the current study, we conducted experiments to investigate the role of PART-1 in the proliferation, invasion, and migration of NSCLC. The expression level of the PART-1 gene increased significantly in the NSCLC cell lines, including A549, H1229, H1650, H1975, and PC9. Knocking down of PART-1 inhibited the proliferation, invasion, and migration of A549 cells, moreover, decreased the tumor proliferation in nude mice. We confirmed that PART-1 targeted miR-204-3p directly, and miR-204-3p targeted the insulin-like growth factor binding protein 2 (IGFBP-2) directly. Furthermore, we discovered that PART-1 involved the NSCLC progression by regulating the miR-204-3p-targeted IGFBP-2 pathway. LncRNA PART-1 might be a target for treating NSCLC, and a warning sign of diagnosis of early lung cancer.

C-type lectin CD209/DC-SIGN and CD209L/L-SIGN proteins are distinct cell adhesion and pathogen recognition receptors that mediate cellular interactions and recognize a wide range of pathogens including, viruses such as SARS, SARS-CoV-2, bacteria, fungi and parasites. Pathogens exploit CD209L family proteins to promote infection and evade the immune recognition system. CD209L and CD209 are widely expressed in SARS-CoV-2 target organs and can contribute to infection and pathogenesis. CD209L family receptors are highly susceptible to alternative splicing and genomic polymorphism, which may influence virus tropism and transmission in vivo. The carbohydrate-recognition domain (CRD) and the neck/repeat region represent the key features of CD209L family proteins that are also central to facilitating cellular ligand interactions and pathogen recognition. While, the neck/repeat region is involved in oligomeric dimerization, the CRD recognizes the mannose containing structures present on specific glycoproteins such as those found on the SARS-CoV-2 spike protein. Considering the role of CD209L and related proteins in diverse pathogen recognition, this review article discusses the recent advances in the cellular and biochemical characterization of CD209 and CD209L and their roles in viral uptake, which has important implications in understanding the host-pathogen interaction, the viral pathobiology and driving vaccine development of SARS-CoV-2.

The rapidly evolving field of artificial intelligence (AI) continues to witness the introduction of innovative open-source pre-trained models, fostering advancements in various applications. One such model is Llama 2, an open-source pre-trained model released by Meta, which has garnered significant attention among early adopters. In addition to exploring the foundational elements of the Llama v2 model, this paper investigates how these early adopters leverage the capabilities of Llama 2 in their AI projects. Through a qualitative study, we delve into the perspectives, experiences, and strategies employed by early adopters to leverage Llama 2's capabilities. For the purpose of data analysis, the capabilities inherent in the Llama 2 model were employed to conduct keyword extraction from the context of the early adopters' case studies. The findings shed light on the model's strengths, weaknesses, and areas of improvement, offering valuable insights for the AI community and Meta to enhance future model iterations. Additionally, we discuss the implications of Llama 2's adoption on the broader open-source AI landscape, addressing challenges and opportunities for developers and researchers in the pursuit of cutting-edge AI solutions. The present study constitutes an early exploration of the Llama 2 pre-trained model, holding promise as a foundational basis for forthcoming research investigations.

Manganese porphyrins reportedly exhibit synergic effects when combined with irradiation. However, an in-depth understanding of intratumoral heterogeneity and immune pathways, as affected by Mn porphyrins, remains limited. Here, we explored the mechanisms underlying immunomodulation of a clinical candidate, MnTnBuOE-2-PyP5+ (BMX-001, MnBuOE), using single-cell analysis in murine carcinoma model. Mice bearing 4T1 tumors were divided into 4 groups: control, MnBuOE, radiotherapy (RT), combined MnBuOE and radiotherapy (MnBuOE/RT). In epithelial cells, epithelial-mesenchymal transition, TNF-α signaling via NF-кB, angiogenesis, and hypoxia-related genes were significantly downregulated in the MnBuOE/RT compared to the RT. All subtypes of cancer-associated fibroblasts (CAFs) were clearly reduced in MnBuOE and MnBuOE/RT. Inhibitory receptor-ligand interactions, in which epithelial cells and CAFs interacted with CD8+ T cells, were significantly lower in the MnBuOE/RT than in the RT. Trajectory analysis showed that DC maturation-associated markers were increased in MnBuOE/RT. M1 macrophages were significantly increased in the MnBuOE/RT compared to the RT, whereas myeloid-derived suppressor cells were decreased. CellChat analysis showed that the number of cell-cell communications was the lowest in the MnBuOE/RT. Our study is the first to provide evidence for the combined radiotherapy with a novel Mn porphyrin clinical candidate, BMX-001 from the perspective of each cell-type within the tumor microenvironment.

Objective: The aim of our study was to perform a retrospective analysis of the volume of cervical screening tests, the number of patients treated with an excision method, and the incidence of invasive and non-invasive cervical during a pandemic and pre-pandemic period of 24 months. Results: There was a statistically significant age difference between the two study periods, both by the average age of patients and by age group. The mean difference was 32 years before the pan-demic and 35 years during the pandemic (p-value >0.05). The majority of patients presenting for investigations before and during the pandemic were in the 30-39-year-old age group (31.95%, respectively; 34.2% (p-value = 0.003). The biggest patient loss ratio identified by age group was in the 50–59 years: 14,53% in the pre-pandemic period and 9,1% in the pandemic period. In the pan-demic period, patients from rural areas presented in the clinical trial with a lower rate of 39.52% (83 patients) vs. 60.47% (127 patients) in urban areas. A higher percentage of patients experiencing cervicorrhagia as a clinical manifestation in the pandemic period vs. the prepandemic period, with an increase in more severe lesions in the pandemic period, has a statistical significance of 8% more newly diagnosed compared to the pre-pandemic period. Conclusion: The addressability of the patients during the COVID period was not affected in a drastic way in our study. We encountered a decrease in appointments in the age group 50–59 years and a decrease in patients with rural residence. In our study, we found an increase in cervicorrhagia as a reason for consultation in the pandemic period with a higher lesion degree, both on a pap smear and on a cervical biopsy.

The world is currently going through a serious pandemic of viral infection with SARS-CoV-2, a new isolate of coronavirus, resembling and surpassing the crisis that occurred in 2002 and 2013 with SARS and MERS, respectively. SARS-CoV-2 has currently infected more than 142,000 people, causing 5,000 deaths and reaching more than 130 countries worldwide. The very large spreading capacity of the virus clearly demonstrates the potential threat of respiratory viruses to human health, alarming governments around the world that preventive health policies and scientific research are pivotal to overcoming the crisis. Coronavirus disease 2019 (COVID-19) causes flu-like symptoms in most cases. However, approximately 15% of patients will need hospitalization, and 5% require assisted ventilation, depending on the cohorts studied. What is intriguing, however, is the higher susceptibility of elderly individuals, especially those who are more than 60 years old and have comorbidities, including hypertension, diabetes and heart disease. In fact, the death rate in this group may be up to 10-12%. Interestingly, children are somehow protected and not included as a risk group.Thus, here, we discuss some possibilities of molecular and cellular mechanisms by which elderly subjects may be more susceptible to severe COVID-19. In this sense, we raise two main points: i) increased ACE-2 expression in pulmonary and heart tissue of chronic angiotensin 1 receptor (AT1R) blocker users and hypertensive individuals and ii) antibody-dependent enhancement (ADE) after previous exposure to other circulating coronaviruses. We believe these are pivotal points for a better understanding of the pathogenesis of severe COVID-19 and must be addressed with attention by physicians and scientists in the field.

Build a special identical equation, use its calculation characters to prove and search for solution of any odd converging to 1 equation through (*3+1)/2^k operation, change the operation to (*3+2^m-1)/2^k, and get a solution for this equation, give a specific example to verify. Thus prove the Collatz Conjecture is true. Furthermore, analysis the sequences produced by iteration calculation during the procedure of searching for solution, build a weight function model, prove it decrease progressively to 0, build a complement weight function model, prove it increase to its convergence state. Build a (*3+2^m-1)/2^k odd tree, prove if odd in (*3+2^m-1)/2^k long huge odd sequence can not converge, the sequence must outstep the boundary of the tree after infinite steps of (*3+2^m-1)/2^k operation.

Newly characterising 245 Italian and Albanian HCV-2 NS5B sequences collected between 2001 and 2016 was used to reconstruct the origin and dispersion pathways of HCV-2c. The tree of a subset of these sequences aligned with 247 publicly available sequences was reconstructed in spatio-temporal scale using the Bayesian approach, and the effective replication number (Re) was estimated using the birth-death model. Our findings show that HCV-2c was the most prevalent subtype in Italy and Albania, and that GT2 originated in Guinea Bissau in the XVI century and spread to Europe in the XX century. The HCV-2c subtype had two internal nodes respectively dating back to the 1930s and 1950s having as most probable locations Ghana and Italy, respectively. Phylodynamic analysis revealed an exponential increase in the effective number of infections and Re in both Italy between the 1950s and 1980s, and Albania between the 1990s and the early 2000s. It seems very likely that HCV-2c reached Italy from Africa at the time of the second Italian colonisation (1936-1941), but did not reach Albania until the period of dramatic migration to Italy in the 1990s.

The study aimed to explore the correlation among Angiopoietin-1, (Ang-1) and Angiopoietin-2, (Ang-2) concentrations and the Angiopoietin-2/Angiopoietin-1 ratio, (Ang-2/Ang-1) with clinical outcomes, potentially serving as disease severity and survival biomarkers. A study at AHEPA University Hospital involved 90 COVID-19 adult patients, with 30 hospitalized in intensive care and 30 in ward units and 30 asymptomatic non-hospitalized individuals as controls. Estimated endothelial dysfunction markers related to angiogenesis were measured, and statistical analysis was performed using IBM SPSS Statistics software, version 29. There was a statistically significant difference only between outpatient and hospitalized patients (non-ICU -ICU groups) for the Ang-1 and Ang-2 indexes. The Ang-2/Ang-1 ratio has differed significantly among all individual patient groups. A ROC analysis was conducted to find an optimal threshold for distinguishing (outpatients – non-ICU) and (non-ICU –ICU) groups. It was based on Youden's Index and was 0.1122 and 0.3825, respectively. The Ang-1, Ang-2 levels, and Ang-2/Ang-1 ratio were analysed as indicators for severity in COVID-19 patients. The Ang-2/Ang-1 ratio demonstrated more excellent prognostic and diagnostic utility than individual biomarker levels. Monitoring the Ang-2/Ang-1 ratio can identify COVID-19 patients at risk and assist clinicians in tailoring treatment strategies for improved outcomes.

The thionamide antithyroid drugs were discovered largely following serendipitous observations by numerous researchers in the 1940s who found that sulfhydryl-containing compounds were goitrogenic in animals. Prof. Edwin B. Astwood was the first to use these compounds to treat hyperthyroidism. In this review, we summarize the history of the development of these drugs and the coordination possibility of 2-thiouracil and its derivatives, as well as the biological activities of some of its complexes. Some of them are used as agents for the treatment of tuberculosis, and arthritis, others have bactericidal and fungicidal activity, the third cytotoxic properties, and could be used to treat various types of cancer.

This study investigated the factors affecting consumers’ acceptance to use cashless payment services in Malaysia through the construction of the Cashless Society Acceptance (CSA) model. The Technology Readiness Index 2.0 and Unified Theory of Acceptance and Use of Technology 2 were employed to create the CSA model. A total of 434 questionnaires were collected from Malaysian consumers, aged 18 years and above. The results show that Perceived Usefulness, Perceived Ease of Use, and Discomfort have the most significant influence on the consumers’ acceptance of cashless payment services with R-square of 71.4%.

Objectives Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has high infectivity in humans, attributed to the strong affinity of its spike (S) protein to human angiotensin-converting enzyme 2 (ACE2). Here, we analyzed the structural similarity of the S protein between SARS-CoV-2 and other SARS-related coronaviruses (CoVs). Methods We performed multiple alignment analysis of nine amino acid sequences of CoV S proteins from NCBI with MAFFT web-based software, followed by phylogeny analysis. Three-dimensional structure modeling was performed by SWISS-MODEL. We calculated the template modeling score between the S protein of SARS-CoV-2 and that of other SARS-related CoVs. Results The S1 domain of the unclassified CoV RaTG13 (the host of which is the intermediate horseshoe bat) was structurally very similar to that of SARS-CoV-2, implying that RaTG13 could be the origin of SARS-CoV-2. In addition, the folding property of the entire S protein was nearly the same between SARS-CoV-2 and RaTG13 after the PRRA amino acid insertion was removed from SARS-CoV-2. Conclusions RaTG13 could have a high binding affinity to ACE2, similar to SARS-CoV-2, and it is therefore highly likely to infect other animals. Therefore, massive research and monitoring of CoVs in animals is necessary to prevent future COVID-19-like disasters.

This paper is devoted to the study of reproducing kernels on 2-inner product Hilbert spaces. We focus on a new structure to produce reproducing kernel Hilbert and Banach spaces. According to multi-variable computing, this structures can be useful in electrocardiographs, machine learning and economy

The Xpert® Xpress SARS-CoV-2 and Xpert® Xpress SARS-CoV-2/Flu/RSV tests were rapidly developed and widely used during the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic. In response to emerging genetic variability, a new SARS-CoV-2 target (RNA-dependent RNA-polymerase) has been added to both tests: Xpert® Xpress CoV-2 plus and Xpert® Xpress CoV-2/Flu/RSV plus test. A rapid evaluation of both tests was performed in South Africa, using residual respiratory specimens. Residual respiratory specimens (n=125) were used to evaluate the Xpert® Xpress CoV-2 plus test and included 50 genotyped specimens. The Xpert® Xpress CoV-2/Flu/RSV plus test was assessed using 45 genotyped SARS-CoV-2 specimens, ten influenza A, ten Influenza B and twenty respiratory syncytial virus specimens. Results were com-pared to in-country standard of care tests. Genotyped specimens tested the performance of the test under pressure from circulating SARS-CoV-2 variants of concern. Reference material was included to assess the test limits and linearity. The Xpert® Xpress CoV-2 plus test performance compared to reference results across residual respiratory specimens was good (positive per-centage agreement (PPA)=95.2%, negative percentage agreement (NPA)=95.0%) The Xpert® Xpress CoV-2/Flu/RSV plus test showed good performance across all residual respiratory specimens (PPA=100%, NPA=98.3%). All genotyped variants of concern were detected by both tests. The Xpert® Xpress CoV-2 plus and Xpert® Xpress CoV-2/Flu/RSV plus tests can be used to diagnose SARS-CoV-2, and to diagnose and differentiate SARS-CoV-2, influenza A, influenza B and respiratory syncytial virus respectively. The NPA was lower than the recommended 99%, but was influenced by the low number of negative specimens tested. The variants of concern assessed did not affect test performance. It is recommended that sites perform their own assessments compared to in-country standard of care tests.

Severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) utilizes Angiotensin Converting Enzyme 2 (ACE2) as its main receptor for cell entry. We have bioengineered a soluble ACE2 protein termed ACE2 618-DDC-ABD that has increased binding to SARS-CoV-2 and prolonged duration of action. Here we investigated the protective effect of this protein when administered intranasally to k18-hACE2 mice infected with the aggressive SARS-CoV-2 delta variant. k18-hACE2 mice were infected with the SARS-CoV-2 delta variant by inoculation of a lethal dose (2x104 PFU) and followed for up to 14 days. ACE2-618-DDC-ABD (10mg/kg) or PBS was administered intranasally six hours prior and 24 and 48 hours post viral inoculation. All animals in the PBS-control group had succumbed to the disease on day 7 post infection (0% survival) whereas, by contrast, there was only one casualty in the group that received ACE2-618-DDC-ABD (90% survival). Mice in the ACE2-618-DDC-ABD group had minimal disease as assessed by a clinical score and stable weight and both brain and lung viral titers were markedly reduced. These findings demonstrate the efficacy of a bioengineered soluble ACE2 decoy with extended duration of action in protecting against the aggressive delta SARS-CoV-2 variant. Together with previous work these findings demonstrate the universal protective potential against current and future emerging SARS-CoV-2 variants.

Since December 2019, the worldwide spread of COVID-19 has brought the majority of the world to a standstill, affecting daily lives as well as economy. Under these conditions, it is imperative to develop a cure as soon as possible. On account of some of the adverse side effects of the existing conventional drugs, researchers all around the world are screening natural antiviral phytochemicals as potential therapeutic agents against COVID-19. This paper aims to review interactions of some specific phytochemicals with the receptor binding domain (RBD) of the Spike glycoprotein of SARS-CoV-2 and suggest their possible therapeutic applications. Literature search was done based on the wide array of in-silico studies conducted using broad spectrum phytochemicals against SARS-CoV-2 and other viruses. We shortlisted 26 such phytochemicals specifically targeting the S protein and its interactions with host receptors. To validate the previously published results, we also conducted molecular docking using the AutoDockVina application and identified 6 high potential phytochemicals for therapeutic use based on their binding energies. Besides this, availability of these compounds, their mode of action, toxicity data and cost-effectiveness were also taken into consideration. Our review specifically identifies 6 phytochemicals that can be used as potential treatments for COVID-19 based on their availability, toxicology results and low costs of production. However, all these compounds need to be further validated by wet lab experiments and should be approved for clinical use only after appropriate trials.

SARS-CoV-2, the novel coronavirus behind COVID-19 pandemic is acquiring new mutations in its genome. Although some mutations provide benefits to the virus against human immune response, a number of them may result in their reduced pathogenicity and virulence. By analyzing more than 3000 high-coverage, complete genome sequences deposited in the GISAID database, here I report a unique 28881-28883:GGG>AAC trinucleotide-bloc mutation in the SARS-CoV-2 genome that results in two sub-strains, described here as SARS-CoV-2g (28881-28883:GGG genotype) and SARS-CoV-2a (28881-28883:AAC genotype). Computational analysis and literature review suggest that this bloc mutation would bring 203-204:RG(arginine-glycine)>KR(lysine-arginine) amino acid changes in the nucleocapsid (N) protein affecting the SR (serine-arginine)-rich motif of the protein, a critical region for the transcription of viral RNA and replication of the virus. Thus, 28881-28883:GGG>AAC bloc-mutation is expected to modulate the pathogenicity of the SARS-CoV-2. Remarkably, SARS-CoV-2g and SARS-CoV-2a strains can be linked with the heterogeneity of COVID-19 cases across different regions within and between countries by analyzing existing data. Sequence analysis suggests that severely affected cities, such as Milan, Lombardy, New York, Paris have the predominant presence of SARS-CoV-2g strains, whereas less affected places like Abruzzo, Lyon, Valencia have a relatively higher presence of SARS-CoV-2a, an indication that the latter strain may contribute to the reduced cases of COVID-19. A similar relationship is observed when Netherlands, Portugal are compared with Spain, France and Germany. These analyses suggest that the SARS-CoV-2 has already evolved into a less infective SARS-CoV-2a affecting COVID-19 cases in different regions. The time a country or region needs to acquire SARS-CoV-2a strains may be indicative to the time it would need to overcome the peak of the COVID-19 cases. To confirm these assumptions, prompt retrospective and prospective epidemiological studies should be conducted in different countries to understand the course of pathogenicity of the SARS-CoV-2a and SARS-CoV-2g. Potential drugs can be designed targeting 28881-28883 region of the N protein to modulate virus pathogenicity.

This case study focuses on exploring the potential of biogas as a direct substitute for conventional fossil fuels in industrial applications. Instead of being limited to its common uses as a vehicle fuel or for power generation, this research aims to investigate how biogas can be integrated into industrial processes as an advanced and sustainable energy solution. By conducting a detailed analysis of the financial implications associated with the utilization of landfill gas and gas derived from biomass, a comprehensive understanding of their practical applications in the industrial sector can be obtained. This research goes beyond a superficial examination and delves into the intricate aspects of incorporating biogas as a viable alternative fuel source. When we say that utilizing biogas is technically feasible, it means that the necessary infrastructure and technologies are available to support its integration into industrial processes. This implies that there are existing methods and systems in place that can efficiently harness and utilize biogas for various industrial applications. These technologies ensure a seamless transition from conventional fossil fuels to renewable energy sources, leading to a more sustainable and environmentally friendly industrial landscape. Moreover, the statement that utilizing biogas is economically feasible emphasizes that the financial viability of employing biogas in industrial processes is advantageous. This research explores the potential cost savings and benefits associated with substituting conventional fuels with biogas. By carefully examining the economic aspects, such as initial investments, operational costs, and potential revenue streams, a comprehensive understanding of the financial impact of adopting biogas solutions in the industrial sector can be gained. By expanding and broadening the understanding of the technical and economic feasibility of biogas integration, this research aims to provide valuable insights into the potential of advanced biogas solutions for industrial applications. Indeed, to make biogas a viable and sustainable option as a raw material, it is necessary to establish farming subsidies and financial support specifically tailored for biogas production, similar to the existing support provided for food production. These subsidies and financial incentives play a crucial role in promoting and encouraging the growth of the biogas industry. By establishing such support systems, farmers and other stakeholders in the agricultural sector can be incentivized to participate in the production of biogas. This can involve the utilization of agricultural waste, organic residues, or dedicated energy crops for biogas generation. The financial assistance can help offset the initial investment costs, provide incentives for production, and ensure the economic viability of biogas projects. Moreover, when considering large-scale landfills or situations where industrial demands for energy are relatively low, landfill gas becomes a viable and practical option. Landfill gas, which is generated by the decomposition of organic waste in landfills, can be harnessed and utilized for various industrial purposes. This not only helps in managing waste but also provides a valuable source of renewable energy. In summary, while farming subsidies and financial support are crucial for promoting biogas production, landfill gas remains a viable option for large landfills or situations with minor industrial demands. The combination of these two approaches offers a comprehensive outlook on utilizing biogas as a renewable energy source for industrial applications.

This paper presents ensemble learning of multi-source satellite sensors dataset to obtain better predictive performance of the forest biomass. Spectral, spectral-indices, and spectral-textural features were generated from two optical satellite sensors, Landsat 8 Operational Land Imager (OLI) and Sentinel-2 Multispectral Instrument (MSI). In addition, two radar satellite sensors, Sentinel-1 C-band Synthetic Aperture Radar (CSAR), and Advanced Land Observing Satellite (ALOS-2) Phased Array type L-band Synthetic Aperture Radar (PALSAR-2) were utilized to generate backscattering and backscattering-textural features. The plot-wise above ground biomass data available from five forests in New England region were utilized. Ensemble learning of multi-source satellite sensors dataset was carried out by employing four machine learning regressors namely, Support Vector Machines (SVM), Random Forests (RF), Gradient Boosting (GB), and Multilayer Perceptron (MLP). A five-fold cross-validation method was used to evaluate predictive performance of the multi-source satellite sensors. The integration of multi-source satellite features, comprising of spectral, spectral-indices, backscattering, spectral-textural, and backscattering-textural information, through ensemble learning and cross-validation approach implemented in the research showed promising results (R² = 0.81, RMSE = 46.2 Mg/ha) for the estimation of plots-level forest biomass in New England region.

Understanding the dynamics of humoral immune responses throughout the COVID-19 pandemic is crucial for optimizing vaccine strategies. This study aimed to investigate the impact of infection and vaccine-induced immunity on the Albanian population from August 2021 to August 2022. Two independent samples from the Albanian general population were analyzed using an ELISA method to assess IgG class anti-Spike (S1) and anti-Nucleocapsid (N) SARS-CoV-2 antibodies. The results revealed a robust immune response among vaccinated individuals with prior COVID-19 infection who received only one vaccine dose. In the 2022 cohort, most individuals who received one vaccine dose achieved comparable seropositivity and antibody levels to those who received two doses. However, individuals aged 61 and over required two or three vaccine doses to reach the same level of immune response as the younger population. Notably, the time elapsed since infection or vaccination did not significantly impact the immune response. These findings highlight the importance of hybrid immunity and suggest that one vaccine dose may be sufficient for most individuals with prior COVID-19 infection. However, additional doses are necessary for optimal protection in older individuals. This study provides unique insights into humoral immune response dynamics that can be used to refine ongoing COVID-19 population vaccination strategies for middle-income countries with low vaccination coverage.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection can cause potentially life-threatening coronavirus disease (COVID-19). COVID-19 is a multisystem disease and is associated with significant respiratory distress, systemic hyper inflammation, vasculitis and multi-organ failures. SARS-CoV-2 causes deterioration of numerous systems with increasing evidence implying that COVID-19 affects endothelium and vascular function. The endothelium is important for preserving vascular tone and homeostasis. The overactivation and dysfunction of endothelial cells are significant outcomes of severity in patients with COVID-19. The Angiopoietin 1/Tie 2 pathway plays an important role in endothelium quiescence and vessel stability. The disruption of Angiopoietins/Tie balance affects vessel contact barrier and leads to vessel leakage, and this in turn causes endothelial dysfunction. Although vascular instability through SARS-CoV-2 is associated with endothelial dysfunction, it is still not understood if the virus affects Angiopoietin/Tie axis directly or via other mechanisms such as cytokine storm and/or immune response associated with the infection. This review provides an overview of the impact SARS-CoV-2 has on endothelial function and more specifically the Angiopoietin/Tie pathway.

A green, fast and selective approach for the synthesis of mono-substituted closo-decaborate derivatives [2-B10H9COR]n– has been established via a nucleophilic addition reaction between the carbonyl derivative of closo-decaborate [2-B10H9CO]– and the corresponding Grignard reagent RMgX, where R is the ethyl, iso-propyl, pentyl, allyl, vinyl, and propynyl groups. This approach is accomplished under mild conditions with 70–80% yields. The significance of these derivative is their ability to constitute building blocks for polymeric integration via the allyl, vinyl and propynyl substituents. All products were characterized by 11B, 1H, and 13C NMR, elemental analysis and mass spectrometry.

Searching for bioactive compounds within the huge chemical space is like trying to find a needle in a haystack. Isatin is a unique natural compound which is endowed with different biopertinent activities specially in cancer therapy. Herein, we envisaged that adopting a hybrid strategy of isatin and α,β-unsaturated ketone would afford new chemical entities with strong chemotherapeutic potential. Of interest, compounds 5b and 5g demonstrated significant antiproliferative activities against different cancer genotypes according to NCI assay. Concomitantly, their IC50 against HL-60 cells were 0.38 ± 0.08 and 0.57 ± 0.05, respectively, demonstrating remarkable apoptosis and mod-erate cell cycle arrest at G1 phase. Intriguingly, an impressive safety profile for 5b was reflected by a 37.2 times selectivity against HL-60 over PBMC from a healthy donor. This provoked us to further explore their mechanism of action by in vitro and in silico tools. Conclusively, 5b and 5g stand out as strong chemotherapeutic agents that hold a clinical promise against acute myeloid leukemia.

It is very difficult to repair large bone defects, especially when they have a complex shape. We have developed a new technique to make a desired copy of rabbit bones. A rabbit distal femur was scanned by computed tomography (CT), and a rectangular-shaped beta-tricalcium phosphate (β-TCP) block with 75% porosity was automatically machined using milling tools into a half-scale copy of the distal femur based on the CT data. The β-TCP block was seeded with bone morphogenetic protein-2 and bone marrow cells obtained from the femur and implanted on the periosteum of the femur. At 10 weeks after implantation, most of the β-TCP block had been replaced by bone and a complete copy of the distal femur was reconstructed. Our findings indicate that this technique will be useful in the clinical setting. We also report the representative clinical results of treatment with β-TCP graft in patients with bone defects since 1989.

Abstract: SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus 2) infection is associated, alongside with lung infection and respiratory disease, to cardiovascular dysfunction that occurs at any stage of the disease. This includes ischemic heart disease, arrhythmias, and cardiomyopathies. The common pathophysiological link between SARS-CoV-2 infection and the cardiovascular events is represented by coagulation abnormalities and disruption of factors released by endothelial cells which contribute in maintaining the blood vessels into an anti-thrombotic state. Thus, early alteration of the functionality of endothelial cells, which may be found soon after SARS-CoV-2 infection, seems to represent the major target of SARS CoV-2 disease state and accounts for the systemic vascular dysfunction that leads to detrimental effect in terms of hospitalization and death accompanying the disease. In particular, the molecular interaction of SARS-CoV-2 with ACE2 receptor located in endothelial cell surface, either at the pulmonary and systemic level, leads to early impairment of endothelial function which, in turn, is followed by vascular inflammation and thrombosis of peripheral blood vessels. This highlights systemic hypoxia and further aggravates the vicious circle that compromises the development of the disease leading to irreversible tissue damage and death of patients with SARS CoV-2 infection. The review aims to assess some recent advances to define the crucial role of endothelial dysfunction in the pathogenesis of vascular complications accompanying SARS-CoV-2 infection. In particular, the molecular mechanisms associated to the interaction of SARS CoV-2 with ACE2 receptor located on the endothelial cells are highlighted to support its role in compromising endothelial cell functionality. Finally, the consequences of endothelial dysfunction in enhancing pro-inflammatory and pro-thrombotic effects of SARS-CoV-2 infection are assessed in order to identify early therapeutic interventions able to reduce the impact of the disease in high-risk patients.

Sars-CoV-2 outbreak represents a public health emergency, affecting different regions of the world. Lung is the organ more damaged due to the high presence of Sars-CoV-2 binding receptor ACE2 on epithelial alveolar cells. Severity of infection vary from absence of symptomatology to be more severe, characterized by acute respiratory distress syndrome (ARDS), multiorgan failure and sepsis requiring treatment in Intensive Care Unit (ICU).It is not still clear why in a small percentage of patients immune system is not able to efficiently suppress viral replication. It has been documented as predictive factors for severity and susceptibility affections of cardiovascular system such as heart failure (HF), coronary heart disease (CHD) and risk factors for atherosclerotic progression, hypertension and diabetes among others.Atherosclerotic progression, as chronic inflammation process, is characterized by immune system dysregulation leading to pro-inflammatory pattern, including (Interleukin 6) IL-6, Tumor Necrosis Factor α (TNF-α) and IL-1β raise. Reviewing immune system and inflammation profiles in atherosclerosis and laboratory results report in severe Sars-CoV-2 infection we have supposed a pathogenetic correlation. Atherosclerosis may be a pathogenetic ideal substrate to high viral replication ability leading to adverse outcomes, how reported in patients with cardiovascular factors. Moreover, level of atherosclerotic progression may impact on a different degree of severe infection and in a vicious circle feeding itself Sars-CoV-2 may exacerbate atherosclerotic progression due to excessive and aberrant plasmatic concentration of cytokines.

Background: COVID-19, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a global pandemic affecting approximately 490,000 people and accounting for more than 22,000 deaths and has no generally acceptable cure. Here, the recently resolved 3D structure of SARS-CoV-2 receptor binding domain (RBD) in complex with its receptor-the angiotensin converting enzyme-2 (ACE-2) have provided the basis for screening chemical database for novel entry inhibitors. Methods: Molecular docking protocols have been used to rapidly screen FDA database for high affinity interaction at the SARS-CoV-2-RBD/ACE-2 interface. One of the top candidates, ubrogepant has been selected and further studied using atomistic molecular dynamics simulation method. Results: Molecular docking result showed that ubrogepant (UBR) and darunavir have binding energies of -10.4 kcal/mol. MMPBSA free energy analyses of UBR bound to RBD, ACE-2 and RBD/ACE-2 revealed RBD/ACE-2 > ACE-2 > RBD preference. Network analysis showed that interaction captured in the crystal structure were disrupted in UBR-bound state, hydration of the interface and increased atomic fluctuation within the RBD oligomerization interface and ACE-2 zinc binding site. Conclusions: The ability of ubrogepant to rupture the interaction at the RBD/ACE-2 interface residues of SARS-CoV-2 RBD/ACE-2 complex may result in loss of protein function with direct implication on oligomerization formation in RBD and loss of function in ACE-2 thus, making binding, cellular receptor recognition impossible. General Significance: Ubrogepant represents a new therapeutic candidate in the fight against COVID-19, as it binds with relatively high affinity with free RBD, ACE-2 receptor and SARS-CoV-2 RBD/ACE-2 complex based on binding affinity calculations.

Aims: Spironolactone is a steroidal mineralocoricosteroid receptor antagonist (MRA) used for treatment of resistant hypertension, heart failure and edema. It exerts class specific adverse effects that are shared by other MRAs. Additionally, it exerts unique “off target” steroidal effects that include gynecomastia, impotence and loss of libido in males and menstrual irregularity in females. Together, these have led to a poor tolerability and limited use despite positive results in many randomized, controlled clinical trials. We review the off-target effects of spironolactone that may summate with its MRA action to provide an advantageous profile for prevention or treatment of patients with COVID-19. Methods: Literature review using PubMed Central. Results: The blockade by spironolactone of the androgen receptor should diminish the expression of transmembrane protease serine 2 (TMPRSS2) that has an androgen promoter while its MRA action should enhance the expression of protease nexin1 (PN1) that inhibits furin and plasmin. TMPRSS2, furin and plasmin cooperated to process the SARS-CoV-2 spike protein to increase its high affinity binding to the angiotensin converting enzyme 2 (ACE2) and thereby promote viral cell entry. Its actions as an MRA may reduce inflammation and preserve pulmonary, cardiac and vascular functions. Its anti-plasmin action may combat hemostatic dysfunction. Conclusion: The hypothesis that the off-target effects of spironolactone summate with its MRA actions to provide special benefits for COVID-19 is worthy of direct investigation and clinical trial.

Although the existing paradigm states that CMV reactivation is under control of cellular immune response, the role of humoral counterpart is underestimated. Anti-CMV positive woman after conditioning with Bu-Flu-ATG underwent stem cell transplantation from fully matched, seronegative sibling donor. In immunodeficient recipient fast and significant decrease of specific immune response was observed but reconstitution of marrow-derived B and NK cells was prior thymic origin T cells. The lowest CMV-IgG(89 U/ml) was observed just before CMV viremia. Noteworthy, the sole and exclusive factor of CMV-specific immune response is a residual recipient antibody class IgG. The CMV-quantiferon increase was observed later, but in the first phase immune reconstitution of the PHA-induced IFNγ release was significantly lower than that CMV-induced. It corresponds with NK cells increase at the top of lymphocyte reconstitution and undetected CMV-specific CD8 cells by pentamer technique. Most of NK cells are CD16+, thus are stimulated by residual IgG. In immunocompetent donor the cellular and humoral immune response increases in parallel manner but symptoms of CMV mononucleosis were observed till the increase of specific IgG. Our observations shed light on a unique host-CMV interaction: indicate that significant decrease of CMV-IgG is a good predictor for CMV reactivation during secondary immunodeficiency.

Transglutaminase 2 (TG2) is a critical cancer cell survival factor that activates several signaling pathways to foster drug resistance, cancer stem cell survival, metastasis, inflammation, epithelial mesenchymal transition, and angiogenesis. All-trans retinoic acid (ATRA) and chemotherapy have been the standard treatments for acute promyelocytic leukemia (APL), but clinical studies have shown that arsenic trioxide (ATO), alone or in combination with ATRA, can improve outcomes. ATO exerts cytotoxic effects in a variety of ways by inducing oxidative stress, genotoxicity, altered signal transduction, and/or epigenetic modification. In the present study, we showed that ATO increased ROS production and apoptosis ratios in ATRA-differentiated NB4 leukemia cells and that these responses were enhanced when TG2 was deleted. The combined ATRA+ATO treatment also increased the amount of nuclear factor erythroid 2-related factor 2 (NRF2) transcription factor, an adaptive regulator of cellular oxidative stress response, and proteolytic activity of calpain, resulting in TG2 degradation and reduced survival of WT leukemia cells. We further showed that upon ATO treatment, the induced TG2 protein expression was degraded in the MCF-7 epithelial cell line, and primary peripheral blood mononuclear cells, thereby sensitizing these cell types to apoptotic signals.

The intricate mechanisms of the immune response elicited by vaccines and the interplay between the immune system and the central nervous system (CNS) are poorly understood. This review explores these mechanisms, emphasizing the interplay between the immune system and the central nervous system (CNS). A critical aspect is the examination of how vaccine-induced immune responses can interact with the CNS, influencing neuroinflammation and neuroimmune interactions. Furthermore, the link between vaccination and persistent symptoms observed in long-COVID patients is discussed. Vaccination initiates a complex cascade of events, starting with the production of specific proteins, such as S1/S2 spike proteins, leading to robust immune activation in the axillary lymph nodes. The role of macrophages and antigen-presenting cells (APCs) in cytokine production, antigen presentation, and the stimulation of B and T cells highlights the sophistication of the adaptive immune response. The migration of immune cell-derived exosomes to the brain plays a dynamic role in CNS inflammation, neurodegenerative processes and long COVID. On the other hand, the prolonged presence of viral and vaccine-derived spike proteins may contribute to the complex pathophysiology of Long-COVID, shedding light on the delicate balance between beneficial immune responses and possible adverse neurological outcomes of vaccination. It is worth rigorous monitoring and further research to understand the mechanisms of neuroinflammation and the persistence of spike proteins and their long-term effects on the brain, emphasising the importance of a nuanced approach to vaccine safety and efficacy in the context of COVID-19 and beyond.Principio del formulario

Nucleic acid delivery through extracellular vesicles (EVs) is a well-preserved evolutionary mechanism in all life kingdoms including eukaryotes, prokaryotes, and plants. EVs naturally allow horizontal transfer of native as well as exogenous functional mRNA, that once incorporated in EVs is protected from enzymatic degradation. The possible use of EVs as carriers for vaccine has been investigated showing that EVs expressing recombinant SARS-CoV-2 S protein induced an immune response. Moreover, EV-based vaccines presenting the natural configuration of viral antigens have advantages in conferring long lasting immunization and lower toxicity than synthetic nanoparticles. To overcome the manufacturing limitations of EVs derived from eukaryotic cells, edible plant-derived EVs have been studied as an attractive alternative for vaccine delivery, especially for mucosal administration. We recently showed that EVs obtained from orange juice (oEVs) loaded with SARS-CoV-2 mRNAs protected their cargo from enzymatic degradation and were stable at room temperature for one year. Lyophilized oEVs containing the S1 mRNA were administered to rats by gavage and they induced a specific humoral immune response with generation of blocking antibodies, including IgA, that are the first mucosal barrier in the adaptive immune response. Moreover, a Th1 cytokine secretion occurred, suggesting a specific lymphocyte activation. In conclusion, mRNA-containing oEVs could be used for developing new oral vaccines due to optimal mucosal absorption, resistance to stress conditions, and the ability to stimulate a humoral and cellular immune response.

Objective: Spontaneous infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) after mRNA vaccination causes a marked increase in antibody titer because of the combined effect of vaccine and infection (“hybrid immunity”). In this study, we discuss the significance of the mRNA vaccine booster inoculation that has been repeatedly performed in Japan.Methods: We describe the temporal trends of antibody titers in cases in which antibody titers were markedly increased by hybrid immunization.Results: The antibody titer increased with hybrid immunization and tended to decrease with time. However, several cases maintained high antibody titers for approximately one year after coronavirus disease 2019 (COVID-19 diagnosis), even without booster vaccination.Conclusions: Most Japanese patients naturally infected with COVID-19 were infected after mRNA vaccination, and many maintained high antibody titers due to hybrid immunity. The significance of additional vaccination in hybrid-immunized cases is highly questionable regarding cost-effectiveness and risk-benefit.

Apoptosis, also known as the programmed death of cells, is responsible for maintaining the homeostasis of tissues and this function is carried out by caspases. The process of apoptosis is carried out via two distinct pathways: the extrinsic pathway, which is governed by death receptors, and the intrinsic pathway, also known as the mitochondrial pathway. The BCL-2 protein family encoded by the BCL-2 gene, located at the 18q21.33 chromosomal location, is in charge of regulating the intrinsic pathway, which is responsible for inducing cell death via the permeabilization of the mitochondrial membrane and the release of apoptosis - inducing components. The BCL-2 homology (BH1, BH2, BH3, BH4) domains of this family proteins are crucial for their functioning and their common BH domains allow interactions between members of the same family and can also serve as indications of pro- or anti-apoptotic activity. A direct correlation may be shown between the overexpression of BCL-2 and the postponement of cell death. It has been determined that a change in the expression of BCL-2 is the root cause of a variety of malignancies, including lung, breast, melanoma, and chronic lymphocytic leukemia, Multiple Sclerosis, Diabetes. In this review, we discuss the therapeutic potential of regulating BCL-2 family connections and their relevance to health and disease.

BA.2, a sublineage of Omicron BA.1, is now prominent in many parts of the world. Early reports indicate that BA.2 is more infectious than BA.1. To gain insight into BA.2 mutation profile and the resulting impact of mutations on interaction with receptor and/or monoclonal antibodies, we analyzed available se-quences, structures of Spike/receptor, and Spike/antibody complexes, and conducted molecular dynamics simulations. The results showed that BA.2 has 50 high-prevalent mutations compared to 48 in BA.1. Seventeen BA.1 mutations are not present in BA.2. Instead, BA.2 has 19 unique mutations and a signature Delta variant mutation (G142D). Intriguingly, the BA.2 has 28 signature mutations in Spike, compared to 30 in BA.1. This is due to two revertant mutations S446G and S496G in the receptor-binding domain (RBD), making BA.2 somewhat similar to Wuhan-Hu-1 (WT), which has G446 and G496. The molecular dynamics simulations showed that the RBD consisting of G446/G496 is more stable than S446/S496 containing RBD. Thus, our analyses suggest that BA.2 has evolved with novel mutations (i) to maintain receptor binding similar to WT, (ii) evade the antibody binding greater than BA.1, and (iii) acquire mutation of the Delta variant that may be associated with the high infectivity.

One of the hallmarks of the SARS-CoV-2 infection has been the inflammatory process that played a role in its pathogenesis, resulting in mortality within susceptible individuals. This uncontrolled inflammatory process leads to severe systemic symptoms via multiple pathways, however, the role of endothelial dysfunction and thrombosis have not been truly explored. This review aims to highlight the pathogenic mechanisms of these inflammatory triggers leading to thrombogenic complications. There are direct and indirect pathogenic pathways of the infection that are examined in detail. We also describe the case of carotid artery thrombosis in a patient following the SARS-CoV-2 infection, while reviewing the literature on the role of ACE2, the endothelium, and the different mechanisms by which SARS-CoV-2 may manifest both acutely and chronically. We also highlight differences from the other coronaviruses that have made this infection pandemic with similarities to the influenza virus.